Want to do get up and running with taxonomer quickly? Go to taxonomer.iobio.io
##metagenomics toolkit
###Building the code:
This repository is written in c and python, with cython bringing the two together.
python dependencies -- we HIGHLY recommend using the anaconda distribution of python:
- Python 2.7+
- cython
- biopython
To build, cd into taxonomer/ -- directory where all the code lives, type the following commands:
rm scripts/cython/*.so
rm scripts/cython/*.c
python setup.py build_ext --inplace
####Building a nucleotide database:
To build a database, you must use kanalyze to create the kmer file. You do this with kanalyze, which is available here: http://sourceforge.net/projects/kanalyze/files/ Note that Taxonomer will ignore kmers with sequences in lower case
The following is a command line example of kanalyze with the necessary paramaters (-k is the kmer size):
java -jar kanalyze.jar count -k 31 -d 3 -l 3 -o \<output file\> -m hex -rcanonical -f fasta \<input fasta\>
Then use build_db.py to construct the database for classification
To see help, use python build_db.py -h
####Building a protein database:
To build a protein database, you must follow these steps:
- Use convert_protein_db.py to do necessary conversion before using kanalyze
- Run kanalyze to create kmer file, but with the following arguments (-k is the kmer size, no -rcanonical):
java -jar kanalyze.jar count -k 30 -d 3 -l 3 -o \<output file\> -m hex -f fasta \<input fasta\>
- Use python build_db.py, but specify --protein 1 to build protein database
####Classifying reads
Use classify_reads.py to classify reads. use -h argument to see command line options.
NOTE -- only use --protein 1 if you have already built a database for protein classification.
####Binner database construction
We have empirically found binning using k-mers of 21bp in length to be effective for our research applications. This may or may not be the optimal size for your application, but the commands that follow demonstrate how to construct a binner database using 21bp k-mers.
- Create k-mer count files using kanalze of fasta files of reference nucleotide sequences:
java -jar kanalyze.jar count -k21 -d 3 -l 3 -o \<output file\> -m hex -f fasta \<input fasta\>
-
Merge all k-mer count files using the script binner_merge_kanalyze.py. The help shows the following:
positional arguments:
kmer_counts_1 name of kmer count file in kanalyze hex output format kmer_counts_2 name of kmer count file to merge, must also be in kanalyze hex output format output merged output file
optional arguments:
-h, --help show this help message and exit -id_1 ID_1 integer value used to identify first database, must be a multiple of 2 -id_2 ID_2 integer value used to identify second databse, must be a multiple of 2
The first kmer count file, kmer_counts_1 will have kmer_counts_2 merged into it. Only use the -id_1 or -id_2 tags if the corresponding k-mer count file (kmer_counts_1 and/or kmer_counts_2) haven't already been merged using this script. The reason is that the flags -id_1, -id_2 will overwrite the id field in the file.
For example, suppose we have 3 kmer count files created by kanalyze to merge: k1.kc, k2.kc, k3.kc First, we determine the integer ids to assign to each kmer count file(must be a power of 2) -- n our example let k1.kc, k2.kc, k3.kc be 1, 2, 4 respectively. The commands to achieve this are (only two files can be merged at once):
python binner_merge_kanalyze.py k1.kc k2.kc k1_k2.merged.kc -id_1 1 -id_2 2
python binner_merge_kanalyze.py k1_k2.merged.kc k3.kc all_k.merged.kc -id_2 4
Now the merged file is called all_k.merged.kc
- Build our example database using :
python build_db.py example_binner_db all_k.merged.kc fake.sti fake.fasta -kl 21 -binner
Where example_binner_db is the prefix for the output files that enable running the binner. fake.sti and fake.fasta are placeholders and are in the scripts/ folder. They can be used in any binner database build.
####Creating taxonomic relationship files
Both building databases and classifying sequences requires knowlege about the taxonomic relationships between the organisms in the database. Taxonomer uses two files for this purpose, they have extensions .sti and .tri.
The .sti file is used during the build process. This file assigns every sequence id to a taxonomic id. It is highly recommended that sequence ids in fasta headers of the reference sequences be non negative integers and it is required that taxonomic ids be non negative integers. The .sti file is a modified fasta format with the sequence id in the header and the taxonomic id in the sequence line. For example, suppose we have the following fasta sequence:
>3 some interesting sequence
ATAATATTAGATGTAGATGTTAGTGTAGTGTAGCGCGCGTGTGTGTAGAGA
In the .sti file this sequence could be represented as follows (assuming its assigned taxid is 17):
>3
17
The .tri file is used during classification. This file describes the parent-child relationship of the taxonomy. Like the .sti file, the .tri is a modified fasta format with the taxonomic child in the header and the taxonomic parent in the sequence line. It is required that the .tri be rooted at taxid '1' with 0 as its parent. Thus the following entry must be found in every .tri file:
>1
0
The only retrictions imposed by taxonomer when defining a taxonomy is that every child has exactly 1 parent and the tree be rooted at taxid '1' with 0 as its parent. For this reason, it is possible to apply taxonomer effectively to a very wide range of mapping problems.