/* * dump * * Outputs the contents of the general purpose registers */ void GPR::dump() { std::string headings[] = {"R0-R7: ", "R8-R15: ", "R16-R23: ", "R24-R31: "}; int32_t i, j; std::cout << "General Purpose Registers:\n"; for (j = 0, i = 0; j < 4; j++, i+=8) { std::cout << headings[j]; dumpRow(i, 8); } std::cout << "\n"; }
void submitRefToFiles(struct sqlConnection *conn, struct sqlConnection *conn2, struct sqlConnection *connSp, char *ref, char *fileRoot, char *inJax) /* Create a .ra and a .tab file for given reference. */ { /* Initially the tab file will have some duplicate lines, so * write to temp file, and then filter. */ char raName[PATH_LEN], tabName[PATH_LEN], capName[PATH_LEN]; FILE *ra = NULL, *tab = NULL, *cap = NULL; struct dyString *query = dyStringNew(0); struct sqlResult *sr; char **row; char *pubMed; struct slName *list, *el; boolean gotAny = FALSE; struct hash *uniqImageHash = newHash(0); struct hash *captionHash = newHash(0); int imageWidth = 0, imageHeight = 0; char path[PATH_LEN]; struct dyString *caption = dyStringNew(0); struct dyString *copyright = dyStringNew(0); struct dyString *probeNotes = dyStringNew(0); boolean lookedForCopyright = FALSE; safef(raName, sizeof(raName), "%s.ra", fileRoot); safef(tabName, sizeof(tabName), "%s.tab", fileRoot); safef(capName, sizeof(capName), "%s.txt", fileRoot); tab = mustOpen(tabName, "w"); cap = mustOpen(capName, "w"); sqlDyStringPrintf(query, "select authors,journal,title,year from BIB_Refs where "); sqlDyStringPrintf(query, "_Refs_key = '%s'", ref); sr = sqlGetResultVerbose(conn, query->string); row = sqlNextRow(sr); if (row == NULL) errAbort("Can't find _Refs_key %s in BIB_Refs", ref); /* Make ra file with stuff common to whole submission set. */ ra = mustOpen(raName, "w"); fprintf(ra, "submissionSource MGI\n"); fprintf(ra, "acknowledgement Thanks to the Gene Expression Database group at " "Mouse Genome Informatics (MGI) for collecting, annotating and sharing " "this image. The MGI images were last updated in VisiGene on March 28, 2006. " "Additional and more up to date annotations and images may be available " "directly at <A HREF='http://www.informatics.jax.org' target='_blank'>MGI.</A>\n"); fprintf(ra, "submitSet jax%s\n", ref); fprintf(ra, "taxon 10090\n"); /* Mus musculus taxon */ fprintf(ra, "fullDir http://hgwdev.gi.ucsc.edu/visiGene/full/inSitu/Mouse/jax\n"); fprintf(ra, "thumbDir http://hgwdev.gi.ucsc.edu/visiGene/200/inSitu/Mouse/jax\n"); fprintf(ra, "setUrl http://www.informatics.jax.org/\n"); fprintf(ra, "itemUrl http://www.informatics.jax.org/searches/image.cgi?%%s\n"); fprintf(ra, "abUrl http://www.informatics.jax.org/searches/antibody.cgi?%%s\n"); fprintf(ra, "journal %s\n", row[1]); fprintf(ra, "publication %s\n", row[2]); fprintf(ra, "year %s\n", row[3]); /* The contributor (author) list is in format Kent WJ; Haussler DH; format in * Jackson. We convert it to Kent W.J.,Haussler D.H., format for visiGene. */ fprintf(ra, "contributor "); list = charSepToSlNames(row[0], ';'); for (el = list; el != NULL; el = el->next) { char *lastName = skipLeadingSpaces(el->name); char *initials = strrchr(lastName, ' '); if (initials == NULL) initials = ""; else *initials++ = 0; fprintf(ra, "%s", lastName); if (initials[0] != 0) { char c; fprintf(ra, " "); while ((c = *initials++) != 0) fprintf(ra, "%c.", c); } fprintf(ra, ","); } fprintf(ra, "\n"); slNameFreeList(&list); sqlFreeResult(&sr); /* Add in link to PubMed record on publication. */ dyStringClear(query); sqlDyStringPrintf(query, "select ACC_Accession.accID from ACC_Accession,ACC_LogicalDB " "where ACC_Accession._Object_key = %s " "and ACC_Accession._LogicalDB_key = ACC_LogicalDB._LogicalDB_key " "and ACC_LogicalDB.name = 'PubMed'", ref); pubMed = sqlQuickStringVerbose(conn, query->string); if (pubMed != NULL) fprintf(ra, "pubUrl https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=%s\n", pubMed); freez(&pubMed); dyStringClear(query); sqlDyStringPrintf(query, "select distinct MRK_Marker.symbol as gene," "GXD_Specimen.sex as sex," "GXD_Specimen.age as age," "GXD_Specimen.ageMin as ageMin," "GXD_Specimen.ageMax as ageMax," "IMG_ImagePane.paneLabel as paneLabel," "ACC_Accession.numericPart as fileKey," "IMG_Image._Image_key as imageKey," "GXD_Assay._ProbePrep_key as probePrepKey," "GXD_Assay._AntibodyPrep_key as antibodyPrepKey," "GXD_Assay._ReporterGene_key as reporterGeneKey," "GXD_FixationMethod.fixation as fixation," "GXD_EmbeddingMethod.embeddingMethod as embedding," "GXD_Assay._Assay_key as assayKey," "GXD_Specimen.hybridization as sliceType," "GXD_Specimen._Genotype_key as genotypeKey," "IMG_ImagePane._ImagePane_key as imagePaneKey\n" "from MRK_Marker," "GXD_Assay," "GXD_Specimen," "GXD_InSituResult," "GXD_InSituResultImage," "GXD_FixationMethod," "GXD_EmbeddingMethod," "IMG_ImagePane," "IMG_Image," "ACC_Accession\n" "where MRK_Marker._Marker_key = GXD_Assay._Marker_key " "and GXD_Assay._Assay_key = GXD_Specimen._Assay_key " "and GXD_Specimen._Specimen_key = GXD_InSituResult._Specimen_key " "and GXD_InSituResult._Result_key = GXD_InSituResultImage._Result_key " "and GXD_InSituResultImage._ImagePane_key = IMG_ImagePane._ImagePane_key " "and GXD_FixationMethod._Fixation_key = GXD_Specimen._Fixation_key " "and GXD_EmbeddingMethod._Embedding_key = GXD_Specimen._Embedding_key " "and IMG_ImagePane._Image_key = IMG_Image._Image_key " "and IMG_Image._Image_key = ACC_Accession._Object_key " "and ACC_Accession.prefixPart = 'PIX:' " "and GXD_Assay._ImagePane_key is NULL " ); sqlDyStringPrintf(query, "and GXD_Assay._Refs_key = '%s'", ref); sr = sqlGetResultVerbose(conn, query->string); fprintf(tab, "#"); fprintf(tab, "gene\t"); fprintf(tab, "probeColor\t"); fprintf(tab, "sex\t"); fprintf(tab, "age\t"); fprintf(tab, "ageMin\t"); fprintf(tab, "ageMax\t"); fprintf(tab, "paneLabel\t"); fprintf(tab, "fileName\t"); fprintf(tab, "submitId\t"); fprintf(tab, "fPrimer\t"); fprintf(tab, "rPrimer\t"); fprintf(tab, "abName\t"); fprintf(tab, "abTaxon\t"); fprintf(tab, "abSubmitId\t"); fprintf(tab, "fixation\t"); fprintf(tab, "embedding\t"); fprintf(tab, "bodyPart\t"); fprintf(tab, "sliceType\t"); fprintf(tab, "genotype\t"); fprintf(tab, "strain\t"); fprintf(tab, "priority\t"); fprintf(tab, "captionId\t"); fprintf(tab, "imageWidth\t"); fprintf(tab, "imageHeight\n"); while ((row = sqlNextRow(sr)) != NULL) { char *gene = row[0]; char *sex = row[1]; char *age = row[2]; char *ageMin = row[3]; char *ageMax = row[4]; char *paneLabel = row[5]; char *fileKey = row[6]; char *imageKey = row[7]; char *probePrepKey = row[8]; char *antibodyPrepKey = row[9]; char *reporterGeneKey = row[10]; char *fixation = row[11]; char *embedding = row[12]; char *assayKey = row[13]; char *sliceType = row[14]; char *genotypeKey = row[15]; char *imagePaneKey = row[16]; double calcAge = -1; char *probeColor = ""; char *bodyPart = ""; char *abName = NULL; char *rPrimer = NULL, *fPrimer = NULL; char *genotype = NULL; char *strain = NULL; char *priority = NULL; char abTaxon[32]; char *captionId = ""; char *abSubmitId = NULL; verbose(3, " "); dumpRow(row, 16); if (age == NULL) continue; if (!lookedForCopyright) { struct sqlResult *sr = NULL; char **row; lookedForCopyright = TRUE; dyStringClear(query); sqlDyStringPrintf(query, "select note from MGI_NoteChunk,MGI_Note,MGI_NoteType,ACC_MGIType " "where MGI_Note._Object_key = %s " "and ACC_MGIType.name = 'Image' " "and ACC_MGIType._MGIType_key = MGI_Note._MGIType_key " "and MGI_NoteType.noteType='Copyright' " "and MGI_Note._NoteType_key = MGI_NoteType._NoteType_key " "and MGI_Note._Note_key = MGI_NoteChunk._Note_key " "order by sequenceNum" , imageKey); sr = sqlGetResultVerbose(conn2, query->string); while ((row = sqlNextRow(sr)) != NULL) dyStringAppend(copyright, row[0]); sqlFreeResult(&sr); verbose(2,"imageKey=%s\n",imageKey); if (copyright->stringSize != 0) { fprintf(ra, "copyright %s\n", copyright->string); } } /* Massage sex */ { if (sameString(sex, "Male")) sex = "male"; else if (sameString(sex, "Female")) sex = "female"; else sex = ""; } /* Massage age */ { char *embryoPat = "embryonic day "; char *newbornPat = "postnatal newborn"; char *dayPat = "postnatal day "; char *weekPat = "postnatal week "; char *adultPat = "postnatal adult"; double calcMinAge = atof(ageMin); double calcMaxAge = atof(ageMax); double mouseBirthAge = 21.0; //double mouseAdultAge = 63.0; /* Relative to conception, not birth */ if (age[0] == 0) { warn("age null, ageMin %s, ageMax %s\n", ageMin, ageMax); calcAge = (calcMinAge + calcMaxAge) * 0.5; } else if (startsWith(embryoPat, age)) calcAge = atof(age+strlen(embryoPat)); else if (sameString(newbornPat, age)) calcAge = mouseBirthAge; else if (startsWith(dayPat, age)) calcAge = atof(age+strlen(dayPat)) + mouseBirthAge; else if (startsWith(weekPat, age)) calcAge = 7.0 * atof(age+strlen(weekPat)) + mouseBirthAge; else if (sameString(adultPat, age) && calcMaxAge - calcMinAge > 1000 && calcMinAge < 365) calcAge = 365; /* Most adult mice are relatively young */ else { warn("Calculating age from %s", age); calcAge = (calcMinAge + calcMaxAge) * 0.5; } if (calcAge < calcMinAge) calcAge = calcMinAge; if (calcAge > calcMaxAge) calcAge = calcMaxAge; } /* Massage probeColor */ { if (!isStrNull(reporterGeneKey)) { /* Fixme: make sure that reporterGene's end up in probeType table. */ char *name = NULL; dyStringClear(query); sqlDyStringPrintf(query, "select term from VOC_Term where _Term_key = %s", reporterGeneKey); name = sqlQuickStringVerbose(conn2, query->string); if (name == NULL) warn("Can't find _ReporterGene_key %s in VOC_Term", reporterGeneKey); else if (sameString(name, "GFP")) probeColor = "green"; else if (sameString(name, "lacZ")) probeColor = "blue"; else warn("Don't know color of reporter gene %s", name); freez(&name); } if (!isStrNull(probePrepKey)) { char *name = NULL; dyStringClear(query); sqlDyStringPrintf(query, "select GXD_VisualizationMethod.visualization " "from GXD_VisualizationMethod,GXD_ProbePrep " "where GXD_ProbePrep._ProbePrep_key = %s " "and GXD_ProbePrep._Visualization_key = GXD_VisualizationMethod._Visualization_key" , probePrepKey); name = sqlQuickStringVerbose(conn2, query->string); if (name == NULL) warn("Can't find visualization from _ProbePrep_key %s", probePrepKey); probeColor = colorFromLabel(name, gene); freez(&name); if (probeColor[0] == 0) { dyStringClear(query); sqlDyStringPrintf(query, "select GXD_Label.label from GXD_Label,GXD_ProbePrep " "where GXD_ProbePrep._ProbePrep_key = %s " "and GXD_ProbePrep._Label_key = GXD_Label._Label_key" , probePrepKey); name = sqlQuickStringVerbose(conn2, query->string); if (name == NULL) warn("Can't find label from _ProbePrep_key %s", probePrepKey); probeColor = colorFromLabel(name, gene); } freez(&name); } if (!isStrNull(antibodyPrepKey) && probeColor[0] == 0 ) { char *name = NULL; dyStringClear(query); sqlDyStringPrintf(query, "select GXD_Label.label from GXD_Label,GXD_AntibodyPrep " "where GXD_AntibodyPrep._AntibodyPrep_key = %s " "and GXD_AntibodyPrep._Label_key = GXD_Label._Label_key" , antibodyPrepKey); name = sqlQuickStringVerbose(conn2, query->string); if (name == NULL) warn("Can't find label from _AntibodyPrep_key %s", antibodyPrepKey); probeColor = colorFromLabel(name, gene); freez(&name); } } /* Get abName, abTaxon, abSubmitId */ abTaxon[0] = 0; if (!isStrNull(antibodyPrepKey)) { struct sqlResult *sr = NULL; int orgKey = 0; char **row; dyStringClear(query); sqlDyStringPrintf(query, "select antibodyName,_Organism_key,GXD_Antibody._Antibody_key " "from GXD_AntibodyPrep,GXD_Antibody " "where GXD_AntibodyPrep._AntibodyPrep_key = %s " "and GXD_AntibodyPrep._Antibody_key = GXD_Antibody._Antibody_key" , antibodyPrepKey); sr = sqlGetResultVerbose(conn2, query->string); row = sqlNextRow(sr); if (row != NULL) { abName = cloneString(row[0]); orgKey = atoi(row[1]); abSubmitId = cloneString(row[2]); } sqlFreeResult(&sr); if (orgKey > 0) { char *latinName = NULL, *commonName = NULL; int spTaxon = 0; dyStringClear(query); sqlDyStringPrintf(query, "select latinName from MGI_Organism " "where _Organism_key = %d", orgKey); latinName = sqlQuickStringVerbose(conn2, query->string); if (latinName != NULL && !sameString(latinName, "Not Specified") && !sameString(latinName, "Not Applicable")) { char *e = strchr(latinName, '/'); if (e != NULL) *e = 0; /* Chop off / and after. */ spTaxon = spBinomialToTaxon(connSp, latinName); } else { dyStringClear(query); sqlDyStringPrintf(query, "select commonName from MGI_Organism " "where _Organism_key = %d", orgKey); commonName = sqlQuickStringVerbose(conn2, query->string); if (commonName != NULL && !sameString(commonName, "Not Applicable") && !sameString(commonName, "Not Specified")) { spTaxon = spCommonToTaxon(connSp, commonName); } } if (spTaxon != 0) safef(abTaxon, sizeof(abTaxon), "%d", spTaxon); freez(&latinName); freez(&commonName); } } if (abName == NULL) abName = cloneString(""); if (abSubmitId == NULL) abSubmitId = cloneString(""); /* Get rPrimer, lPrimer */ if (!isStrNull(probePrepKey)) { struct sqlResult *sr = NULL; char **row; dyStringClear(query); sqlDyStringPrintf(query, "select primer1sequence,primer2sequence " "from PRB_Probe,GXD_ProbePrep " "where PRB_Probe._Probe_key = GXD_ProbePrep._Probe_key " "and GXD_ProbePrep._ProbePrep_key = %s" , probePrepKey); sr = sqlGetResultVerbose(conn2, query->string); row = sqlNextRow(sr); if (row != NULL) { fPrimer = cloneString(row[0]); rPrimer = cloneString(row[1]); } sqlFreeResult(&sr); } /* Note Jackson database actually stores the primers very * erratically. In all the cases I can find for in situs * the primers are actually stored in free text in the PRB_Notes * e.g. ... primers CGCGGATCCAGGGGAAACAGAAGGGCTGCG and CCCAAGCTTAGACTGTACAGGCTGAGCC ... */ if (fPrimer == NULL || fPrimer[0]==0) { struct sqlResult *sr = NULL; char **row; dyStringClear(query); sqlDyStringPrintf(query, "select PRB_Notes.note from GXD_ProbePrep, PRB_Notes" " where GXD_ProbePrep._ProbePrep_key = %s" " and GXD_ProbePrep._Probe_key = PRB_Notes._Probe_key" " order by PRB_Notes.sequenceNum" , probePrepKey); sr = sqlGetResultVerbose(conn2, query->string); dyStringClear(probeNotes); while ((row = sqlNextRow(sr)) != NULL) dyStringAppend(probeNotes, row[0]); sqlFreeResult(&sr); if (probeNotes->stringSize > 0) { char f[256]; char r[256]; int i = 0; char *s = strstr(probeNotes->string," primers "); if (s) { s += strlen(" primers "); i = 0; while (strchr("ACGT",*s) && (i<sizeof(f))) f[i++] = *s++; f[i]=0; if (strstr(s," and ")==s) { s += strlen(" and "); i = 0; while (strchr("ACGT",*s) && (i<sizeof(r))) r[i++] = *s++; r[i]=0; if (strlen(f) >= 10 && strlen(r) >= 10) { fPrimer = cloneString(f); rPrimer = cloneString(r); } else { verbose(1, "bad primer parse:_ProbePrep_key=%s fPrimer=[%s], rPrimer=[%s]\n", probePrepKey,f,r); } } } } } if (fPrimer == NULL) fPrimer = cloneString(""); if (rPrimer == NULL) rPrimer = cloneString(""); fixation = blankOutUnknown(fixation); embedding = blankOutUnknown(embedding); /* Massage body part and slice type. We only handle whole mounts. */ if (sameString(sliceType, "whole mount")) { bodyPart = "whole"; priority = "100"; } else { sliceType = ""; priority = "1000"; } genotypeAndStrainFromKey(genotypeKey, conn2, &genotype, &strain); if (isStrNull(paneLabel)) paneLabel = cloneString(""); /* trying to suppress nulls in output */ stripChar(paneLabel, '"'); /* Get rid of a difficult quote to process. */ /* Fetch image dimensions from file. */ imageWidth=0; imageHeight=0; safef(path, sizeof(path), "%s/%s.jpg", inJax, fileKey); if (fileExists(path)) jpegSize(path,&imageWidth,&imageHeight); /* will errAbort if no valid .jpeg exists */ else warn("Picture Missing! %s ",path); /* Deal caption if any. Most of the work only happens the * first time see the image. */ if (!hashLookup(uniqImageHash, imageKey)) { struct sqlResult *sr = NULL; char **row; hashAdd(uniqImageHash, imageKey, NULL); dyStringClear(caption); dyStringClear(query); sqlDyStringPrintf(query, "select note from MGI_NoteChunk,MGI_Note,MGI_NoteType,ACC_MGIType " "where MGI_Note._Object_key = %s " "and ACC_MGIType.name = 'Image' " "and ACC_MGIType._MGIType_key = MGI_Note._MGIType_key " "and MGI_NoteType.noteType='Caption' " "and MGI_Note._NoteType_key = MGI_NoteType._NoteType_key " "and MGI_Note._Note_key = MGI_NoteChunk._Note_key " "order by sequenceNum" , imageKey); sr = sqlGetResultVerbose(conn2, query->string); while ((row = sqlNextRow(sr)) != NULL) dyStringAppend(caption, row[0]); sqlFreeResult(&sr); if (caption->stringSize > 0) { subChar(caption->string, '\t', ' '); subChar(caption->string, '\n', ' '); fprintf(cap, "%s\t%s\n", imageKey, caption->string); hashAdd(captionHash, imageKey, imageKey); } } if (hashLookup(captionHash, imageKey)) captionId = imageKey; else captionId = ""; fprintf(tab, "%s\t", gene); fprintf(tab, "%s\t", probeColor); fprintf(tab, "%s\t", sex); fprintf(tab, "%3.2f\t", calcAge); fprintf(tab, "%s\t", ageMin); fprintf(tab, "%s\t", ageMax); fprintf(tab, "%s\t", paneLabel); /* may have to change NULL to empty string or "0" ? */ fprintf(tab, "%s.jpg\t", fileKey); fprintf(tab, "%s\t", imageKey); fprintf(tab, "%s\t", fPrimer); fprintf(tab, "%s\t", rPrimer); fprintf(tab, "%s\t", abName); fprintf(tab, "%s\t", abTaxon); fprintf(tab, "%s\t", abSubmitId); fprintf(tab, "%s\t", fixation); fprintf(tab, "%s\t", embedding); fprintf(tab, "%s\t", bodyPart); fprintf(tab, "%s\t", sliceType); fprintf(tab, "%s\t", genotype); fprintf(tab, "%s\t", strain); fprintf(tab, "%s\t", priority); fprintf(tab, "%s\t", captionId); fprintf(tab, "%d\t", imageWidth); fprintf(tab, "%d\n", imageHeight); printExpression(tab, conn2, imagePaneKey, assayKey); gotAny = TRUE; freez(&genotype); freez(&abName); freez(&abSubmitId); freez(&rPrimer); freez(&fPrimer); } sqlFreeResult(&sr); carefulClose(&ra); carefulClose(&tab); carefulClose(&cap); if (!gotAny) { remove(raName); remove(capName); remove(tabName); } dyStringFree(&probeNotes); dyStringFree(©right); dyStringFree(&caption); dyStringFree(&query); hashFree(&uniqImageHash); hashFree(&captionHash); }