forked from cory-ko/KBWS
Keio Bioinformatics Web Service (an EMBASSY package for accessing popular bioinformatics web services)
License
agustin-avila/KBWS
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
------------------------------------------------------------------------- KBWS - KEIO Bioinformatics Web Service - EMBASSY package ver. 1.0.9 Web home: http://www.g-language.org/kbws/ All rights reserved. Copyright (C) 2010 by OSHITA Kazuki. This EMBASSY package is free software for non-commercial and education use only (limited due to wsdl2h); you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, version 2 of the License expect commercial use. See also GNU General Public License Version 2, included in this package as COPYING. ------------------------------------------------------------------------- [ About ]---------------------------------------------------------------- This is an EMBASSY package for the utilization of bioinformatics web servcie. All of the tools included in this package are wrapper programs to utilize KBWS SOAP services, which are web APIs to access numerous bioinformatics web services under unified interface with SOAP 1.1. Detailed documentation about KBWS SOAP services are available at http://www.g-language.org/kbws/. ------------------------------------------------------------------------- [ Installation ]--------------------------------------------------------- REQUIREMENT EMBOSS (> 6.6.0) - This EMBASSY package requires EMBOSS version 6.6.0 or above. INSTALLATION In the following examples, we assume downloaded EMBOSS filename is EMBOSS-latest.tar.gz (EMBOSS-6.6.0) 1. Download and compile EMBOSS source code % wget ftp://emboss.open-bio.org/pub/EMBOSS/emboss-latest.tar.gz (or "curl -O ftp://emboss.open-bio.org/pub/EMBOSS/emboss-latest.tar.gz") % tar xzf EMBOSS-latest.tar.gz % cd EMBOSS-6.6.0 % ./configure % make % sudo make install 2. Make new directory "embassy" (in EMBOSS-6.6.0/ directory) if it does not exist already % mkdir embassy 3. Go into that directory % cd embassy 4. Place KBWS file in current directory % wget http://www.g-language.org/kbws/source/KBWS-1.0.9.tar.gz (or "curl -O http://www.g-language.org/kbws/source/KBWS-1.0.0.tar.gz") 5. Uncompress the KBWS tarball package, and go into the new KBWS directory % tar xzf KBWS-1.0.9.tar.gz % cd KBWS-1.0.9 ( EMBOSS-6.6.0/embassy/KBWS-1.0.9 ) 6. Configure and compile % ./configure (use same options as you used to compile emboss) % make % sudo make install NOTE libtool problem On some systems there may be compatibility problems with different automake, autoconf or libtool versions. If a libtool problem arises you can try deleting the following files: config.cache ltmain.sh ltconfig libtool and then type % aclocal -I m4 % autoconf % automake -a and then retry make. Update of EMBOSS When users are upgrading EMBOSS, please be sure to uninstall old version of EMBOSS and KBWS. If you override them, some older version of files may cause errors. EMBOSS is already installed When EMBOSS is already installed in your system, please install KBWS at the same PATH as existed EMBOSS by '--prefix' option. Non-root users (using '--prefix' option) If you use './configure' command with '--prefix' option, please rewrite 'emboss_acdroot' and 'emboss_data' value in ~/.embossrc file. Please check '~/.embossrc' file for further informations. ------------------------------------------------------------------------- [QuickStart]------------------------------------------------------------- DATABASE DEFINITION The database definitions for following commands are available at "KBWS-1.0.9/data/embossrc-template". The latest version is available at following URL: http://soap.g-language.org/kbws/embossrc INFORMATION OF KBWS TOOLS List of all tools If you want to get list of all tools included in KBWS, you can try the below command. % wossname -showembassy KBWS Documentation You can view available documentations with "tfm" utility included in EMBOSS. % tfm kblast # example for "kblast" USAGE EXAMPLE Sample files used in this section are available from EMBOSS package. ( EMBOSS-6.6.0/test/data/* ) 1. kblast (BLAST) % kblast swissprot:FOXP2_HUMAN -database swissprot -format 8 -eval 1e-100 Search similar sequences in public repositories using BLAST Output file [foxp2_human.kblast]: % cat foxp2_human.kblast query sp|Q8MJ98.3|FOXP2_PONPY 99 457 1 0 240 697 238 695 0.0 2005 query sp|Q5QL03.1|FOXP2_HYLLA 99 457 1 0 240 697 238 695 0.0 2005 query sp|Q8MJ99.1|FOXP2_GORGO 99 457 1 0 240 697 238 695 0.0 2005 query sp|Q8MJA0.1|FOXP2_PANTR 99 457 1 0 240 697 241 698 0.0 2005 query sp|P58463.2|FOXP2_MOUSE 99 457 1 0 240 697 239 696 0.0 2005 query sp|Q8MJ97.1|FOXP2_MACMU 99 457 1 0 240 697 239 696 0.0 2005 query sp|O15409.2|FOXP2_HUMAN 100 458 0 0 240 697 240 697 0.0 2005 query sp|P0CF24.1|FOXP2_RAT 99 456 2 0 240 697 235 692 0.0 2000 query sp|Q4VYS1.1|FOXP2_XENLA 95 450 8 0 240 697 231 688 0.0 1948 query sp|Q5W1J5.1|FOXP1_XENLA 68 373 87 6 240 697 105 560 8e-148 1350 query sp|A4IFD2.1|FOXP1_BOVIN 66 371 89 6 240 697 201 656 4e-146 1335 query sp|Q9H334.1|FOXP1_HUMAN 66 372 89 7 240 697 203 659 2e-144 1321 query sp|Q498D1.1|FOXP1_RAT 65 371 90 7 240 697 237 693 9e-144 1315 query sp|P58462.1|FOXP1_MOUSE 65 372 89 7 240 697 231 687 1e-143 1314 query sp|Q58NQ4.1|FOXP1_CHICK 65 369 92 7 240 697 212 668 1e-143 1313 query sp|Q8IVH2.1|FOXP4_HUMAN 60 332 119 5 240 686 201 650 6e-131 1204 query sp|Q9DBY0.1|FOXP4_MOUSE 60 332 118 17 240 686 207 642 2e-126 1166 query sp|Q4VYR7.1|FOXP4_XENLA 58 336 120 20 241 696 187 622 6e-126 1161 2. kcentroidfold (Centroid Fold) % kcentroidfold RNA 2D structure prediction from an RNA sequence using CentroidFold Input (gapped) sequence(s): dna.fasta Output image file name [kcentroidfold.png]: Output file [fasta.centroidfold]: % cat fasta.centroidfold >FASTA ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ((((((((((((((((((((((((((((((((((((((((((((((((....)))))))))))))))))))))))))))))))))))))))))))))))) % ls kcentroidfold.png kcentroidfold.png 3. kweblogo (WebLogo) % kweblogo dna.m-fasta -filename kweblogo.png make the generation of sequence logos using WebLogo Output file name [kweblogo.png]: % ls kweblogo.png kweblogo.png SAMPLE DATA You can use sample data included in EMBOSS. Please check test/ directory in EMBOSS package. ------------------------------------------------------------------------- [ Content ]-------------------------------------------------------------- gSOAP Toolkit This EMBASSY package is depended on gSOAP Toolkit to use SOAP transfer, which is included in gsoap/ directory and automatically used during compilation. ------------------------------------------------------------------------- [Contact]---------------------------------------------------------------- Kazuki Oshita < cory@g-language.org > Institute for Advanced Biosciences, Keio University. -------------------------------------------------------------------------
About
Keio Bioinformatics Web Service (an EMBASSY package for accessing popular bioinformatics web services)
Resources
License
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published