SeqScan locate pattern matches in nucleotide and protein sequences. A pattern consists of one or more pattern units (see pattern section). A pattern match is a substring of the sequence that satisfies the criteria of all pattern units.
Usage: seqscan [options] <file(s)>
[options]:
-h --help Print this help menu.
-p --pattern <pattern> Pattern to use, see the pattern
section in the documentation.
-P --pattern_file <string> File with list of patterns, one
per line.
-c --complement <forward|reverse|both> Scan the forward, reverse or
both strands
(default=forward).
-d --direction <forward|reverse> Scan direction
(default=forward).
-s --start <int> Start scanning position
(default=1).
-e --end <int> End scanning position.
-t --threads <int> Threads to use (default=1).
-E --score_encoding <Phred33|Phred64> Specify FASTQ score encoding
(default=Phred33).
-S --score_min <int> Minimum Phred score in matches.
-a --ambiguate Ambiguate residues with score
below the minimum Phred score.
-m --match_type <int> Match type used (default=6):
Features:
N: Nucleotide.
P: Protein.
A: Ambiguity codes.
I: Case insensitive.
Match type Sequence Pattern
---------- -------- -------
1 N N
2 NI NI
3 NA N
4 NIA NI
5 N NA
6 NI NIA (default)
7 NA NA
8 NIA NIA
9 P P
10 PI PI
-M --match_file <string> File with custom match type
matrices.
-o --output <string> Output file.
-O --overlap Output overlapping matches.
-f --filter <filter> Filter matches, see the filter
section in the documentation.
-v --version Output program version.
-V --verbose Enable verbose messages.
Documentation: https://github.com/BIO-DIKU/SeqScan
Below links are currently not functional - do ignore.
SeqScan compiles with C++11 support but has no dependencies on other external libraries. To prepare makefiles for release versions of the library and executable, download the source code (see above) and type:
$ tar -xzvf SeqScan-latest-src.tar.gz
$ cd SeqScan-latest-src
$ mkdir SeqScan-build
$ cd SeqScan-build
$ cmake ../SeqScan-latest-src
After running make
, the static library will be in SeqScan-build/libseqscan.a
and the executable in SeqScan-build/seqscan. To install in the system folders
type make install
.
To prepare makefiles for debugging, instead type:
$ mkdir SeqScan-debug
$ cd SeqScan-debug
$ cmake -DCMAKE_BUILD_TYPE=Debug ../SeqScan-latest-src
Patterns consist of one or more pattern units of the types: exact, approximate,
range, and match group. One or more pattern units can be collected in
composites and both pattern units and composites can have named backreferences.
Below =~
indicates a search for a match and =>
indicates the resulting
matches. Matches are given as match position, match length, edit distance, and
matched sequence substring.
An exact pattern unit is the simplest form of pattern, and will match a
sequence (to the left of =~
) if the pattern (to the right of =~
) is a
subsequence:
GAGATCGAG =~ ATC => 4,3,0,ATC
An approximate pattern unit is any pattern unit with edit modifiers except composites.
Mismatches: allow a number of non-matching residues:
ATGCA =~ TAC/1,0,0 => 2,3,1,TGC
Insertions: allow a number of extra pattern residues:
GTAACG =~ TAC/0,1,0 => 2,4,1,TAAC
Deletions: allow a number of missing pattern residues:
GTCG =~ TAC/0,0,1 => 2,2,1,TC
Edits: allow a number of mismatches, insertions and deletions:
TAACGTCGTGC =~ TAC/1 => 1,2,1,TA and 1,3,1,TAA and 2,3,1,AAC and 1,4,1,TAAC
and 6,2,1,TC and 9,3,1,TGC
Mismatches, indels: allow a number of mismatches and a number of insertions and deletions (indels):
TAACGTCGTGC =~ TAC/0,1 => 1,2,1,TA and 3,1,1,AC and 1,4,1,TAAC and 6,2,1,TC
The reverse and reverse-complement operators can be applied to exact and approximate pattern units as well as composites and backreferences.
The reverse operator <
indicates that the pattern unit will match the reverse
sequence:
GAGCTAGAG =~ <ATC => 4,3,0,CTA
The reverse-complement operator ~
indicates that the pattern unit will match
the reverse-complement sequence:
GAGGATGAG =~ ~ATC => 4,3,0,GAT
It is possible to combine the reverse and reverse-complement operators (in any order) to match the complement sequence:
GAGTAGGAG =~ <~ATC => 4,3,0,TAG
The or operator |
can be used to evaluate multiple pattern units, composites,
and backreferences such that if any match, then the pattern matches:
TAGATAC =~ TAC|TAG => 1,3,0,TAG and 4,3,0,TAC
Multiple pattern units can be collected in composite pattern units using parentheses:
ACTGTGT =~ (T ~AC)|ACT => 1,3,0,ACT and 5,1,0,T;6,2,0,GT
Repetitions can be added to pattern units and backreferences so a series of submatches must occur.
Repetitions: allows a number of repetitions:
GTACTACG =~ TAC{2} => 2,3,0,TAC;5,3,0TAC
Closed repetitions: allows a minimum and a maximum of repetitions:
GTACTACTACTACG =~ TAC{2,3} => 2,3,0,TAC;5,3,0,TAC;8,3,0,TAC
NB. SeqScan have greedy behavior so it will match as much as possible.
Open repetitions: allow a minimum of repetitions:
GTACTACTACTACG =~ TAC{2,} => 2,3,0,TAC;5,3,0,TAC;8,3,0,TAC;11,3,0,TAC
This allows for shorthands using the Kleene *
and +
modifiers indicating
zero or more matches, and one or more matches, respectively. E.g. TAC*
is
equal to TAC{0,}
and TAC+
is equal to TAC{1,0}
.
It is also possible to add edit modifiers to repetitions:
Exact repetitions:
ATGCTGCA =~ TAC/1,0,0{2} => 2,3,1,TGC;5,3,1,TGC
(but it will not match the sequence ATGCTACA)
Approximate repetitions:
ATGCTACA =~ TAC{2}/1,0,0 => 2,3,1,TGC;5,3,0,TAC
The .
character can be used as a wildcard in exact and approximate pattern
units:
GAGTGCG =~ A.T.C => 2,5,0,AGTGC
A range pattern unit can be used between exact and approximate pattern units to
indicate a range of matching sequence. A range unit is basically a wildcard
with a closed repetition e.g. .{20,30}
which can be replaced by the shorthand
20..30
or the synonym 20...30
.
CAGCCCTGC =~ AG 2..4 TG => 2,2,0,AG;4,3,0,CCC;7,2,0,TG
It is possible to assign pattern units to named variables, which can be used as backreferences.
Named pattern:
GATATG =~ p1=.A p1 => 2,2,0,AT;4,2,0,AT
Named composite:
ATGTTGTA =~ p1=(T ~AC) p1 => 2,3,0,TGT;5,3,0,TGT
Nested named pattern:
GACGTACGTG =~ p2=(p1=AC ~p1) p2 => 2,2,0,AC;4,2,0,GT;6,2,0,AC;8,2,0,GT
Nested named composite:
ATGTTGTTGTTGTA =~ p2=(p1=(T ~AC) p1) p2 =>
2,1,0,T;3,2,0,GT;5,1,0,T;6,2,0,GT;8,1,0,T;9,2,0,GT;11,1,0,T;12,2,0,GT
Match groups are pattern units that match a set of specified residues. It is
possible to use the non-match operator ^
as the first character to indicate
that no residues in the match group will be matched (do not confuse with the
match anchor ^
):
ACTT =~ [AT] => 1,1,0,A and 3,1,0,T and 4,1,0,T
GCAGTTAAG =~ [AT]+ => 3,1,0,A and 5,4,0,TTAA
GCAGTTAAG =~ [^AT]+ => 1,2,0,GC and 4,1,0,G and 9,1,0,G
Anchors can be applied to any pattern unit. The start anchor ^
only accept
pattern unit matches at the start of the sequence:
ATCATC =~ ^ATC => 1,3,0,ATC
The end anchor $
only accept pattern unit matches at the end of the
sequences:
ATCATC =~ ATC$ => 4,3,0,ATC
Using both anchors will only accept patterns units matching the full sequence:
ATC =~ ^ATC$ => 1,3,0,ATC
Pattern units may contain ambiguity codes for nucleotides in the pattern and sequence as defined in the Match Matrix. Pattern units may be case insensitive as defined in the Match Matrix. See Match Matrix section for details.
The SeqScan output is a four column table separated by tabs and with the following columns:
- ID - ID of sequence matched.
- Strand - Strand matched:
-
- is forward strand.
-
- is reverse strand.
- . is used for proteins.
- Match - Semicolon separated list of submatches from the pattern units of the pattern. Each submatch is a comma separated list of:
- Submatch start position (1-indexed).
- Length of submatch.
- Edit distance of submatch.
- Submatch sequence.
- Length - Total length of pattern match.
Each line in the output contains one pattern match.
seq1 + 3,4,0,TGCG;8,4,0,TGAT 8
seq1 + 51,4,1,TACG;56,4,0,TGAT 8
seq1 - 20,4,0,TGCG;25,4,1,TGAA 8
Here we illustrate how to locate all matches for a 20 bases hybridization probe allowing for 3 mismatches and 2 indels. Imagine a FASTA file named input.fna with the following entry:
>test
TCAGTACGACACTACTAGCSGGTRTGAACTAGTGACTGATCGACTCAGTT
To search for the hybridization probe we do ($
indicates command-line
prompt):
$ seqscan -p 'TAGCTAGCSGCTRTGACTAG/3,2' input.fna
And we get the following output:
test + 12,21,3,CTACTAGCSGGTRTGAACTAG 21
An alignment of the pattern and the hit demonstrates that this was procured by using one mismatch and two indels:
pattern -TAGCTAGCSGCTRTGACTAG-
|| ||||||| |||||||||
hit GTA-CTAGCSGGTRTGaACTAG
Tetraloops are short hairpins capped by a four nucleotide loop:
https://en.wikipedia.org/wiki/Tetraloop
To find all tetraloops in the FASTA file named input.fna with the following entries:
>test1
AGATGATAGTATGGTGNRAACCATAGATGATGAT
>test2
AGATGATAGTATGGTGNRAACGATAGATGATGAT
>test3
AGATGATAGTATGGTGNRAACGAAGATGATGAT
Now we run SeqScan with the following pattern where we save any 4 to 6
residues in the variable p1 (p1=4..6
), then allow any 4 residues (.{4}
),
which must be followed by a match of the reverse-complement of p1 (~p1
):
$ seqscan -p 'p1=4..6 .{4} ~p1' -o hits.tsv input.fna
Which will give the following output in the hits.tsv file:
test1 + 11,5,0,ATGGT;16,4,0,GNRA;20,5,0,ACCAT 14
We can also allow a mismatch in the stem by adding an edit modifier to the backreference:
$ seqscan -p 'p1=4..6 .{4} ~p1/1,0,0' -o hits.tsv input.fna
So now we get:
test1 + 11,5,0,ATGGT;16,4,0,GNRA;20,5,0,ACCAT 14
test2 + 11,5,0,ATGGT;16,4,0,GNRA;20,5,1,ACGAT 14
Or we can allow a mismatch and an indel, the latter allowing a bulge in the stem:
$ seqscan -p 'p1=4..6 .{4} ~p1/1,1' -o hits.tsv input.fna
And so getting:
test1 + 11,5,0,ATGGT;16,4,0,GNRA;20,5,0,ACCAT 14
test2 + 11,5,0,ATGGT;16,4,0,GNRA;20,5,1,ACGAT 14
test3 + 11,5,0,ATGGT;16,4,0,GNRA;20,4,1,ACGA 13
Here we search for a particular protein motif consisting of 0 to 4 residues in
the variable p1 (p1=0..4
) that must by exactly 1 of the residues H, Q or D
([HQD]
), followed by any 1 to 3 residues (1..3
), followed by exactly 1
residue that cannot be H or K ([^HK]
) and finally followed by p1. So for the
following FASTA entry in the file input.faa:
>test
MENDQYWVDAACYWVPSTRNE
We use SeqScan like this:
$ seqscan -p 'p1=0..4 [HQD] 1..3 [^HK] p1' input.faa
And we get the following hit:
test . 6,3,0,YWV;9,1,0,D;10,2,0,AA;12,1,0,C;13,3,0,YWV 10
In silico PCR is a search for two approximate pattern units separated by a range:
https://en.wikipedia.org/wiki/In_silico_PCR
It can be done like this (\
denotes a line break):
$ seqscan -p 'GACTAGCTAGCTTGACGTAG/2,1 500..3000 \
~GTTAGCTAGGGGCTGACGTG/2,1' -c both input.fna
Notice that the primers in the pattern are specified in the 5'-3' orientation,
and that we use the reverse-complement operator ~
on the reverse primer.
The H/ACA box small nucleolar RNA have a secondary structure with a rabbit ear-like secondary structure:
https://en.wikipedia.org/wiki/Small_nucleolar_RNA
It is possible to locate these like this:
$ seqscan -p 'p1=4..8 4..8 p2=4..8 .{4} ~p2/1 4..8 ~p1/1 0..4 ANANNA \
0..4 p3=4..8 4..8 p4=4..8 .{4} ~p4/1 4..8 ~p3/1 0..4 \
ACANNN' -c both input.fna
Using the -o/--overlap
option causes SeqScan to output all overlapping
matches.
Imagine a FASTA file with the following entry:
>test1
AAAA
If we search without the --overlap
option:
$ seqscan -p 'AA'
We get the output:
test1 + 1,2,0,AA 2
test1 + 3,2,0,AA 2
But with the --overlap
option:
$ seqscan -o -p 'AA'
We get:
test1 + 1,2,0,AA 2
test1 + 2,2,0,AA 2
test1 + 3,2,0,AA 2
If the input data is in FASTQ format then the quality scores will be considered
when matching residues if the -s/--score_min
option is used. When the
-s/--score_min
option is used then a pattern will fail to match any residue
with a score below the minimum score. However, if the -a/--ambiguate
option
is used then all residues with a score below the minimum score will match.
Read about quality scores here:
https://en.wikipedia.org/wiki/FASTQ_format
Use the -M/--match_file
to read a given match matrix. The file must contain
one or two matrices, where the first describes how sequences match, and the
second optional matrix describes how complemented sequences match. The latter is
only relevant for nucleotide sequences.
The first row denotes sequence residues and the first column denotes pattern
residues. Below is an example of a match file with matrices for matching only
uppercase DNA/RNA and complement matching of the same (if the ~
operator is
used a complement matrix must also be defined). Matching residues are indicated
by +
in the row and column intersection.
ACGTU
A+
C +
G +
T ++
U ++
~ACGTU
A ++
C +
G +
T+
U+
Below are the default (--match_type 6
) match matrices used for the
case-insensitive matching of nucleotides allowing for ambigius residues in the
pattern but not in the scanned sequence:
ACGTUacgtu
A+ +
C + +
G + +
T ++ ++
U ++ ++
R+ + + +
Y + ++ + ++
W+ +++ ++
S ++ ++
M++ ++
K +++ +++
H++ ++++ ++
D+ ++++ +++
V+++ +++
B ++++ ++++
N++++++++++
a+ +
c + +
g + +
t ++ ++
u ++ ++
r+ + + +
y + ++ + ++
w+ +++ ++
s ++ ++
m++ ++
k +++ +++
h++ ++++ ++
d+ ++++ +++
v+++ +++
b ++++ ++++
n++++++++++
~ACGTUacgtu
A ++ ++
C + +
G + +
T+ +
U+ +
R + ++ + ++
Y+ + + +
W+ +++ ++
S ++ ++
M +++ +++
K++ ++
H+ ++++ +++
D++ ++++ ++
V ++++ ++++
B+++ +++
N++++++++++
a ++ ++
c + +
g + +
t+ +
u+ +
r + ++ + ++
y+ + + +
w+ +++ ++
s ++ ++
m +++ +++
k++ ++
h+ ++++ +++
d++ ++++ ++
v ++++ ++++
b+++ +++
n++++++++++
Results can be filtered using arithmetic predicates on reference variables.
Multiple predicates can be combined with the logical operators AND (&&
) and
OR (||
).
The following functions are defined on a reference, p:
- length(p) - The lengths of substrings matched by p.
- rescount(p, r) - The number of residues of type r in substrings matched by p.
Match length must be greater than 6:
$ seqscan -p 'p1=(A 0..4 GC 0..4 T)' -f 'length(p1) > 6'
Range lengths must be greater than 4:
$ seqscan -p 'A p1=0..4 GC p2=0..4 T' -f 'length(p1) + length(p2) > 4'
First range must be at least twice the length of the second range:
$ seqscan -p 'A p1=0..4 GC p2=0..4 T' -f 'length(p1) >= 2 * length(p2)'
ATG repeats that are either 9 or 18 residues:
$ seqscan -p 'p1=ATG{3,6}' -f 'length(p1) == 9 || length(p1) == 18'
GC-content of match must be at least 0.75:
$ seqscan -p 'p1=(A p2=0..4 GC p3=0..4 T)' \
-f 'rescount(p1, G) + rescount(p1, C) >= 0.75 * length(p1)'
Copyright (C) 2015 BIO-DIKU - All rights reserved.
GNU General Public License version 2
http://www.gnu.org/copyleft/gpl.html
All generic disclaimers apply.
SeqScan is based on ideas from scan_for_matches which was developed in 1987 by Ross Overbeek, David Joerg and Morgan Price and based on earlier ideas from David Searls.
https://github.com/BIO-DIKU/SeqScan
Manuscript is in preparation. Until published, please cite:
https://github.com/BIO-DIKU/SeqScan
Please report bugs: