TakashiMatsuda/ractIP_alifold
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
= RactIP for predicting RNA-RNA interaction using integer programming == Requirements * Boost C++ Library (>=1.42.0) ((<URL:http://www.boost.org/>)) * Vienna RNA package (>= 1.8) ((<URL:http://www.tbi.univie.ac.at/~ivo/RNA/>)) * GNU Linear Programming Kit (>=4.41) ((<URL:http://www.gnu.org/software/glpk/>)) or Gurobi Optimizer (>=2.0) ((<URL:http://www.gurobi.com/)) or ILOG CPLEX (>=12.0) ((<URL:http://http://www-01.ibm.com/software/integration/optimization/cplex/>)) == Install For GLPK, ./configure --with-vienna-rna=/path/to/vienna-rna --with-glpk For Gurobi, ./configure --with-vienna-rna=/path/to/vienna-rna --with-gurobi For CPLEX, ./configure --with-vienna-rna=/path/to/vienna-rna --with-cplex You may have to specify the include path and the library path by CPPFLAGS and LDFLAGS like env CPPFLAGS='-I/path/to/gurobi/include' LDFLAGS='-L/path/to/gurobi/lib' \ ./configure --with-vienna-rna=/path/to/vienna-rna --with-gurobi Then, make make install == Usage (({ractip})) can take two FASTA formatted RNA sequences as input, the predict their joint secondary structures. % ractip: [options] fasta1 fasta2 -h: show this message -p: do not use the constraints for interenal pseudoknots -a alpha: weight for hybridation probabilities (default: 0.5) -t th_bp: threshold of base-pairing probabilities (default: 0.5) -u th_hy: threshold of hybridazation probabilities (default: 0.2) -m: use McCaskill model (default: CONTRAfold model) -i: allow isolated base-pairs -n n_th: specify the number of threads (default: 1) % ractip DIS.fa DIS.fa >DIS CUCGGCUUGCUGAGGUGCACACAGCAAGAGGCGAG ((((.(((((((..[[[[[[.)))))))...)))) >DIS CUCGGCUUGCUGAGGUGCACACAGCAAGAGGCGAG ((((.(((((((..]]]]]].)))))))...)))) The parenthesis '()' and the brackets '[]' indicate the predicted internal base-pairs and external base-pairs (interactions), respectively. == References * Kato, Y., Sato, K., Hamada, M., Watanabe, Y., Asai, K., Akutsu, T.: RactIP: fast and accurate prediction of RNA-RNA interaction using integer programming. Bioinformatics, 26(18):i460-i466, 2010.
About
ractIP+CentroidAlign
Resources
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published