void piracy_cmd(unit * u, order *ord) { region *r = u->region; ship *sh = u->ship, *sh2; direction_t target_dir; struct { const faction *target; int value; } aff[MAXDIRECTIONS]; int saff = 0; int *il; if (!validate_pirate(u, ord)) { return; } il = parse_ids(ord); /* Feststellen, ob schon ein anderer alliierter Pirat ein * Ziel gefunden hat. */ target_dir = find_piracy_target(u, il); /* Wenn nicht, sehen wir, ob wir ein Ziel finden. */ if (target_dir == NODIRECTION) { direction_t dir; /* Einheit ist also Kapitän. Jetzt gucken, in wievielen * Nachbarregionen potentielle Opfer sind. */ for (dir = 0; dir < MAXDIRECTIONS; dir++) { region *rc = rconnect(r, dir); aff[dir].value = 0; aff[dir].target = 0; if (rc && fval(rc->terrain, SAIL_INTO) && can_takeoff(sh, r, rc)) { for (sh2 = rc->ships; sh2; sh2 = sh2->next) { unit *cap = ship_owner(sh2); if (cap) { faction *f = visible_faction(cap->faction, cap); if (alliedunit(u, f, HELP_FIGHT)) continue; if (!il || intlist_find(il, cap->faction->no)) { // TODO: shouldn't this be f->no? ++aff[dir].value; if (rng_int() % aff[dir].value == 0) { aff[dir].target = f; } } } } /* Und aufaddieren. */ saff += aff[dir].value; } } if (saff != 0) { saff = rng_int() % saff; for (dir = 0; dir != MAXDIRECTIONS; ++dir) { if (saff < aff[dir].value) { target_dir = dir; a_add(&r->attribs, mk_piracy(u->faction, aff[dir].target, target_dir)); break; } saff -= aff[dir].value; } } } free(il); /* Wenn kein Ziel gefunden, entsprechende Meldung generieren */ if (target_dir == NODIRECTION) { ADDMSG(&u->faction->msgs, msg_message("piratenovictim", "ship region", sh, r)); return; } /* Meldung generieren */ ADDMSG(&u->faction->msgs, msg_message("piratesawvictim", "ship region dir", sh, r, target_dir)); /* Befehl konstruieren */ set_order(&u->thisorder, create_order(K_MOVE, u->faction->locale, "%s", LOC(u->faction->locale, directions[target_dir]))); /* Bewegung ausführen */ init_order(u->thisorder); move_cmd(u, true); }
int main( int argc, char* argv[] ) { char mafn[MAX_FN_LEN+1]; char ma_in_fn[MAX_FN_LEN+1]; char assign_id[MAX_ID_LEN+1]; unsigned int any_arg; int id_assigned = 0; // Boolean, set to true if -I is given int cons_scheme; int out_ma = 0; int in_ma = 0; int no_dups = 0; // allow duplicate ids by default - the user knows what he's doing int out_format = 1; int reg_start = 90; int reg_end = 109; int in_color = 0; // Output f6 format colored -> bad when you want to pipe it into a file MapAlignmentP maln; PWAlnFragP pwaln; IDsListP rest_ids_list, // the IDs in the -i argument, if any, will go here used_ids_list; // the IDs seen thusfar; just for this list, // the segment character is tacked onto the end int ich, cons_scheme_def, ids_rest; double score_int, score_slo; extern char* optarg; cons_scheme_def = 1; ids_rest = 0; // Boolean set to no => no IDs restriction set (yet) /* Get input options */ any_arg = 0; cons_scheme = cons_scheme_def; score_int = -1.0; // Set the score intercept to -1 => not specified (yet) score_slo = -1.0; // Set the score intercept to -1 => not specified (yet) while( (ich=getopt( argc, argv, "I:c:i:f:R:s:m:M:Cb:s:d" )) != -1 ) { switch(ich) { case 'h' : help(); exit( 0 ); any_arg = 1; break; case 'I' : strcpy( assign_id, optarg ); id_assigned = 1; break; case 'c' : cons_scheme = atoi( optarg ); any_arg = 1; break; case 'i' : rest_ids_list = parse_ids( optarg ); ids_rest = 1; any_arg = 1; break; case 'f' : out_format = atoi( optarg ); any_arg = 1; break; case 'R' : parse_region( optarg, ®_start, ®_end ); any_arg = 1; break; case 's' : score_slo = atof( optarg ); any_arg = 1; break; case 'b' : score_int = atof( optarg ); any_arg = 1; break; case 'C' : in_color = 1; break; case 'm' : strcpy( mafn, optarg ); out_ma = 1; any_arg = 1; break; case 'M' : strcpy( ma_in_fn, optarg ); in_ma = 1; any_arg = 1; break; case 'd' : no_dups = 1; used_ids_list = init_ids_list(); any_arg = 1; break; default : help(); any_arg = 1; exit( 0 ); } } if ( !any_arg || ( (score_slo == -1) && (score_int != -1) ) || ( (score_slo != -1) && (score_int == -1) ) ) { help(); exit( 0 ); } /* Initialize maln, either from specified input file or brand new */ if ( in_ma ) { maln = read_ma( ma_in_fn ); } else { help(); exit( 0 ); } /* Set the maln->cons_code to something reasonable */ maln->cons_code = cons_scheme; /* Now input from all sources has been dealt with, we turn our attention to output...*/ sort_aln_frags( maln ); /* If an ID to be assigned to the assembly was given, then assign it now */ if ( id_assigned ) { strcpy( maln->ref->id, assign_id ); } if ( (out_format == 6) || (out_format == 61) ) { print_region( maln, reg_start, reg_end, out_format, in_color ); } else { show_consensus( maln, out_format ); } if (out_format == 7){ ace_output(maln); } /* Write MapAlignment output to a file */ if ( out_ma ) { write_ma( mafn, maln ); } exit( 0 ); }
/* Parses the whole DO REPEAT command specification. Returns success. */ static bool parse_specification (struct lexer *lexer, struct dictionary *dict, struct hmap *dummies) { struct dummy_var *first_dv = NULL; hmap_init (dummies); do { struct dummy_var *dv; const char *name; bool ok; /* Get a stand-in variable name and make sure it's unique. */ if (!lex_force_id (lexer)) goto error; name = lex_tokcstr (lexer); if (dict_lookup_var (dict, name)) msg (SW, _("Dummy variable name `%s' hides dictionary variable `%s'."), name, name); if (find_dummy_var (dummies, name, strlen (name))) { msg (SE, _("Dummy variable name `%s' is given twice."), name); goto error; } /* Make a new macro. */ dv = xmalloc (sizeof *dv); dv->name = xstrdup (name); dv->values = NULL; dv->n_values = 0; hmap_insert (dummies, &dv->hmap_node, hash_dummy (name, strlen (name))); /* Skip equals sign. */ lex_get (lexer); if (!lex_force_match (lexer, T_EQUALS)) goto error; /* Get the details of the variable's possible values. */ if (lex_token (lexer) == T_ID || lex_token (lexer) == T_ALL) ok = parse_ids (lexer, dict, dv); else if (lex_is_number (lexer)) ok = parse_numbers (lexer, dv); else if (lex_is_string (lexer)) ok = parse_strings (lexer, dv); else { lex_error (lexer, NULL); goto error; } if (!ok) goto error; assert (dv->n_values > 0); if (lex_token (lexer) != T_SLASH && lex_token (lexer) != T_ENDCMD) { lex_error (lexer, NULL); goto error; } /* If this is the first variable then it defines how many replacements there must be; otherwise enforce this number of replacements. */ if (first_dv == NULL) first_dv = dv; else if (first_dv->n_values != dv->n_values) { msg (SE, _("Dummy variable `%s' had %zu substitutions, so `%s' must " "also, but %zu were specified."), first_dv->name, first_dv->n_values, dv->name, dv->n_values); goto error; } lex_match (lexer, T_SLASH); } while (!lex_match (lexer, T_ENDCMD)); while (lex_match (lexer, T_ENDCMD)) continue; return true; error: destroy_dummies (dummies); return false; }
int main( int argc, char* argv[] ) { char mat_fn[MAX_FN_LEN+1]; char maln_fn[MAX_FN_LEN+1]; char fastq_out_fn[MAX_FN_LEN+1]; char maln_root[MAX_FN_LEN+1]; char ref_fn[MAX_FN_LEN+1]; char frag_fn[MAX_FN_LEN+1]; char adapter_code[2]; // place to keep the argument for -a (which adapter to trim) char* c_time; // place to keep asctime string char* test_id; int ich; int any_arg = 0; int Hard_cut = 0; // If 0 => use dynamic score cutoff, if > 0 use this instead int circular = 0; // Boolean, TRUE if reference sequence is circular int make_fastq = 0; // Boolean, TRUE if we should also output fastq database of seqs in assembly int seq_code = 0; // code to indicate sequence input format; 0 => fasta; 1 => fastq int do_adapter_trimming = 0; // Boolean, TRUE if we should try to trim // adapter from input sequences int iterate = 0; //Boolean, TRUE means interate the assembly until convergence // on an assembled sequence int FINAL_ONLY = 0; //Boolean, TRUE means only write out the final assembly maln file // FALSE (default) means write out each one int ids_rest = 0; // Boolean, TRUE means restrict analysis to IDs in input file int repeat_filt = 0; //Boolean, TRUE means remove sequences that are repeats, // keeping best-scoring representative int repeat_qual_filt = 0; //Boolean, TRUE means remove sequences that are repeats, // keeping best quality score sum representative int just_outer_coords = 1; // Boolean, TRUE means just use strand, start, and end to // determine if sequences are redundant int SCORE_CUT_SET = 0; //Boolean, TRUE means user has set a length/score cutoff line int seen_seqs = 0; int hp_special = 0; // Boolean, TRUE means user wants hp gap special discount int distant_ref = 0; // Boolean, TRUE means the initial reference sequence is // known to be distantly related so keep trying to align all // sequences each round int kmer_filt_len = -1; // length of kmer filtering, if user wants it; otherwise // special value of -1 indicates this is unset int soft_mask = 0; //Boolean; TRUE => do not use kmers that are all lower-case // FALSE => DO use all kmers, regardless of case int iter_num; // Number of iterations of assembly done int collapse = 0; // Boolean; TRUE => collapse input sequences in FSDB to improve // sequence quality // FALSE => (default) keep all sequences double slope = DEF_S; // Set these to default unless, until user changes double intercept = DEF_N; // them MapAlignmentP maln, // Contains all fragments initially better // than FIRST_ROUND_SCORE_CUTOFF culled_maln; // Contains all fragments with scores // better than SCORE_CUTOFF AlignmentP fw_align, rc_align, adapt_align; PSSMP ancsubmat = init_flatsubmat(); PSSMP rcancsubmat = revcom_submat(ancsubmat); const PSSMP flatsubmat = init_flatsubmat(); KPL* fkpa; // Place to keep forward kmer array if user requested kmer KPL* rkpa; // Place to keep reverse kmer array if user requested kmer IDsListP good_ids; FragSeqP frag_seq; PWAlnFragP front_pwaln, back_pwaln; FSDB fsdb; // Database to hold sequences to iterate over FILE* FF; time_t curr_time; char maln_root_def[] = "assembly.maln.iter"; extern int optind; extern char* optarg; char neand_adapt[] = "GTCAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGG"; char stand_adapt[] = "CTGAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGG"; char user_def_adapt[128]; char* adapter; // set to either neand_adapt or stand_adapt based on user preference adapter = neand_adapt; // Default is Neandertal char* assembly_cons; char* last_assembly_cons; int cc = 1; // consensus code for calling consensus base int i; /* Set the default output filename until the user overrides it */ strcpy( maln_root, maln_root_def ); /* Process command line arguments */ while( (ich=getopt( argc, argv, "s:r:f:m:a:p:H:I:S:N:k:q:FTciuhDMUAC" )) != -1 ) { switch(ich) { case 'c' : circular = 1; break; case 'q' : make_fastq = 1; strcpy( fastq_out_fn, optarg ); case 'C' : collapse = 1; break; case 'i' : iterate = 1; break; case 'h' : hp_special = 1; break; case 'u' : repeat_filt = 1; break; case 'A' : just_outer_coords = 0; break; case 'U' : repeat_qual_filt = 1; break; case 'D' : distant_ref = 1; break; case 'p' : cc = atoi( optarg ); any_arg = 1; break; case 'I' : good_ids = parse_ids( optarg ); ids_rest = 1; break; case 'H' : Hard_cut = atoi( optarg ); if ( Hard_cut <= 0 ) { fprintf( stderr, "Hard cutoff (-H) must be positive\n" ); help(); exit( 0 ); } any_arg = 1; break; case 'M' : soft_mask = 1; break; case 's' : strcpy( mat_fn, optarg ); free( ancsubmat ); // trash the flat submat we initialized with ancsubmat = read_pssm( mat_fn ); free( rcancsubmat ); // trash the init rcsubmat, too rcancsubmat = revcom_submat( ancsubmat ); any_arg = 1; break; case 'r' : strcpy( ref_fn, optarg ); any_arg = 1; break; case 'k' : kmer_filt_len = atoi( optarg ); any_arg = 1; break; case 'f' : strcpy( frag_fn, optarg ); any_arg = 1; break; case 'm' : strcpy( maln_root, optarg ); any_arg = 1; break; case 'T' : do_adapter_trimming = 1; break; case 'a' : if ( strlen( optarg ) > 127 ) { fprintf( stderr, "That adapter is too big!\nMIA will use the standard adapter.\n" ); adapter = stand_adapt; } else { strcpy( user_def_adapt, optarg ); if ( strlen( user_def_adapt ) > 1 ) { adapter = user_def_adapt; } else { if ( !( (user_def_adapt[0] == 'n') || (user_def_adapt[0] == 'N') ) ) { adapter = stand_adapt; } else { adapter = neand_adapt; } } } break; case 'S' : slope = atof( optarg ); SCORE_CUT_SET = 1; break; case 'N' : intercept = atof( optarg ); SCORE_CUT_SET = 1; break; case 'F' : FINAL_ONLY = 1; break; default : help(); exit( 0 ); } } if ( !any_arg ) { help(); exit( 0 ); } if ( optind != argc ) { fprintf( stderr, "There seems to be some extra cruff on the command line that mia does not understand.\n" ); } /* Start the clock... */ curr_time = time(NULL); // c_time = (char*)save_malloc(64*sizeof(char)); // c_time = asctime(localtime(&curr_time)); /* Announce that we're starting */ fprintf( stderr, "Starting assembly of %s\nusing %s\nas reference at %s\n", frag_fn, ref_fn, asctime(localtime(&curr_time)) ); /* Set up the maln structure */ maln = (MapAlignmentP)init_map_alignment(); maln->cons_code = cc; if ( maln == NULL ) { fprintf( stderr, "Not enough memories for this\n" ); exit( 1 ); } /* Set the distant_ref flag */ maln->distant_ref = distant_ref; /* Set up the FSDB for keeping good-scoring sequence in memory */ fsdb = init_FSDB(); if ( fsdb == NULL ) { fprintf( stderr, "Not enough memories for holding sequences\n" ); exit( 1 ); } /* Read in the reference sequence and make reverse complement, too*/ if ( read_fasta_ref( maln->ref, ref_fn ) != 1 ) { fprintf( stderr, "Problem reading reference sequence file %s\n", ref_fn ); exit( 1 ); } /* Add wrap-around sequence (rc, too) and set maln->ref->circular if it's circular */ if ( circular ) { add_ref_wrap( maln->ref ); } else { maln->ref->wrap_seq_len = maln->ref->seq_len; } /* Add space for the gaps array */ maln->ref->gaps = (int*)save_malloc((maln->ref->wrap_seq_len+1) * sizeof(int)); for( i = 0; i <= maln->ref->wrap_seq_len; i++ ) { maln->ref->gaps[i] = 0; } /* Set up fkpa and rkpa for list of kmers in the reference (forward and revcom strand) if user wants kmer filtering */ if ( kmer_filt_len > 0 ) { fprintf( stderr, "Making kmer list for k-mer filtering...\n" ); fkpa = init_kpa(kmer_filt_len); rkpa = init_kpa(kmer_filt_len); /* kmer_list = (KmersP)pop_kmers( maln->ref, kmer_filt_len ); */ populate_kpa( fkpa, maln->ref->seq, maln->ref->wrap_seq_len, kmer_filt_len, soft_mask ); populate_kpa( rkpa, maln->ref->rcseq, maln->ref->wrap_seq_len, kmer_filt_len, soft_mask ); } /* Now kmer arrays have been made if requested. We can upper case the reference sequences. */ make_ref_upper( maln->ref ); /* Set up FragSeqP to point to a FragSeq */ frag_seq = (FragSeqP)save_malloc(sizeof(FragSeq)); /* Set up the alignment structures for forward and reverse complement alignments */ fw_align = (AlignmentP)init_alignment( INIT_ALN_SEQ_LEN, (maln->ref->wrap_seq_len + (2*INIT_ALN_SEQ_LEN)), 0, hp_special ); rc_align = (AlignmentP)init_alignment( INIT_ALN_SEQ_LEN, (maln->ref->wrap_seq_len + (2*INIT_ALN_SEQ_LEN)), 1, hp_special ); /* Set up the alignment structure for adapter trimming, if user wants that */ if ( do_adapter_trimming ) { adapt_align = (AlignmentP)init_alignment( INIT_ALN_SEQ_LEN, INIT_ALN_SEQ_LEN, 0, hp_special ); /* Setup the flatsubmat */ //flatsubmat = init_flatsubmat(); adapt_align->submat = flatsubmat; adapt_align->seq2 = adapter; adapt_align->len2 = strlen( adapt_align->seq2 ); pop_s2c_in_a( adapt_align ); if ( hp_special ) { pop_hpl_and_hps( adapt_align->seq2, adapt_align->len2, adapt_align->hprl, adapt_align->hprs ); } /* Set for a semi-global that pays a penalty for unaligning the beginning of the adapter, but not for the end of the adapter. This is because if the sequence read (align->seq1) ends, then we won't see any more of the adapter. When we search for the best alignment, we'll only look in the last column, requiring that all of align->seq1 is accounted for */ adapt_align->sg5 = 1; adapt_align->sg3 = 0; } fw_align->seq1 = maln->ref->seq; rc_align->seq1 = maln->ref->rcseq; if ( circular ) { fw_align->len1 = maln->ref->wrap_seq_len; rc_align->len1 = maln->ref->wrap_seq_len; } else { fw_align->len1 = maln->ref->seq_len; rc_align->len1 = maln->ref->seq_len; } /* Now the reference sequence and its reverse complement are prepared, put the s1c lookup codes in */ pop_s1c_in_a( fw_align ); pop_s1c_in_a( rc_align ); if ( hp_special ) { pop_hpl_and_hps( fw_align->seq1, fw_align->len1, fw_align->hpcl, fw_align->hpcs ); pop_hpl_and_hps( rc_align->seq1, rc_align->len1, rc_align->hpcl, rc_align->hpcs ); } /* One by one, go through the input file of fragments to be aligned. Align them to the reference. For each fragment generating an alignment score better than the cutoff, merge it into the maln alignment. Keep track of those that don't, too. */ FF = fileOpen( frag_fn, "r" ); seq_code = find_input_type( FF ); //LOG = fileOpen( log_fn, "w" ); front_pwaln = (PWAlnFragP)save_malloc( sizeof(PWAlnFrag)); back_pwaln = (PWAlnFragP)save_malloc( sizeof(PWAlnFrag)); /* Give some space to remember the IDs as we see them */ test_id = (char*)save_malloc(MAX_ID_LEN * sizeof(char)); /* Announce we're strarting alignment of fragments */ fprintf( stderr, "Starting to align sequences to the reference...\n" ); while( read_next_seq( FF, frag_seq, seq_code ) ) { seen_seqs++; strcpy( test_id, frag_seq->id ); if ( DEBUG ) { fprintf( stderr, "%s\n", frag_seq->id ); } if ( !ids_rest || ( bsearch( &test_id, good_ids->ids, good_ids->num_ids, sizeof(char*), idCmp ) != NULL ) ) { if ( do_adapter_trimming ) { /* Trim sequence (set frag_seg->trimmed and frag_seg->trim_point field) */ trim_frag( frag_seq, adapter, adapt_align ); } else { frag_seq->trimmed = 0; } /* Check if kmer filtering. If so, filter */ if ( new_kmer_filter( frag_seq, fkpa, rkpa, kmer_filt_len, fw_align, rc_align ) ) { /* Align this fragment to the reference and write the result into pwaln; use the ancsubmat, not the reverse complemented rcsancsubmat during this first iteration because all sequence is forward strand */ fw_align->submat = ancsubmat; rc_align->submat = ancsubmat; if ( sg_align( maln, frag_seq, fsdb, fw_align, rc_align, front_pwaln, back_pwaln ) == 0 ) { fprintf( stderr, "Problem handling %s\n", frag_seq->id ); } } } if ( seen_seqs % 1000 == 0 ) { fprintf( stderr, "." ); } if ( seen_seqs % 80000 == 0 ) { fprintf( stderr, "\n" ); } } /* Now, fsdb is complete and points to all the things in maln. So we can fill in the AlnSeqP->smp array for everything in the maln->AlnSeqArray to know which matrices to use for *CALLING* a consensus; Conveniently, there are pointers to all of these in the fss->fss[X]->front|back_asp */ pop_smp_from_FSDB( fsdb, PSSM_DEPTH ); //fprintf( LOG, "__Finished with initial alignments__" ); //fflush( LOG ); fprintf( stderr, "\n" ); iter_num = 1; /* Now, we need a new MapAlignment, culled_maln, that is big enough to hold all the unique guys from maln */ culled_maln = init_culled_map_alignment( maln ); /* Filtering repeats announcement */ fprintf( stderr, "Repeat and score filtering\n" ); /* If user wants to filter against repeats by alignment score, do it */ if ( repeat_filt ) { /* Sort fsdb by fsdb->as */ sort_fsdb( fsdb ); /* Now, everything is sorted in fsdb, so I can easily see which guys are unique by as, ae, and rc fields */ set_uniq_in_fsdb( fsdb, just_outer_coords ); } /* If user wants to filter against repeats by q-score sum, do it */ if ( repeat_qual_filt ) { /* Sort fsdb by fsdb->as */ sort_fsdb_qscore( fsdb ); /* Now, everything is sorted in fsdb, so I can easily see which guys are unique by as, ae, and rc fields */ set_uniq_in_fsdb( fsdb, just_outer_coords ); } /* Now, we know which sequences are unique, so make a culled_maln with just the unique guys */ cull_maln_from_fsdb( culled_maln, fsdb, Hard_cut, SCORE_CUT_SET, slope, intercept ); fclose(FF); /* Tell the culled_maln which matrices to use for assembly */ culled_maln->fpsm = ancsubmat; culled_maln->rpsm = rcancsubmat; sort_aln_frags( culled_maln ); //invalidates fsdb->front|back_asp fields! fw_align->submat = ancsubmat; fw_align->sg5 = 1; fw_align->sg3 = 1; last_assembly_cons = (char*)save_malloc((maln->ref->seq_len +1) * sizeof(char)); strncpy( last_assembly_cons, maln->ref->seq, maln->ref->seq_len ); last_assembly_cons[maln->ref->seq_len] = '\0'; /* Re-align everything with revcomped sequence and substitution matrices, but first unmask all alignment positions and collapse sequences if requested */ memset(fw_align->align_mask, 1, fw_align->len1); if ( collapse ) { collapse_FSDB( fsdb, Hard_cut, SCORE_CUT_SET, slope, intercept ); } reiterate_assembly( last_assembly_cons, iter_num, maln, fsdb, fw_align, front_pwaln, back_pwaln, ancsubmat, rcancsubmat ); pop_smp_from_FSDB( fsdb, PSSM_DEPTH ); fprintf( stderr, "Repeat and score filtering\n" ); if ( repeat_filt ) { sort_fsdb( fsdb ); set_uniq_in_fsdb( fsdb, just_outer_coords ); } if ( repeat_qual_filt ) { sort_fsdb_qscore( fsdb ); set_uniq_in_fsdb( fsdb, just_outer_coords ); } cull_maln_from_fsdb( culled_maln, fsdb, Hard_cut, SCORE_CUT_SET, slope, intercept ); /* Tell the culled_maln which matrices to use for assembly */ culled_maln->fpsm = ancsubmat; culled_maln->rpsm = rcancsubmat; //invalidates fsdb->front|back_asp fields! sort_aln_frags( culled_maln ); sprintf( maln_fn, "%s.%d", maln_root, iter_num ); if ( !iterate || !FINAL_ONLY ) { write_ma( maln_fn, culled_maln ); if ( make_fastq ) { write_fastq( fastq_out_fn, fsdb ); } } /* Are we iterating (re-aligning to the a new consensus? */ if (iterate) { /* New assembly consensus announcement */ fprintf( stderr, "Generating new assembly consensus\n" ); assembly_cons = consensus_assembly_string( culled_maln ); while( ( strcmp( assembly_cons, last_assembly_cons ) != 0) && (iter_num < MAX_ITER) ) { /* Another round...*/ iter_num++; free( last_assembly_cons ); last_assembly_cons = assembly_cons; fprintf( stderr, "Starting assembly iteration %d\n", iter_num ); /* If the user wants collapsed sequences, now is the time */ if ( collapse ) { collapse_FSDB( fsdb, Hard_cut, SCORE_CUT_SET, slope, intercept ); } reiterate_assembly( assembly_cons, iter_num, maln, fsdb, fw_align, front_pwaln, back_pwaln, ancsubmat, rcancsubmat ); pop_smp_from_FSDB( fsdb, PSSM_DEPTH ); fprintf( stderr, "Repeat and score filtering\n" ); if ( repeat_filt ) { sort_fsdb( fsdb ); set_uniq_in_fsdb( fsdb, just_outer_coords ); } if ( repeat_qual_filt ) { sort_fsdb_qscore( fsdb ); set_uniq_in_fsdb( fsdb, just_outer_coords ); } cull_maln_from_fsdb( culled_maln, fsdb, Hard_cut, SCORE_CUT_SET, slope, intercept ); /* Tell the culled_maln which matrices to use for assembly */ culled_maln->fpsm = ancsubmat; culled_maln->rpsm = rcancsubmat; //invalidates fsdb->front|back_asp fields! sort_aln_frags( culled_maln ); sprintf( maln_fn, "%s.%d", maln_root, iter_num ); if ( !FINAL_ONLY ) { fprintf( stderr, "Writing maln file for iteration %d\n", iter_num ); write_ma( maln_fn, culled_maln ); } assembly_cons = consensus_assembly_string( culled_maln ); } /* Convergence? */ if ( strcmp( assembly_cons, last_assembly_cons ) == 0 ) { fprintf( stderr, "Assembly convergence - writing final maln\n" ); write_ma( maln_fn, culled_maln ); } else { fprintf( stderr, "Assembly did not converge after % rounds, quitting\n" ); write_ma( maln_fn, culled_maln ); } if ( make_fastq ) { write_fastq( fastq_out_fn, fsdb ); } } /* No iteration, but we must still re-align everything with revcomped sequence and substitution matrices to keep scores comparable to what they would have been had we iterated */ /* Announce we're finished */ curr_time = time(NULL); // c_time = asctime(localtime(&curr_time)); fprintf( stderr, "Assembly finished at %s\n", asctime(localtime(&curr_time)) ); exit( 0 ); }