void makeConditions(char *input, char *output)
/* Parse input in form:
* transcriptionFactor list, of, conditions
* into
* transcriptionFactor<tab>list
* transcriptionFactor<tab>of
* transcriptionFactor<tab>conditions
*/
{
struct lineFile *lf = lineFileOpen(input, TRUE);
FILE *f = mustOpen(output, "w");
char *line;
while (lineFileNextReal(lf, &line))
{
char *tf, *cond;
tf = nextWord(&line);
while ((cond = nextWord(&line)) != NULL)
{
stripChar(cond, ',');
fprintf(f, "%s\t%s\n", tf, cond);
}
}
carefulClose(&f);
lineFileClose(&lf);
}
static char *normalizeType(char *type)
/* Strips any quotation marks and converts common synonyms */
{
if (type != NULL)
{
(void)stripChar(type,'\"');
if (sameWord(type,"Factor"))
return cloneString(CV_TERM_ANTIBODY);
char *cleanType = cloneString(cvTermNormalized(type));
if (differentString(cleanType,type))
return cleanType;
freeMem(cleanType);
/*
if ((sameWord(type,"Cell Line"))
|| (sameWord(type,"cellLine" ))
|| (sameWord(type,"Cell Type"))
|| (sameWord(type,"Cell Type"))
|| (sameWord(type,"Cell" ))) // sameWord is case insensitive
return cloneString(CV_TERM_CELL);
else if (sameWord(type,"Factor"))
|| (sameString(type,"Antibody")))
return cloneString(CV_TERM_ANTIBODY);
*/
}
return type;
}
void mafAliToFa(struct mafAli *maf, FILE *of)
/* convert a MAF alignment to a fa */
{
struct mafComp *c;
for (c = maf->components ; c ; c = c->next )
{
int start = c->start;
int end = c->start+c->size;
if (stripDotsDashes)
{
stripChar(c->text, '.');
stripChar(c->text, '-');
}
reverseIntRange(&start, &end, c->srcSize);
fprintf(of, ">%s.%d.%d.%c.%d\n%s\n", c->src, start, end, c->strand, c->srcSize, c->text);
}
fprintf(of,"\n");
}
struct hash *loadChroms(char *dir)
/* Load zipped chromosome files into memory. */
{
FILE *f;
char fastaScan[16];
safef(fastaScan, sizeof(fastaScan), "*.%s", faExtn);
struct fileInfo *chromEl, *chromList = listDirX(dir, fastaScan, TRUE);
struct hash *chromHash = newHash(0);
struct dnaSeq *seq;
char chrom[128];
char *faName;
int count = 0;
verbose(2, "# scanning '%s/%s'\n", dir, fastaScan);
for (chromEl = chromList; chromEl != NULL; chromEl = chromEl->next)
{
char *fileName = chromEl->name;
splitPath(fileName, NULL, chrom, NULL);
chopSuffix(chrom);
if (startsWith("chr0", chrom)) /* Convert chr01 to chr1, etc. */
stripChar(chrom, '0');
if (sameString(chrom, "chrmt"))
strcpy(chrom, "chr17");
f = fopen(fileName, "r");
AllocVar(seq);
seq->name = cloneString(chrom);
if (!faFastReadNext(f, &seq->dna, &seq->size, &faName))
errAbort("Couldn't load sequence from %s", fileName);
seq->dna = cloneMem(seq->dna, seq->size+1);
toUpperN(seq->dna, seq->size);
hashAdd(chromHash, chrom, seq);
verbose(3, "# loadChrom %s '%s'\n", fileName, chrom);
fclose(f);
f = NULL;
count++;
}
if (0 == count)
errAbort("not fasta files found in '%s/%s'\n", dir, fastaScan);
return chromHash;
}
struct visiMatch *visiSearch(struct sqlConnection *conn, char *searchString)
/* visiSearch - return list of images that match searchString sorted
* by how well they match. This will search most fields in the
* database. */
{
char *dupe = cloneString(searchString);
struct trix *trix = trixOpen("visiGeneData/visiGene.ix");
struct trixSearchResult *tsrList, *tsr;
struct visiMatch *matchList = NULL, *match;
int wordCount = chopByWhite(dupe, NULL, 0);
char **words;
boolean hasWild;
struct hash *privateHash = makePrivateHash(conn);
tolowers(dupe);
hasWild = (strchr(searchString, '*') != NULL);
if (hasWild)
stripChar(dupe, '*');
AllocArray(words, wordCount);
chopByWhite(dupe, words, wordCount);
/* if (wordCount != 1 ||
(matchList = matchGeneName(conn, words[0],privateHash)) == NULL) */
{
tsrList = trixSearch(trix, wordCount, words, hasWild);
for (tsr = tsrList; tsr != NULL; tsr = tsr->next)
{
if (!isPrivate(conn, privateHash, tsr->itemId))
{
AllocVar(match);
match->imageId = sqlUnsigned(tsr->itemId);
slAddHead(&matchList, match);
}
}
trixSearchResultFreeList(&tsrList);
trixClose(&trix);
slReverse(&matchList);
}
freeMem(dupe);
return matchList;
}
static int hexToDecimal(char *hexString)
/* return decimal value for hex string (from utils/subChar/subChar.c) */
{
int acc = 0;
char c;
tolowers(hexString);
stripChar(hexString, '#'); /* can start with # (as in html) */
while ((c = *hexString++) != 0)
{
acc <<= 4;
if (c >= '0' && c <= '9')
acc += c - '0';
else if (c >= 'a' && c <= 'f')
acc += c + 10 - 'a';
/* ignoring bad characters
else
errAbort("Expecting hexadecimal character got %s", hexString);
*/
}
return acc;
}
static struct bed* parseSectionString(char* sectionString, struct hash* chromSizes)
/* returns a list of sections represented as beds as anything */
/* past a ':' given in the file name. given string should only be that portion.*/
/* passing a NULL sectionString produces the entire chromosomes from the */
/* chromSizes hash table. */
{
char* sections[1024];
struct bed* bedList = NULL;
if (sectionString) {
int numSections = 0;
int i;
char* s = cloneString(sectionString);
stripChar(s, ',');
numSections = chopString(s, ";", sections, ArraySize(sections));
for (i = 0; i < numSections; i++) {
struct bed* sec = sectionToBed(sections[i], chromSizes);
slAddHead(&bedList, sec);
}
slReverse(&bedList);
} else
bedList = sectionsFromChromSizes(chromSizes);
return bedList;
}
static void makeEnumValMenu(char *type, char ***pMenu, int *pMenuSize)
/* Given a SQL type description of an enum or set, parse out the list of
* values and turn them into a char array for menu display, with "*" as
* the first item (no constraint).
* This assumes that the values do not contain the ' character.
* This will leak a little mem unless you free *pMenu[1] and *pMenu
* when done. */
{
static char *noop = "*";
char *dup = NULL;
char *words[256];
int wordCount = 0;
int len = 0, i = 0;
if (startsWith("enum(", type))
dup = cloneString(type + strlen("enum("));
else if (startsWith("set(", type))
dup = cloneString(type + strlen("set("));
else
errAbort("makeEnumValMenu: expecting a SQL type description that begins "
"with \"enum(\" or \"set(\", but got \"%s\".", type);
stripChar(dup, '\'');
wordCount = chopCommas(dup, words);
len = strlen(words[wordCount-1]);
if (words[wordCount-1][len-1] == ')')
words[wordCount-1][len-1] = 0;
else
errAbort("makeEnumValMenu: expecting a ')' at the end of the last word "
"of SQL type, but got \"%s\"", type);
*pMenuSize = wordCount + 1;
AllocArray(*pMenu, wordCount+1);
*pMenu[0] = noop;
for (i = 1; i < wordCount + 1; i++)
{
(*pMenu)[i] = words[i-1];
}
}
boolean mahoneyNameAgrees(char *mName, char *name)
/* Return TRUE if mahoney name agrees with name. */
{
if (mName == NULL || mName[0] == 0 || name == NULL || name[0] == 0)
return FALSE;
else
{
char *mNameDupe = cloneString(mName);
char *nameDupe = cloneString(name);
char *s, *e;
boolean match = FALSE;
touppers(mNameDupe);
touppers(nameDupe);
stripChar(mNameDupe, ' ');
stripChar(mNameDupe, '-');
stripChar(mNameDupe, '.');
stripChar(nameDupe, ' ');
stripChar(nameDupe, '-');
stripChar(mNameDupe, '.');
verbose(2, "mahoneyNameAgrees %s (%s) %s (%s)", mName, mNameDupe, name, nameDupe);
s = mNameDupe;
while (s != NULL && s[0] != 0)
{
e = strchr(s, '/');
if (e != NULL)
*e++ = 0;
if (sameString(s, nameDupe))
{
match = TRUE;
break;
}
s = e;
}
verbose(2, " matches %d\n", match);
freeMem(mNameDupe);
freeMem(nameDupe);
return match;
}
}
void doMiddle()
{
struct hash *cvHash = raReadAll((char *)cvFile(), CV_TERM);
struct hashCookie hc = hashFirst(cvHash);
struct hashEl *hEl;
struct slList *termList = NULL;
struct hash *ra;
int totalPrinted = 0;
boolean excludeDeprecated = (cgiOptionalString("deprecated") == NULL);
// Prepare an array of selected terms (if any)
int requestCount = 0;
char **requested = NULL;
char *requestVal = termOpt;
char *queryBy = CV_TERM;
if (tagOpt)
{
requestVal = tagOpt;
queryBy = CV_TAG;
}
else if (targetOpt)
{
requestVal = targetOpt;
queryBy = CV_TERM; // request target is special: lookup term, convert to target, display target
}
else if (labelOpt)
{
requestVal = labelOpt;
queryBy = CV_LABEL;
}
if (requestVal)
{
(void)stripChar(requestVal,'\"');
requestCount = chopCommas(requestVal,NULL);
requested = needMem(requestCount * sizeof(char *));
chopByChar(requestVal,',',requested,requestCount);
}
char *org = NULL;
// if the org is specified in the type (eg. cell line)
// then use that for the org, otherwise use the command line option,
// otherwise use human.
char *type = findType(cvHash,requested,requestCount,&queryBy, &org, FALSE);
if (org == NULL)
org = organismOptLower;
if (org == NULL)
org = ORG_HUMAN;
// Special logic for requesting antibody by target
if (targetOpt && requestCount > 0 && sameWord(queryBy,CV_TERM) && sameWord(type,CV_TERM_ANTIBODY))
{
// Several antibodies may have same target.
// requested target={antibody} and found antibody
// Must now convert each of the requested terms to its target before displaying all targets
char **targets = convertAntibodiesToTargets(cvHash,requested,requestCount);
if (targets != NULL)
{
freeMem(requested);
requested = targets;
queryBy = CV_TARGET;
}
}
//warn("Query by: %s = '%s' type:%s",queryBy,requestVal?requestVal:"all",type);
// Get just the terms that match type and requested, then sort them
if (differentWord(type,CV_TOT) || typeOpt != NULL ) // If type resolves to typeOfTerm and
{ // typeOfTerm was not requested,
while ((hEl = hashNext(&hc)) != NULL) // then just show definition
{
ra = (struct hash *)hEl->val;
char *thisType = (char *)cvTermNormalized(hashMustFindVal(ra,CV_TYPE));
if (differentWord(thisType,type) && (requested == NULL
|| differentWord(thisType,CV_TERM_CONTROL)))
continue;
// Skip all rows that do not match queryBy param if specified
if (requested)
{
char *val = hashFindVal(ra, queryBy);
if (val == NULL)
{
// Special case for input that has no target
if (sameString(queryBy, CV_TARGET))
val = hashMustFindVal(ra, CV_TERM);
else
continue;
}
if (-1 == stringArrayIx(val,requested,requestCount))
continue;
}
else if (excludeDeprecated)
{
if (hashFindVal(ra, "deprecated") != NULL)
continue;
}
slAddTail(&termList, ra);
}
}
slSort(&termList, termCmp);
boolean described = doTypeDefinition(type,FALSE,(slCount(termList) == 0));
boolean sortable = (slCount(termList) > 5);
if (sortable)
{
webIncludeResourceFile("HGStyle.css");
jsIncludeFile("jquery.js",NULL);
jsIncludeFile("utils.js",NULL);
printf("<TABLE class='sortable' border=1 CELLSPACING=0 style='border: 2px outset #006600; "
"background-color:%s;'>\n",COLOR_BG_DEFAULT);
}
else
printf("<TABLE BORDER=1 BGCOLOR=%s CELLSPACING=0 CELLPADDING=2>\n",COLOR_BG_DEFAULT);
if (slCount(termList) > 0)
{
doTypeHeader(type, org,sortable);
// Print out the terms
while ((ra = slPopHead(&termList)) != NULL)
{
if (doTypeRow( ra, org ))
totalPrinted++;
}
}
puts("</TBODY></TABLE><BR>");
if (sortable)
jsInline("{$(document).ready(function() "
"{sortTable.initialize($('table.sortable')[0],true,true);});}\n");
if (totalPrinted == 0)
{
if (!described)
warn("Error: Unrecognised type (%s)\n", type);
}
else if (totalPrinted > 1)
printf("Total = %d\n", totalPrinted);
}
void fillInArrayFromPair(struct lm *lm, struct mafComp *native, struct mafComp *xeno,
struct orthoCds *array, int arraySize, int symCount)
/* Figure out the CDS in xeno for each position in native. */
{
char *nText = native->text, *xText = xeno->text;
int nSize = arraySize, xSize = symCount - countChars(xText, '-');
/* Create an array that for each point in native gives you the index of corresponding
* point in xeno, and another array that does the opposite. */
int *nToX, *xToN;
lmAllocArray(lm, nToX, nSize+1);
lmAllocArray(lm, xToN, xSize+1);
int i;
int nIx = 0, xIx = 0;
for (i=0; i<symCount; ++i)
{
char n = nText[i], x = xText[i];
if (n == '.')
errAbort("Dot in native component %s of maf. Can't handle it.", native->src);
nToX[nIx] = xIx;
xToN[xIx] = nIx;
if (n != '-')
{
array[nIx].base = x;
nToX[nIx] = xIx;
++nIx;
}
if (x != '-')
++xIx;
}
assert(xIx == xSize);
assert(nIx == nSize);
/* Put an extra value at end of arrays to simplify logic. */
nToX[nSize] = xSize;
xToN[xSize] = nSize;
/* Create xeno sequence without the '-' chars */
char *xDna = lmCloneString(lm, xText);
tolowers(xDna);
stripChar(xDna, '-');
#ifdef DEBUG
uglyf("xToN:");
for (i=0; i<xSize; ++i) uglyf(" %d", xToN[i]);
uglyf("\n");
#endif /* DEBUG */
/* Step through this, one frame at a time, looking for best ORF */
int frame;
for (frame=0; frame<3; ++frame)
{
/* Calculate some things constant for this frame, and deal with
* ORF that starts at beginning (may not have ATG) */
int lastPos = xSize-3;
int frameDnaSize = xSize-frame;
int start = frame, end = findOrfEnd(xDna, frameDnaSize, frame);
applyOrf(start, end, xDna, xToN, array, arraySize);
for (start = end; start<=lastPos; )
{
// uglyf("start %d %c%c%c\n", start, xDna[start], xDna[start+1], xDna[start+2]);
if (startsWith("atg", xDna+start))
{
end = findOrfEnd(xDna, frameDnaSize, start);
applyOrf(start, end, xDna, xToN, array, arraySize);
start = end;
}
else
start += 3;
}
}
}
struct wordTree *wordTreeForChainsInFile(char *fileName, int chainSize, struct lm *lm)
/* Return a wordTree of all chains-of-words of length chainSize seen in file.
* Allocate the structure in local memory pool lm. */
{
/* Stuff for processing file a line at a time. */
struct lineFile *lf = lineFileOpen(fileName, TRUE);
char *line, *word;
/* We'll keep a chain of three or so words in a doubly linked list. */
struct dlNode *node;
struct dlList *chain = dlListNew();
int curSize = 0;
/* We'll build up the tree starting with an empty root node. */
struct wordTree *wt = wordTreeNew("");
int wordCount = 0;
/* Save time/space by sharing stack between all "following" rbTrees. */
struct rbTreeNode **stack;
lmAllocArray(lm, stack, 256);
/* Loop through each line of input file, lowercasing the whole line, and then
* looping through each word of line, stripping out special chars, and finally
* processing each word. */
while (lineFileNext(lf, &line, NULL))
{
if (lower)
tolowers(line);
while ((word = nextWord(&line)) != NULL)
{
if (unpunc)
{
stripChar(word, ',');
stripChar(word, '.');
stripChar(word, ';');
stripChar(word, '-');
stripChar(word, '"');
stripChar(word, '?');
stripChar(word, '!');
stripChar(word, '(');
stripChar(word, ')');
if (word[0] == 0)
continue;
}
verbose(2, "%s\n", word);
/* We come to this point in the code for each word in the file.
* Here we want to maintain a chain of sequential words up to
* chainSize long. We do this with a doubly-linked list structure.
* For the first few words in the file we'll just build up the list,
* only adding it to the tree when we finally do get to the desired
* chain size. Once past the initial section of the file we'll be
* getting rid of the first link in the chain as well as adding a new
* last link in the chain with each new word we see. */
if (curSize < chainSize)
{
dlAddValTail(chain, cloneString(word));
++curSize;
if (curSize == chainSize)
addChainToTree(wt, chain, lm, stack);
}
else
{
/* Reuse doubly-linked-list node, but give it a new value, as we move
* it from head to tail of list. */
node = dlPopHead(chain);
freeMem(node->val);
node->val = cloneString(word);
dlAddTail(chain, node);
addChainToTree(wt, chain, lm, stack);
}
++wordCount;
}
}
/* Handle last few words in file, where can't make a chain of full size. Need
* a special case for file that has fewer than chain size words too. */
if (curSize < chainSize)
addChainToTree(wt, chain, lm, stack);
while ((node = dlPopHead(chain)) != NULL)
{
addChainToTree(wt, chain, lm, stack);
freeMem(node->val);
freeMem(node);
}
dlListFree(&chain);
lineFileClose(&lf);
return wt;
}
/** main: initialize our shell, and loop until user specifies
* exit with the appropriate commands.
* @param c - user input (beginning with "cd ")
*/
int main(int argc, char * argv[]) {
char input[SIZE];
int fk = 0;
fillPathStack();
int OopsOrNah = -1;
bool bg = false;
if(argc == 2){
OopsOrNah = open(argv[1], O_RDWR);
if( OopsOrNah >= 0){
dup2(OopsOrNah, STDIN_FILENO);
} else {
return throwError();
}
}
// loop until user exits
while (1) {
if (OopsOrNah < 0){
char* prompt = "CShell> ";
write(STDOUT_FILENO, (void*) prompt, sizeof(prompt)-1);
}
fgets(input, SIZE, stdin);
stripString(input);
if(OopsOrNah >=0){puts(input);}
int lastcharidx = lastChar(input);
if (lastcharidx >= 0) {
if (input[lastcharidx] == '&') {
stripChar(input, '&');
stripEndSpace(input);
fk = fork();
bg = true;
}
}
//fork failed; exit
if (fk < 0) {
fprintf(stderr, "fork failed\n");
exit(1);
}
// child process: runs bash
else if (fk == 0) {
if (bg) {
strcat(input, " &");
bg = false;
}
int result = parse(input);
if (result == ERROR_CODE) {
continue;
} if (result == FORCE_EXIT) {
return SUCCESS;
}
}
//parent does nothing
else {
wait(NULL);
exit(0);
}
}
return SUCCESS;
}
struct cutter *readGcg(char *gcgFile)
/* Parse a GCG file and load it into cutter format. */
{
struct lineFile *lf = lineFileOpen(gcgFile,TRUE);
struct cutter *enzList = NULL;
char *line = "whatever", *words[10], numWords;
/* Skip to the right line. */
while (lineFileNext(lf,&line,NULL) && !startsWith("..",line));
/* */
while ((numWords=lineFileChop(lf,words)))
{
struct cutter *newone = NULL;
int comIx = (numWords==7) ? 5 : 6;
int refIx = (numWords==7) ? 6 : 7;
int i;
char *items[100];
/* Skip ones */
if (words[4][0] == '?')
continue;
AllocVar(newone);
newone->semicolon = (words[0][0] == ';') ? TRUE : FALSE;
/* Deal with the first few columns */
if (!isdigit(words[1][0]))
errAbort("Error: expecting a number in cut site column on line %d\n", lf->lineIx+1);
if (!isdigit(words[3][0]) && words[3][0]!='-')
errAbort("Error: expecting a number in the overhang column on line %d\n", lf->lineIx+1);
if (words[comIx][0] != '>')
errAbort("Error: expecting a \'>\' in the commercial sources column of line %d\n", lf->lineIx+1);
newone->name = (words[0][0] == ';') ? cloneString(words[0]+1) : cloneString(words[0]);
newone->cut = atoi(words[1]);
newone->seq = cloneString(words[2]);
touppers(newone->seq);
stripChar(newone->seq,'\'');
stripChar(newone->seq,'_');
newone->size = strlen(newone->seq);
newone->matchSize = newone->size - countChars(newone->seq, 'N');
newone->palindromic = isPalindrome(newone->seq);
newone->overhang = atoi(words[3]);
newone->numCompanies = strlen(words[comIx]+1);
if (newone->numCompanies > 0)
newone->companies = cloneMem(words[comIx]+1, newone->numCompanies*sizeof(char));
newone->numRefs = chopString(words[refIx], ",", items, ArraySize(items));
AllocArray(newone->refs, newone->numRefs);
for (i = 0; i < newone->numRefs; i++)
{
if (i == 100)
errAbort("Error: Andy didn't make the array for holding references big enough\n");
if (!isdigit(items[i][0]))
errAbort("Error: expecting number in references column in line %d\n", lf->lineIx+1);
newone->refs[i] = atoi(items[i]);
}
/* Deal with isoscizomers. */
if (numWords == 8)
{
newone->numSciz = chopString(words[5], ",", items, ArraySize(items));
AllocArray(newone->scizs, newone->numSciz*sizeof(int));
for (i = 0; i < newone->numSciz; i++)
{
if (i == 100)
errAbort("Error: Andy didn't make the array for having isoscizomers big enough\n");
newone->scizs[i] = cloneString(items[i]);
}
}
else
newone->numSciz = 0;
slAddHead(&enzList, newone);
}
slReverse(&enzList);
lineFileClose(&lf);
return enzList;
}
/** changeDirectory: handle the change directory command
* @param c - user input (beginning with "cd ")
* @return ERROR_CODE if an error is thrown
*/
int changeDirectory(char * c) {
int result;
char path[SIZE];
memset(&path[0], 0, sizeof(path));
stripChar(c, '&');
stripEndSpace(c);
int i = 2; //jump to beginning of input path
while (c[i] == CHAR_SPACE) {
i++;
}
// changing to home, means user only wrote "cd"
if (c[i] == 0 || c[i] == '\n') {
char* homePath = getenv("HOME");
result = chdir(homePath);
if (result == 0) {//chdir worked
clearStack();
char* homeTokens;
homeTokens = strtok(homePath, "/");
//get tokens based on /
while (homeTokens != NULL) {
push(homeTokens);
homeTokens = strtok(NULL, "/");
}
}
}
//otherwise user gave more info about directory traversal
else {
stripChar(c, '\n'); //remove newline
strtok(c, " "); //skip to path characters
char * token[SIZE];
int z = 0;
token[z] = strtok(NULL, "/");
//get tokens based on /
while (token[z] != NULL) {
z++;
token[z] = strtok(NULL, "/");
}
//this means an absolute path
if (strncmp(home, token[0], 4) == 0) {
strcat(path, "/");
int p = 0;
for (; p < z; p++) {
strcat(path, token[p]);
strcat(path, "/");
}
result = chdir(path);
if (result == 0) {
clearStack();
int v = 0;
for (; v < z; v++) {
push(token[v]);
}
} else {
return throwError();
}
}
// relative path
else {
copyStack(); //save the stack state of path
bool root = false;
int f = 0;
for (; f <z; f++) {
if (strncmp(dotdot, token[f], 2) == 0) {
// user tries to traverse past root
if (stackPointer == 0) {
root = true;
break;
} else {
pop();
}
} else {
push(token[f]);
}
}
// user has not gone past root
if (!root) {
strcat(path, "/");
int p = 0;
for (; p < stackPointer; p++) {
strcat(path, pathStack[p]);
strcat(path, "/");
}
result = chdir(path);
if (result != 0) {
replaceStack();
return throwError();
}
}
// user goes past root, in command, so reload stack
else {
replaceStack();
return throwError();
}
}
}
return SUCCESS;
}
void submitRefToFiles(struct sqlConnection *conn, struct sqlConnection *conn2, struct sqlConnection *connSp,
char *ref, char *fileRoot, char *inJax)
/* Create a .ra and a .tab file for given reference. */
{
/* Initially the tab file will have some duplicate lines, so
* write to temp file, and then filter. */
char raName[PATH_LEN], tabName[PATH_LEN], capName[PATH_LEN];
FILE *ra = NULL, *tab = NULL, *cap = NULL;
struct dyString *query = dyStringNew(0);
struct sqlResult *sr;
char **row;
char *pubMed;
struct slName *list, *el;
boolean gotAny = FALSE;
struct hash *uniqImageHash = newHash(0);
struct hash *captionHash = newHash(0);
int imageWidth = 0, imageHeight = 0;
char path[PATH_LEN];
struct dyString *caption = dyStringNew(0);
struct dyString *copyright = dyStringNew(0);
struct dyString *probeNotes = dyStringNew(0);
boolean lookedForCopyright = FALSE;
safef(raName, sizeof(raName), "%s.ra", fileRoot);
safef(tabName, sizeof(tabName), "%s.tab", fileRoot);
safef(capName, sizeof(capName), "%s.txt", fileRoot);
tab = mustOpen(tabName, "w");
cap = mustOpen(capName, "w");
sqlDyStringPrintf(query, "select authors,journal,title,year from BIB_Refs where ");
sqlDyStringPrintf(query, "_Refs_key = '%s'", ref);
sr = sqlGetResultVerbose(conn, query->string);
row = sqlNextRow(sr);
if (row == NULL)
errAbort("Can't find _Refs_key %s in BIB_Refs", ref);
/* Make ra file with stuff common to whole submission set. */
ra = mustOpen(raName, "w");
fprintf(ra, "submissionSource MGI\n");
fprintf(ra, "acknowledgement Thanks to the Gene Expression Database group at "
"Mouse Genome Informatics (MGI) for collecting, annotating and sharing "
"this image. The MGI images were last updated in VisiGene on March 28, 2006. "
"Additional and more up to date annotations and images may be available "
"directly at <A HREF='http://www.informatics.jax.org' target='_blank'>MGI.</A>\n");
fprintf(ra, "submitSet jax%s\n", ref);
fprintf(ra, "taxon 10090\n"); /* Mus musculus taxon */
fprintf(ra, "fullDir http://hgwdev.gi.ucsc.edu/visiGene/full/inSitu/Mouse/jax\n");
fprintf(ra, "thumbDir http://hgwdev.gi.ucsc.edu/visiGene/200/inSitu/Mouse/jax\n");
fprintf(ra, "setUrl http://www.informatics.jax.org/\n");
fprintf(ra, "itemUrl http://www.informatics.jax.org/searches/image.cgi?%%s\n");
fprintf(ra, "abUrl http://www.informatics.jax.org/searches/antibody.cgi?%%s\n");
fprintf(ra, "journal %s\n", row[1]);
fprintf(ra, "publication %s\n", row[2]);
fprintf(ra, "year %s\n", row[3]);
/* The contributor (author) list is in format Kent WJ; Haussler DH; format in
* Jackson. We convert it to Kent W.J.,Haussler D.H., format for visiGene. */
fprintf(ra, "contributor ");
list = charSepToSlNames(row[0], ';');
for (el = list; el != NULL; el = el->next)
{
char *lastName = skipLeadingSpaces(el->name);
char *initials = strrchr(lastName, ' ');
if (initials == NULL)
initials = "";
else
*initials++ = 0;
fprintf(ra, "%s", lastName);
if (initials[0] != 0)
{
char c;
fprintf(ra, " ");
while ((c = *initials++) != 0)
fprintf(ra, "%c.", c);
}
fprintf(ra, ",");
}
fprintf(ra, "\n");
slNameFreeList(&list);
sqlFreeResult(&sr);
/* Add in link to PubMed record on publication. */
dyStringClear(query);
sqlDyStringPrintf(query,
"select ACC_Accession.accID from ACC_Accession,ACC_LogicalDB "
"where ACC_Accession._Object_key = %s "
"and ACC_Accession._LogicalDB_key = ACC_LogicalDB._LogicalDB_key "
"and ACC_LogicalDB.name = 'PubMed'", ref);
pubMed = sqlQuickStringVerbose(conn, query->string);
if (pubMed != NULL)
fprintf(ra, "pubUrl https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=%s\n", pubMed);
freez(&pubMed);
dyStringClear(query);
sqlDyStringPrintf(query,
"select distinct MRK_Marker.symbol as gene,"
"GXD_Specimen.sex as sex,"
"GXD_Specimen.age as age,"
"GXD_Specimen.ageMin as ageMin,"
"GXD_Specimen.ageMax as ageMax,"
"IMG_ImagePane.paneLabel as paneLabel,"
"ACC_Accession.numericPart as fileKey,"
"IMG_Image._Image_key as imageKey,"
"GXD_Assay._ProbePrep_key as probePrepKey,"
"GXD_Assay._AntibodyPrep_key as antibodyPrepKey,"
"GXD_Assay._ReporterGene_key as reporterGeneKey,"
"GXD_FixationMethod.fixation as fixation,"
"GXD_EmbeddingMethod.embeddingMethod as embedding,"
"GXD_Assay._Assay_key as assayKey,"
"GXD_Specimen.hybridization as sliceType,"
"GXD_Specimen._Genotype_key as genotypeKey,"
"IMG_ImagePane._ImagePane_key as imagePaneKey\n"
"from MRK_Marker,"
"GXD_Assay,"
"GXD_Specimen,"
"GXD_InSituResult,"
"GXD_InSituResultImage,"
"GXD_FixationMethod,"
"GXD_EmbeddingMethod,"
"IMG_ImagePane,"
"IMG_Image,"
"ACC_Accession\n"
"where MRK_Marker._Marker_key = GXD_Assay._Marker_key "
"and GXD_Assay._Assay_key = GXD_Specimen._Assay_key "
"and GXD_Specimen._Specimen_key = GXD_InSituResult._Specimen_key "
"and GXD_InSituResult._Result_key = GXD_InSituResultImage._Result_key "
"and GXD_InSituResultImage._ImagePane_key = IMG_ImagePane._ImagePane_key "
"and GXD_FixationMethod._Fixation_key = GXD_Specimen._Fixation_key "
"and GXD_EmbeddingMethod._Embedding_key = GXD_Specimen._Embedding_key "
"and IMG_ImagePane._Image_key = IMG_Image._Image_key "
"and IMG_Image._Image_key = ACC_Accession._Object_key "
"and ACC_Accession.prefixPart = 'PIX:' "
"and GXD_Assay._ImagePane_key is NULL "
);
sqlDyStringPrintf(query, "and GXD_Assay._Refs_key = '%s'", ref);
sr = sqlGetResultVerbose(conn, query->string);
fprintf(tab, "#");
fprintf(tab, "gene\t");
fprintf(tab, "probeColor\t");
fprintf(tab, "sex\t");
fprintf(tab, "age\t");
fprintf(tab, "ageMin\t");
fprintf(tab, "ageMax\t");
fprintf(tab, "paneLabel\t");
fprintf(tab, "fileName\t");
fprintf(tab, "submitId\t");
fprintf(tab, "fPrimer\t");
fprintf(tab, "rPrimer\t");
fprintf(tab, "abName\t");
fprintf(tab, "abTaxon\t");
fprintf(tab, "abSubmitId\t");
fprintf(tab, "fixation\t");
fprintf(tab, "embedding\t");
fprintf(tab, "bodyPart\t");
fprintf(tab, "sliceType\t");
fprintf(tab, "genotype\t");
fprintf(tab, "strain\t");
fprintf(tab, "priority\t");
fprintf(tab, "captionId\t");
fprintf(tab, "imageWidth\t");
fprintf(tab, "imageHeight\n");
while ((row = sqlNextRow(sr)) != NULL)
{
char *gene = row[0];
char *sex = row[1];
char *age = row[2];
char *ageMin = row[3];
char *ageMax = row[4];
char *paneLabel = row[5];
char *fileKey = row[6];
char *imageKey = row[7];
char *probePrepKey = row[8];
char *antibodyPrepKey = row[9];
char *reporterGeneKey = row[10];
char *fixation = row[11];
char *embedding = row[12];
char *assayKey = row[13];
char *sliceType = row[14];
char *genotypeKey = row[15];
char *imagePaneKey = row[16];
double calcAge = -1;
char *probeColor = "";
char *bodyPart = "";
char *abName = NULL;
char *rPrimer = NULL, *fPrimer = NULL;
char *genotype = NULL;
char *strain = NULL;
char *priority = NULL;
char abTaxon[32];
char *captionId = "";
char *abSubmitId = NULL;
verbose(3, " "); dumpRow(row, 16);
if (age == NULL)
continue;
if (!lookedForCopyright)
{
struct sqlResult *sr = NULL;
char **row;
lookedForCopyright = TRUE;
dyStringClear(query);
sqlDyStringPrintf(query,
"select note from MGI_NoteChunk,MGI_Note,MGI_NoteType,ACC_MGIType "
"where MGI_Note._Object_key = %s "
"and ACC_MGIType.name = 'Image' "
"and ACC_MGIType._MGIType_key = MGI_Note._MGIType_key "
"and MGI_NoteType.noteType='Copyright' "
"and MGI_Note._NoteType_key = MGI_NoteType._NoteType_key "
"and MGI_Note._Note_key = MGI_NoteChunk._Note_key "
"order by sequenceNum"
, imageKey);
sr = sqlGetResultVerbose(conn2, query->string);
while ((row = sqlNextRow(sr)) != NULL)
dyStringAppend(copyright, row[0]);
sqlFreeResult(&sr);
verbose(2,"imageKey=%s\n",imageKey);
if (copyright->stringSize != 0)
{
fprintf(ra, "copyright %s\n", copyright->string);
}
}
/* Massage sex */
{
if (sameString(sex, "Male"))
sex = "male";
else if (sameString(sex, "Female"))
sex = "female";
else
sex = "";
}
/* Massage age */
{
char *embryoPat = "embryonic day ";
char *newbornPat = "postnatal newborn";
char *dayPat = "postnatal day ";
char *weekPat = "postnatal week ";
char *adultPat = "postnatal adult";
double calcMinAge = atof(ageMin);
double calcMaxAge = atof(ageMax);
double mouseBirthAge = 21.0;
//double mouseAdultAge = 63.0; /* Relative to conception, not birth */
if (age[0] == 0)
{
warn("age null, ageMin %s, ageMax %s\n", ageMin, ageMax);
calcAge = (calcMinAge + calcMaxAge) * 0.5;
}
else if (startsWith(embryoPat, age))
calcAge = atof(age+strlen(embryoPat));
else if (sameString(newbornPat, age))
calcAge = mouseBirthAge;
else if (startsWith(dayPat, age))
calcAge = atof(age+strlen(dayPat)) + mouseBirthAge;
else if (startsWith(weekPat, age))
calcAge = 7.0 * atof(age+strlen(weekPat)) + mouseBirthAge;
else if (sameString(adultPat, age) && calcMaxAge - calcMinAge > 1000
&& calcMinAge < 365)
calcAge = 365; /* Most adult mice are relatively young */
else
{
warn("Calculating age from %s", age);
calcAge = (calcMinAge + calcMaxAge) * 0.5;
}
if (calcAge < calcMinAge)
calcAge = calcMinAge;
if (calcAge > calcMaxAge)
calcAge = calcMaxAge;
}
/* Massage probeColor */
{
if (!isStrNull(reporterGeneKey))
{
/* Fixme: make sure that reporterGene's end up in probeType table. */
char *name = NULL;
dyStringClear(query);
sqlDyStringPrintf(query,
"select term from VOC_Term where _Term_key = %s",
reporterGeneKey);
name = sqlQuickStringVerbose(conn2, query->string);
if (name == NULL)
warn("Can't find _ReporterGene_key %s in VOC_Term",
reporterGeneKey);
else if (sameString(name, "GFP"))
probeColor = "green";
else if (sameString(name, "lacZ"))
probeColor = "blue";
else
warn("Don't know color of reporter gene %s", name);
freez(&name);
}
if (!isStrNull(probePrepKey))
{
char *name = NULL;
dyStringClear(query);
sqlDyStringPrintf(query,
"select GXD_VisualizationMethod.visualization "
"from GXD_VisualizationMethod,GXD_ProbePrep "
"where GXD_ProbePrep._ProbePrep_key = %s "
"and GXD_ProbePrep._Visualization_key = GXD_VisualizationMethod._Visualization_key"
, probePrepKey);
name = sqlQuickStringVerbose(conn2, query->string);
if (name == NULL)
warn("Can't find visualization from _ProbePrep_key %s", probePrepKey);
probeColor = colorFromLabel(name, gene);
freez(&name);
if (probeColor[0] == 0)
{
dyStringClear(query);
sqlDyStringPrintf(query,
"select GXD_Label.label from GXD_Label,GXD_ProbePrep "
"where GXD_ProbePrep._ProbePrep_key = %s "
"and GXD_ProbePrep._Label_key = GXD_Label._Label_key"
, probePrepKey);
name = sqlQuickStringVerbose(conn2, query->string);
if (name == NULL)
warn("Can't find label from _ProbePrep_key %s",
probePrepKey);
probeColor = colorFromLabel(name, gene);
}
freez(&name);
}
if (!isStrNull(antibodyPrepKey) && probeColor[0] == 0 )
{
char *name = NULL;
dyStringClear(query);
sqlDyStringPrintf(query,
"select GXD_Label.label from GXD_Label,GXD_AntibodyPrep "
"where GXD_AntibodyPrep._AntibodyPrep_key = %s "
"and GXD_AntibodyPrep._Label_key = GXD_Label._Label_key"
, antibodyPrepKey);
name = sqlQuickStringVerbose(conn2, query->string);
if (name == NULL)
warn("Can't find label from _AntibodyPrep_key %s", antibodyPrepKey);
probeColor = colorFromLabel(name, gene);
freez(&name);
}
}
/* Get abName, abTaxon, abSubmitId */
abTaxon[0] = 0;
if (!isStrNull(antibodyPrepKey))
{
struct sqlResult *sr = NULL;
int orgKey = 0;
char **row;
dyStringClear(query);
sqlDyStringPrintf(query,
"select antibodyName,_Organism_key,GXD_Antibody._Antibody_key "
"from GXD_AntibodyPrep,GXD_Antibody "
"where GXD_AntibodyPrep._AntibodyPrep_key = %s "
"and GXD_AntibodyPrep._Antibody_key = GXD_Antibody._Antibody_key"
, antibodyPrepKey);
sr = sqlGetResultVerbose(conn2, query->string);
row = sqlNextRow(sr);
if (row != NULL)
{
abName = cloneString(row[0]);
orgKey = atoi(row[1]);
abSubmitId = cloneString(row[2]);
}
sqlFreeResult(&sr);
if (orgKey > 0)
{
char *latinName = NULL, *commonName = NULL;
int spTaxon = 0;
dyStringClear(query);
sqlDyStringPrintf(query, "select latinName from MGI_Organism "
"where _Organism_key = %d", orgKey);
latinName = sqlQuickStringVerbose(conn2, query->string);
if (latinName != NULL
&& !sameString(latinName, "Not Specified")
&& !sameString(latinName, "Not Applicable"))
{
char *e = strchr(latinName, '/');
if (e != NULL)
*e = 0; /* Chop off / and after. */
spTaxon = spBinomialToTaxon(connSp, latinName);
}
else
{
dyStringClear(query);
sqlDyStringPrintf(query, "select commonName from MGI_Organism "
"where _Organism_key = %d", orgKey);
commonName = sqlQuickStringVerbose(conn2, query->string);
if (commonName != NULL
&& !sameString(commonName, "Not Applicable")
&& !sameString(commonName, "Not Specified"))
{
spTaxon = spCommonToTaxon(connSp, commonName);
}
}
if (spTaxon != 0)
safef(abTaxon, sizeof(abTaxon), "%d", spTaxon);
freez(&latinName);
freez(&commonName);
}
}
if (abName == NULL)
abName = cloneString("");
if (abSubmitId == NULL)
abSubmitId = cloneString("");
/* Get rPrimer, lPrimer */
if (!isStrNull(probePrepKey))
{
struct sqlResult *sr = NULL;
char **row;
dyStringClear(query);
sqlDyStringPrintf(query,
"select primer1sequence,primer2sequence "
"from PRB_Probe,GXD_ProbePrep "
"where PRB_Probe._Probe_key = GXD_ProbePrep._Probe_key "
"and GXD_ProbePrep._ProbePrep_key = %s"
, probePrepKey);
sr = sqlGetResultVerbose(conn2, query->string);
row = sqlNextRow(sr);
if (row != NULL)
{
fPrimer = cloneString(row[0]);
rPrimer = cloneString(row[1]);
}
sqlFreeResult(&sr);
}
/* Note Jackson database actually stores the primers very
* erratically. In all the cases I can find for in situs
* the primers are actually stored in free text in the PRB_Notes
* e.g. ... primers CGCGGATCCAGGGGAAACAGAAGGGCTGCG and CCCAAGCTTAGACTGTACAGGCTGAGCC ...
*/
if (fPrimer == NULL || fPrimer[0]==0)
{
struct sqlResult *sr = NULL;
char **row;
dyStringClear(query);
sqlDyStringPrintf(query,
"select PRB_Notes.note from GXD_ProbePrep, PRB_Notes"
" where GXD_ProbePrep._ProbePrep_key = %s"
" and GXD_ProbePrep._Probe_key = PRB_Notes._Probe_key"
" order by PRB_Notes.sequenceNum"
, probePrepKey);
sr = sqlGetResultVerbose(conn2, query->string);
dyStringClear(probeNotes);
while ((row = sqlNextRow(sr)) != NULL)
dyStringAppend(probeNotes, row[0]);
sqlFreeResult(&sr);
if (probeNotes->stringSize > 0)
{
char f[256];
char r[256];
int i = 0;
char *s = strstr(probeNotes->string," primers ");
if (s)
{
s += strlen(" primers ");
i = 0;
while (strchr("ACGT",*s) && (i<sizeof(f)))
f[i++] = *s++;
f[i]=0;
if (strstr(s," and ")==s)
{
s += strlen(" and ");
i = 0;
while (strchr("ACGT",*s) && (i<sizeof(r)))
r[i++] = *s++;
r[i]=0;
if (strlen(f) >= 10 && strlen(r) >= 10)
{
fPrimer = cloneString(f);
rPrimer = cloneString(r);
}
else
{
verbose(1, "bad primer parse:_ProbePrep_key=%s fPrimer=[%s], rPrimer=[%s]\n",
probePrepKey,f,r);
}
}
}
}
}
if (fPrimer == NULL)
fPrimer = cloneString("");
if (rPrimer == NULL)
rPrimer = cloneString("");
fixation = blankOutUnknown(fixation);
embedding = blankOutUnknown(embedding);
/* Massage body part and slice type. We only handle whole mounts. */
if (sameString(sliceType, "whole mount"))
{
bodyPart = "whole";
priority = "100";
}
else
{
sliceType = "";
priority = "1000";
}
genotypeAndStrainFromKey(genotypeKey, conn2, &genotype, &strain);
if (isStrNull(paneLabel))
paneLabel = cloneString(""); /* trying to suppress nulls in output */
stripChar(paneLabel, '"'); /* Get rid of a difficult quote to process. */
/* Fetch image dimensions from file. */
imageWidth=0;
imageHeight=0;
safef(path, sizeof(path), "%s/%s.jpg", inJax, fileKey);
if (fileExists(path))
jpegSize(path,&imageWidth,&imageHeight); /* will errAbort if no valid .jpeg exists */
else
warn("Picture Missing! %s ",path);
/* Deal caption if any. Most of the work only happens the
* first time see the image. */
if (!hashLookup(uniqImageHash, imageKey))
{
struct sqlResult *sr = NULL;
char **row;
hashAdd(uniqImageHash, imageKey, NULL);
dyStringClear(caption);
dyStringClear(query);
sqlDyStringPrintf(query,
"select note from MGI_NoteChunk,MGI_Note,MGI_NoteType,ACC_MGIType "
"where MGI_Note._Object_key = %s "
"and ACC_MGIType.name = 'Image' "
"and ACC_MGIType._MGIType_key = MGI_Note._MGIType_key "
"and MGI_NoteType.noteType='Caption' "
"and MGI_Note._NoteType_key = MGI_NoteType._NoteType_key "
"and MGI_Note._Note_key = MGI_NoteChunk._Note_key "
"order by sequenceNum"
, imageKey);
sr = sqlGetResultVerbose(conn2, query->string);
while ((row = sqlNextRow(sr)) != NULL)
dyStringAppend(caption, row[0]);
sqlFreeResult(&sr);
if (caption->stringSize > 0)
{
subChar(caption->string, '\t', ' ');
subChar(caption->string, '\n', ' ');
fprintf(cap, "%s\t%s\n", imageKey, caption->string);
hashAdd(captionHash, imageKey, imageKey);
}
}
if (hashLookup(captionHash, imageKey))
captionId = imageKey;
else
captionId = "";
fprintf(tab, "%s\t", gene);
fprintf(tab, "%s\t", probeColor);
fprintf(tab, "%s\t", sex);
fprintf(tab, "%3.2f\t", calcAge);
fprintf(tab, "%s\t", ageMin);
fprintf(tab, "%s\t", ageMax);
fprintf(tab, "%s\t", paneLabel); /* may have to change NULL to empty string or "0" ? */
fprintf(tab, "%s.jpg\t", fileKey);
fprintf(tab, "%s\t", imageKey);
fprintf(tab, "%s\t", fPrimer);
fprintf(tab, "%s\t", rPrimer);
fprintf(tab, "%s\t", abName);
fprintf(tab, "%s\t", abTaxon);
fprintf(tab, "%s\t", abSubmitId);
fprintf(tab, "%s\t", fixation);
fprintf(tab, "%s\t", embedding);
fprintf(tab, "%s\t", bodyPart);
fprintf(tab, "%s\t", sliceType);
fprintf(tab, "%s\t", genotype);
fprintf(tab, "%s\t", strain);
fprintf(tab, "%s\t", priority);
fprintf(tab, "%s\t", captionId);
fprintf(tab, "%d\t", imageWidth);
fprintf(tab, "%d\n", imageHeight);
printExpression(tab, conn2, imagePaneKey, assayKey);
gotAny = TRUE;
freez(&genotype);
freez(&abName);
freez(&abSubmitId);
freez(&rPrimer);
freez(&fPrimer);
}
sqlFreeResult(&sr);
carefulClose(&ra);
carefulClose(&tab);
carefulClose(&cap);
if (!gotAny)
{
remove(raName);
remove(capName);
remove(tabName);
}
dyStringFree(&probeNotes);
dyStringFree(©right);
dyStringFree(&caption);
dyStringFree(&query);
hashFree(&uniqImageHash);
hashFree(&captionHash);
}
void readOneOut(char *rmskFile)
/* Read .out file rmskFile, check each line, and print OK lines to .tab. */
{
struct lineFile *lf;
char *line, *words[24];
int lineSize, wordCount;
/* Open .out file and process header. */
lf = lineFileOpen(rmskFile, TRUE);
if (!lineFileNext(lf, &line, &lineSize))
errAbort("Empty %s", lf->fileName);
if (!startsWith(" SW perc perc", line))
{
if (!startsWith(" SW perc perc", line))
errAbort("%s doesn't seem to be a RepeatMasker .out file, first "
"line seen:\n%s", lf->fileName, line);
}
lineFileNext(lf, &line, &lineSize);
lineFileNext(lf, &line, &lineSize);
/* Process line oriented records of .out file. */
while (lineFileNext(lf, &line, &lineSize))
{
static struct rmskOut2 r;
char *s;
wordCount = chopLine(line, words);
if (wordCount < 14)
errAbort("Expecting 14 or 15 words line %d of %s",
lf->lineIx, lf->fileName);
r.swScore = atoi(words[0]);
r.milliDiv = makeMilli(words[1], lf);
r.milliDel = makeMilli(words[2], lf);
r.milliIns = makeMilli(words[3], lf);
r.genoName = words[4];
r.genoStart = atoi(words[5])-1;
r.genoEnd = atoi(words[6]);
r.genoLeft = parenInt(words[7], lf);
r.strand[0] = (words[8][0] == '+' ? '+' : '-');
r.repName = words[9];
r.repClass = words[10];
char *repClassTest = cloneString(r.repClass);
stripChar(repClassTest, '(');
stripChar(repClassTest, ')');
int nonDigitCount = countLeadingNondigits(repClassTest);
int wordOffset = 0;
// this repClass is only digits, (or only (digits) with surrounding parens)
// this is the sign of an empty field here
// due to custom library in use that has no class/family indication
if (0 == nonDigitCount)
{
wordOffset = 1;
r.repClass = cloneString("Unspecified");
r.repFamily = cloneString("Unspecified");
}
else
{
s = strchr(r.repClass, '/');
if (s == NULL)
r.repFamily = r.repClass;
else
{
*s++ = 0;
r.repFamily = s;
}
}
r.repStart = parenInt(words[11-wordOffset], lf);
r.repEnd = atoi(words[12-wordOffset]);
r.repLeft = parenInt(words[13-wordOffset], lf);
r.id = atoi(words[14-wordOffset]);
if (words[8][0] == 'C')
{
r.repLeft = parenInt(words[11-wordOffset], lf);
r.repStart = parenInt(words[13-wordOffset], lf);
}
if (checkRepeat(&r, lf))
{
FILE *f = getFileForChrom(r.genoName);
if (!noBin)
fprintf(f, "%u\t", hFindBin(r.genoStart, r.genoEnd));
rmskOut2TabOut(&r, f);
}
}
}
void gensatImageDownload(char *gensatXml, char *outDir, char *outLog)
/* gensatImageDownload - Download images from gensat guided by xml file.. */
{
struct xap *xap;
struct gsGensatImage *image;
char *ftpUri = "ftp://ftp.ncbi.nih.gov/pub/gensat";
char *jpgCgiUri = "http://www.ncbi.nlm.nih.gov/projects/gensat/gensat_img.cgi?action=image&mode=full&fmt=jpeg&id=";
char finalJpg[PATH_LEN];
char finalDir[PATH_LEN];
char wgetSource[PATH_LEN];
struct hash *dirHash = newHash(16);
struct dyString *mkdir = dyStringNew(0);
int imageIx = 0;
fLog = mustOpen(outLog, "a");
fprintf(fLog, "starting gensatImageDownload from %s to %s\n", gensatXml, outDir);
xap = xapListOpen(gensatXml, "GensatImageSet", gsStartHandler, gsEndHandler);
while ((image = xapListNext(xap, "GensatImage")) != NULL)
{
int id = image->gsGensatImageId->text;
char *imageFile = image->gsGensatImageImageInfo->gsGensatImageImageInfoFullImg
->gsGensatImageInfo->gsGensatImageInfoFilename->text;
/* Mangle file name a little */
subChar(imageFile, '(', '_');
stripChar(imageFile, ')');
/* Figure out name of jpeg file in outDir. */
verbose(1, "image %d, id %d\n", ++imageIx, id);
safef(finalJpg, sizeof(finalJpg), "%s/%s", outDir, imageFile);
stripString(finalJpg, ".full"); /* Image magick can't handle two suffixes */
chopSuffix(finalJpg);
strcat(finalJpg, ".jpg");
/* Create directory that it goes in if necessary */
splitPath(finalJpg, finalDir, NULL, NULL);
if (!hashLookup(dirHash, finalDir))
{
hashAdd(dirHash, finalDir, NULL);
dyStringClear(mkdir);
dyStringPrintf(mkdir, "mkdir -p %s", finalDir);
if (system(mkdir->string) != 0)
errAbort("Couldn't %s", mkdir->string);
}
/* Download it - either directly via ftp, or indirectly via cgi. */
if (fileExists(finalJpg))
{
verbose(1, "already have %s\n", imageFile);
fprintf(fLog, "%s already downloaded\n", finalJpg);
}
else
{
if (endsWith(imageFile, ".jpg"))
{
safef(wgetSource, sizeof(wgetSource), "%s/%s", ftpUri, imageFile);
if (safeGetOne(wgetSource, finalJpg))
fprintf(fLog, "Got via ftp %s\n", finalJpg);
}
else
{
safef(wgetSource, sizeof(wgetSource), "%s%d", jpgCgiUri, id);
if (safeGetOne(wgetSource, finalJpg))
fprintf(fLog, "Got via cgi %s\n", finalJpg);
}
}
}
carefulClose(&fLog);
}
void doSearchTracks(struct group *groupList)
{
if (!advancedJavascriptFeaturesEnabled(cart))
{
warn("Requires advanced javascript features.");
return;
}
struct group *group;
char *groups[128];
char *labels[128];
int numGroups = 1;
groups[0] = ANYLABEL;
labels[0] = ANYLABEL;
char *currentTab = cartUsualString(cart, TRACK_SEARCH_CURRENT_TAB, "simpleTab");
char *nameSearch = cartOptionalString(cart, TRACK_SEARCH_ON_NAME);
#ifdef TRACK_SEARCH_ON_TYPE
char *typeSearch = cartOptionalString(cart, TRACK_SEARCH_ON_TYPE);
#else///ifndef TRACK_SEARCH_ON_TYPE
char *typeSearch = NULL;
#endif///def TRACK_SEARCH_ON_TYPE
char *descSearch;
char *groupSearch = cartOptionalString(cart, TRACK_SEARCH_ON_GROUP);
boolean doSearch = sameString(cartOptionalString(cart, TRACK_SEARCH), "Search") || cartUsualInt(cart, TRACK_SEARCH_PAGER, -1) >= 0;
struct sqlConnection *conn = hAllocConn(database);
boolean metaDbExists = sqlTableExists(conn, "metaDb");
int numMetadataSelects, tracksFound = 0;
int numMetadataNonEmpty = 0;
char **mdbVar = NULL;
char **mdbVal = NULL;
#ifdef ONE_FUNC
struct hash *parents = newHash(4);
#endif///def ONE_FUNC
boolean simpleSearch;
struct trix *trix;
char trixFile[HDB_MAX_PATH_STRING];
char **descWords = NULL;
int descWordCount = 0;
boolean searchTermsExist = FALSE;
int cols;
char buf[512];
if(sameString(currentTab, "simpleTab"))
{
descSearch = cartOptionalString(cart, TRACK_SEARCH_SIMPLE);
simpleSearch = TRUE;
freez(&nameSearch);
#ifdef TRACK_SEARCH_ON_TYPE
freez(&typeSearch);
#endif///def TRACK_SEARCH_ON_TYPE
freez(&groupSearch);
}
else
{
descSearch = cartOptionalString(cart, TRACK_SEARCH_ON_DESCR);
simpleSearch = FALSE;
}
if(descSearch)
stripChar(descSearch, '"');
trackList = getTrackList(&groupList, -2); // global
makeGlobalTrackHash(trackList);
// NOTE: This is necessary when container cfg by '*' results in vis changes
// This will handle composite/view override when subtrack specific vis exists, AND superTrack reshaping.
parentChildCartCleanup(trackList,cart,oldVars); // Subtrack settings must be removed when composite/view settings are updated
getSearchTrixFile(database, trixFile, sizeof(trixFile));
trix = trixOpen(trixFile);
slSort(&groupList, gCmpGroup);
for (group = groupList; group != NULL; group = group->next)
{
groupTrackListAddSuper(cart, group);
if (group->trackList != NULL)
{
groups[numGroups] = cloneString(group->name);
labels[numGroups] = cloneString(group->label);
numGroups++;
if (numGroups >= ArraySize(groups))
internalErr();
}
}
safef(buf, sizeof(buf),"Search for Tracks in the %s %s Assembly", organism, hFreezeFromDb(database));
webStartWrapperDetailedNoArgs(cart, database, "", buf, FALSE, FALSE, FALSE, FALSE);
hPrintf("<div style='max-width:1080px;'>");
hPrintf("<form action='%s' name='%s' id='%s' method='get'>\n\n", hgTracksName(),TRACK_SEARCH_FORM,TRACK_SEARCH_FORM);
cartSaveSession(cart); // Creates hidden var of hgsid to avoid bad voodoo
safef(buf, sizeof(buf), "%lu", clock1());
cgiMakeHiddenVar("hgt_", buf); // timestamps page to avoid browser cache
hPrintf("<input type='hidden' name='db' value='%s'>\n", database);
hPrintf("<input type='hidden' name='%s' id='currentTab' value='%s'>\n", TRACK_SEARCH_CURRENT_TAB, currentTab);
hPrintf("<input type='hidden' name='%s' value=''>\n",TRACK_SEARCH_DEL_ROW);
hPrintf("<input type='hidden' name='%s' value=''>\n",TRACK_SEARCH_ADD_ROW);
hPrintf("<input type='hidden' name='%s' value=''>\n",TRACK_SEARCH_PAGER);
hPrintf("<div id='tabs' style='display:none; %s'>\n"
"<ul>\n"
"<li><a href='#simpleTab'><B style='font-size:.9em;font-family: arial, Geneva, Helvetica, san-serif;'>Search</B></a></li>\n"
"<li><a href='#advancedTab'><B style='font-size:.9em;font-family: arial, Geneva, Helvetica, san-serif;'>Advanced</B></a></li>\n"
"</ul>\n"
"<div id='simpleTab' style='max-width:inherit;'>\n",cgiBrowser()==btIE?"width:1060px;":"max-width:inherit;");
hPrintf("<table style='width:100%%; font-size:.9em;'><tr><td colspan='2'>");
hPrintf("<input type='text' name='%s' id='simpleSearch' class='submitOnEnter' value='%s' style='max-width:1000px; width:100%%;' onkeyup='findTracksSearchButtonsEnable(true);'>\n",
TRACK_SEARCH_SIMPLE,descSearch == NULL ? "" : descSearch);
if (simpleSearch && descSearch)
searchTermsExist = TRUE;
hPrintf("</td></tr><td style='max-height:4px;'></td></tr></table>");
//hPrintf("</td></tr></table>");
hPrintf("<input type='submit' name='%s' id='searchSubmit' value='search' style='font-size:.8em;'>\n", TRACK_SEARCH);
hPrintf("<input type='button' name='clear' value='clear' class='clear' style='font-size:.8em;' onclick='findTracksClear();'>\n");
hPrintf("<input type='submit' name='submit' value='cancel' class='cancel' style='font-size:.8em;'>\n");
hPrintf("</div>\n");
// Advanced tab
hPrintf("<div id='advancedTab' style='width:inherit;'>\n"
"<table cellSpacing=0 style='width:inherit; font-size:.9em;'>\n");
cols = 8;
// Track Name contains
hPrintf("<tr><td colspan=3></td>");
hPrintf("<td nowrap><b style='max-width:100px;'>Track Name:</b></td>");
hPrintf("<td align='right'>contains</td>\n");
hPrintf("<td colspan='%d'>", cols - 4);
hPrintf("<input type='text' name='%s' id='nameSearch' class='submitOnEnter' value='%s' onkeyup='findTracksSearchButtonsEnable(true);' style='min-width:326px; font-size:.9em;'>",
TRACK_SEARCH_ON_NAME, nameSearch == NULL ? "" : nameSearch);
hPrintf("</td></tr>\n");
// Description contains
hPrintf("<tr><td colspan=2></td><td align='right'>and </td>");
hPrintf("<td><b style='max-width:100px;'>Description:</b></td>");
hPrintf("<td align='right'>contains</td>\n");
hPrintf("<td colspan='%d'>", cols - 4);
hPrintf("<input type='text' name='%s' id='descSearch' value='%s' class='submitOnEnter' onkeyup='findTracksSearchButtonsEnable(true);' style='max-width:536px; width:536px; font-size:.9em;'>",
TRACK_SEARCH_ON_DESCR, descSearch == NULL ? "" : descSearch);
hPrintf("</td></tr>\n");
if (!simpleSearch && descSearch)
searchTermsExist = TRUE;
hPrintf("<tr><td colspan=2></td><td align='right'>and </td>\n");
hPrintf("<td><b style='max-width:100px;'>Group:</b></td>");
hPrintf("<td align='right'>is</td>\n");
hPrintf("<td colspan='%d'>", cols - 4);
cgiMakeDropListFull(TRACK_SEARCH_ON_GROUP, labels, groups, numGroups, groupSearch, "class='groupSearch' style='min-width:40%; font-size:.9em;'");
hPrintf("</td></tr>\n");
if (!simpleSearch && groupSearch)
searchTermsExist = TRUE;
#ifdef TRACK_SEARCH_ON_TYPE
// Track Type is (drop down)
hPrintf("<tr><td colspan=2></td><td align='right'>and </td>\n");
hPrintf("<td nowrap><b style='max-width:100px;'>Data Format:</b></td>");
hPrintf("<td align='right'>is</td>\n");
hPrintf("<td colspan='%d'>", cols - 4);
char **formatTypes = NULL;
char **formatLabels = NULL;
int formatCount = getFormatTypes(&formatLabels, &formatTypes);
cgiMakeDropListFull(TRACK_SEARCH_ON_TYPE, formatLabels, formatTypes, formatCount, typeSearch, "class='typeSearch' style='min-width:40%; font-size:.9em;'");
hPrintf("</td></tr>\n");
if (!simpleSearch && typeSearch)
searchTermsExist = TRUE;
#endif///def TRACK_SEARCH_ON_TYPE
// Metadata selects require careful accounting
if(metaDbExists)
numMetadataSelects = printMdbSelects(conn, cart, simpleSearch, &mdbVar, &mdbVal, &numMetadataNonEmpty, cols);
else
numMetadataSelects = 0;
hPrintf("</table>\n");
hPrintf("<input type='submit' name='%s' id='searchSubmit' value='search' style='font-size:.8em;'>\n", TRACK_SEARCH);
hPrintf("<input type='button' name='clear' value='clear' class='clear' style='font-size:.8em;' onclick='findTracksClear();'>\n");
hPrintf("<input type='submit' name='submit' value='cancel' class='cancel' style='font-size:.8em;'>\n");
//hPrintf("<a target='_blank' href='../goldenPath/help/trackSearch.html'>help</a>\n");
hPrintf("</div>\n</div>\n");
hPrintf("</form>\n");
hPrintf("</div>"); // Restricts to max-width:1000px;
if(descSearch != NULL && !strlen(descSearch))
descSearch = NULL;
if(groupSearch != NULL && sameString(groupSearch, ANYLABEL))
groupSearch = NULL;
if(typeSearch != NULL && sameString(typeSearch, ANYLABEL))
typeSearch = NULL;
if(!isEmpty(descSearch))
{
char *tmp = cloneString(descSearch);
char *val = nextWord(&tmp);
struct slName *el, *descList = NULL;
int i;
while (val != NULL)
{
slNameAddTail(&descList, val);
descWordCount++;
val = nextWord(&tmp);
}
descWords = needMem(sizeof(char *) * descWordCount);
for(i = 0, el = descList; el != NULL; i++, el = el->next)
descWords[i] = strLower(el->name);
}
if (doSearch && simpleSearch && descWordCount <= 0)
doSearch = FALSE;
if(doSearch)
{
// Now search
struct slRef *tracks = NULL;
if(simpleSearch)
tracks = simpleSearchForTracksstruct(trix,descWords,descWordCount);
else
tracks = advancedSearchForTracks(conn,groupList,descWords,descWordCount,nameSearch,typeSearch,descSearch,groupSearch,numMetadataNonEmpty,numMetadataSelects,mdbVar,mdbVal);
// Sort and Print results
enum sortBy sortBy = cartUsualInt(cart,TRACK_SEARCH_SORT,sbRelevance);
tracksFound = slCount(tracks);
if(tracksFound > 1)
findTracksSort(&tracks,simpleSearch,sortBy);
displayFoundTracks(cart,tracks,tracksFound,sortBy);
}
hFreeConn(&conn);
webNewSection("About Track Search");
if(metaDbExists)
hPrintf("<p>Search for terms in track names, descriptions, groups, and ENCODE "
"metadata. If multiple terms are entered, only tracks with all terms "
"will be part of the results.");
else
hPrintf("<p>Search for terms in track descriptions, groups, and names. "
"If multiple terms are entered, only tracks with all terms "
"will be part of the results.");
hPrintf("<BR><a target='_blank' href='../goldenPath/help/trackSearch.html'>more help</a></p>\n");
webEndSectionTables();
}
void txGeneXref(char *genomeDb, char *uniProtDb, char *genePredFile, char *infoFile, char *pickFile,
char *evFile, char *outFile)
/* txGeneXref - Make kgXref type table for genes.. */
{
/* Load picks into hash. We don't use cdsPicksLoadAll because empty fields
* cause that autoSql-generated routine problems. */
struct hash *pickHash = newHash(18);
struct hash *geneToProtHash = makeGeneToProtHash(genePredFile);
struct cdsPick *pick;
struct lineFile *lf = lineFileOpen(pickFile, TRUE);
char *row[CDSPICK_NUM_COLS];
while (lineFileRowTab(lf, row))
{
pick = cdsPickLoad(row);
removePickVersions(pick);
hashAdd(pickHash, pick->name, pick);
}
/* Load evidence into hash */
struct hash *evHash = newHash(18);
struct txRnaAccs *ev, *evList = txRnaAccsLoadAll(evFile);
for (ev = evList; ev != NULL; ev = ev->next)
hashAdd(evHash, ev->name, ev);
/* Open connections to our databases */
struct sqlConnection *gConn = sqlConnect(genomeDb);
struct sqlConnection *uConn = sqlConnect(uniProtDb);
/* Read in info file, and loop through it to make out file. */
struct txInfo *info, *infoList = txInfoLoadAll(infoFile);
FILE *f = mustOpen(outFile, "w");
for (info = infoList; info != NULL; info = info->next)
{
char *kgID = info->name;
char *mRNA = "";
char *spID = "";
char *spDisplayID = "";
char *geneSymbol = NULL;
char *refseq = "";
char *protAcc = "";
char *description = NULL;
char query[256];
char *proteinId = hashMustFindVal(geneToProtHash, info->name);
boolean isAb = sameString(info->category, "antibodyParts");
pick = hashFindVal(pickHash, info->name);
ev = hashFindVal(evHash, info->name);
if (pick != NULL)
{
/* Fill in the relatively straightforward fields. */
refseq = pick->refSeq;
if (info->orfSize > 0)
{
protAcc = pick->refProt;
spID = proteinId;
if (sameString(protAcc, spID))
spID = pick->uniProt;
if (spID[0] != 0)
spDisplayID = spAnyAccToId(uConn, spID);
}
/* Fill in gene symbol and description from refseq if possible. */
if (refseq[0] != 0)
{
struct sqlResult *sr;
safef(query, sizeof(query), "select name,product from refLink where mrnaAcc='%s'",
refseq);
sr = sqlGetResult(gConn, query);
char **row = sqlNextRow(sr);
if (row != NULL)
{
geneSymbol = cloneString(row[0]);
if (!sameWord("unknown protein", row[1]))
description = cloneString(row[1]);
}
sqlFreeResult(&sr);
}
/* If need be try uniProt for gene symbol and description. */
if (spID[0] != 0 && (geneSymbol == NULL || description == NULL))
{
char *acc = spLookupPrimaryAcc(uConn, spID);
if (description == NULL)
description = spDescription(uConn, acc);
if (geneSymbol == NULL)
{
struct slName *nameList = spGenes(uConn, acc);
if (nameList != NULL)
geneSymbol = cloneString(nameList->name);
slFreeList(&nameList);
}
}
}
/* If it's an antibody fragment use that as name. */
if (isAb)
{
geneSymbol = cloneString("abParts");
description = cloneString("Parts of antibodies, mostly variable regions.");
isAb = TRUE;
}
if (ev == NULL)
{
mRNA = cloneString("");
if (!isAb)
{
errAbort("%s is %s but not %s\n", info->name, infoFile, evFile);
}
}
else
{
mRNA = cloneString(ev->primary);
chopSuffix(mRNA);
}
/* Still no joy? Try genbank RNA records. */
if (geneSymbol == NULL || description == NULL)
{
if (ev != NULL)
{
int i;
for (i=0; i<ev->accCount; ++i)
{
char *acc = ev->accs[i];
chopSuffix(acc);
if (geneSymbol == NULL)
{
safef(query, sizeof(query),
"select geneName.name from gbCdnaInfo,geneName "
"where geneName.id=gbCdnaInfo.geneName and gbCdnaInfo.acc = '%s'", acc);
geneSymbol = sqlQuickString(gConn, query);
if (geneSymbol != NULL)
{
if (sameString(geneSymbol, "n/a"))
geneSymbol = NULL;
}
}
if (description == NULL)
{
safef(query, sizeof(query),
"select description.name from gbCdnaInfo,description "
"where description.id=gbCdnaInfo.description "
"and gbCdnaInfo.acc = '%s'", acc);
description = sqlQuickString(gConn, query);
if (description != NULL)
{
if (sameString(description, "n/a"))
description = NULL;
}
}
}
}
}
if (geneSymbol == NULL)
geneSymbol = mRNA;
if (description == NULL)
description = mRNA;
/* Get rid of some characters that will cause havoc downstream. */
stripChar(geneSymbol, '\'');
subChar(geneSymbol, '<', '[');
subChar(geneSymbol, '>', ']');
/* Abbreviate geneSymbol if too long */
if (strlen(geneSymbol) > 40)
strcpy(geneSymbol+37, "...");
fprintf(f, "%s\t", kgID);
fprintf(f, "%s\t", mRNA);
fprintf(f, "%s\t", spID);
fprintf(f, "%s\t", spDisplayID);
fprintf(f, "%s\t", geneSymbol);
fprintf(f, "%s\t", refseq);
fprintf(f, "%s\t", protAcc);
fprintf(f, "%s\n", description);
}
carefulClose(&f);
}
void doSearchTracks(struct group *groupList)
{
webIncludeResourceFile("ui.dropdownchecklist.css");
jsIncludeFile("ui.dropdownchecklist.js",NULL);
// This line is needed to get the multi-selects initialized
jsIncludeFile("ddcl.js",NULL);
struct group *group;
char *groups[128];
char *labels[128];
int numGroups = 1;
groups[0] = ANYLABEL;
labels[0] = ANYLABEL;
char *nameSearch = cartOptionalString(cart, TRACK_SEARCH_ON_NAME);
char *typeSearch = cartUsualString( cart, TRACK_SEARCH_ON_TYPE,ANYLABEL);
char *simpleEntry = cartOptionalString(cart, TRACK_SEARCH_SIMPLE);
char *descSearch = cartOptionalString(cart, TRACK_SEARCH_ON_DESCR);
char *groupSearch = cartUsualString( cart, TRACK_SEARCH_ON_GROUP,ANYLABEL);
boolean doSearch = sameString(cartOptionalString(cart, TRACK_SEARCH), "Search")
|| cartUsualInt(cart, TRACK_SEARCH_PAGER, -1) >= 0;
struct sqlConnection *conn = hAllocConn(database);
boolean metaDbExists = sqlTableExists(conn, "metaDb");
int tracksFound = 0;
boolean searchTermsExist = FALSE;
int cols;
char buf[512];
char *currentTab = cartUsualString(cart, TRACK_SEARCH_CURRENT_TAB, "simpleTab");
enum searchTab selectedTab = (sameString(currentTab, "advancedTab") ? advancedTab : simpleTab);
// NOTE: could support quotes in simple tab by detecting quotes and choosing
// to use doesNameMatch() || doesDescriptionMatch()
if (selectedTab == simpleTab && !isEmpty(simpleEntry))
stripChar(simpleEntry, '"');
trackList = getTrackList(&groupList, -2); // global
makeGlobalTrackHash(trackList);
// NOTE: This is necessary when container cfg by '*' results in vis changes
// This will handle composite/view override when subtrack specific vis exists,
// AND superTrack reshaping.
// Subtrack settings must be removed when composite/view settings are updated
parentChildCartCleanup(trackList,cart,oldVars);
slSort(&groupList, gCmpGroup);
for (group = groupList; group != NULL; group = group->next)
{
groupTrackListAddSuper(cart, group);
if (group->trackList != NULL)
{
groups[numGroups] = cloneString(group->name);
labels[numGroups] = cloneString(group->label);
numGroups++;
if (numGroups >= ArraySize(groups))
internalErr();
}
}
safef(buf, sizeof(buf),"Search for Tracks in the %s %s Assembly",
organism, hFreezeFromDb(database));
webStartWrapperDetailedNoArgs(cart, database, "", buf, FALSE, FALSE, FALSE, FALSE);
hPrintf("<div style='max-width:1080px;'>");
hPrintf("<form action='%s' name='%s' id='%s' method='get'>\n\n",
hgTracksName(),TRACK_SEARCH_FORM,TRACK_SEARCH_FORM);
cartSaveSession(cart); // Creates hidden var of hgsid to avoid bad voodoo
safef(buf, sizeof(buf), "%lu", clock1());
cgiMakeHiddenVar("hgt_", buf); // timestamps page to avoid browser cache
hPrintf("<input type='hidden' name='db' value='%s'>\n", database);
hPrintf("<input type='hidden' name='%s' id='currentTab' value='%s'>\n",
TRACK_SEARCH_CURRENT_TAB, currentTab);
hPrintf("<input type='hidden' name='%s' value=''>\n",TRACK_SEARCH_DEL_ROW);
hPrintf("<input type='hidden' name='%s' value=''>\n",TRACK_SEARCH_ADD_ROW);
hPrintf("<input type='hidden' name='%s' value=''>\n",TRACK_SEARCH_PAGER);
hPrintf("<div id='tabs' style='display:none; %s'>\n<ul>\n<li><a href='#simpleTab'>"
"<B style='font-size:.9em;font-family: arial, Geneva, Helvetica, san-serif;'>Search</B>"
"</a></li>\n<li><a href='#advancedTab'>"
"<B style='font-size:.9em;font-family: arial, Geneva, Helvetica, san-serif;'>Advanced</B>"
"</a></li>\n</ul>\n<div id='simpleTab' style='max-width:inherit;'>\n",
cgiBrowser()==btIE?"width:1060px;":"max-width:inherit;");
hPrintf("<table id='simpleTable' style='width:100%%; font-size:.9em;'><tr><td colspan='2'>");
hPrintf("<input type='text' name='%s' id='simpleSearch' class='submitOnEnter' value='%s' "
"style='max-width:1000px; width:100%%;' onkeyup='findTracks.searchButtonsEnable(true);'>\n",
TRACK_SEARCH_SIMPLE,simpleEntry == NULL ? "" : simpleEntry);
if (selectedTab==simpleTab && simpleEntry)
searchTermsExist = TRUE;
hPrintf("</td></tr><td style='max-height:4px;'></td></tr></table>");
//hPrintf("</td></tr></table>");
hPrintf("<input type='submit' name='%s' id='searchSubmit' value='search' "
"style='font-size:.8em;'>\n", TRACK_SEARCH);
hPrintf("<input type='button' name='clear' value='clear' class='clear' "
"style='font-size:.8em;' onclick='findTracks.clear();'>\n");
hPrintf("<input type='submit' name='submit' value='cancel' class='cancel' "
"style='font-size:.8em;'>\n");
hPrintf("</div>\n");
// Advanced tab
hPrintf("<div id='advancedTab' style='width:inherit;'>\n"
"<table id='advancedTable' cellSpacing=0 style='width:inherit; font-size:.9em;'>\n");
cols = 8;
// Track Name contains
hPrintf("<tr><td colspan=3></td>");
hPrintf("<td nowrap><b style='max-width:100px;'>Track Name:</b></td>");
hPrintf("<td align='right'>contains</td>\n");
hPrintf("<td colspan='%d'>", cols - 4);
hPrintf("<input type='text' name='%s' id='nameSearch' class='submitOnEnter' value='%s' "
"onkeyup='findTracks.searchButtonsEnable(true);' style='min-width:326px; font-size:.9em;'>",
TRACK_SEARCH_ON_NAME, nameSearch == NULL ? "" : nameSearch);
hPrintf("</td></tr>\n");
// Description contains
hPrintf("<tr><td colspan=2></td><td align='right'>and </td>");
hPrintf("<td><b style='max-width:100px;'>Description:</b></td>");
hPrintf("<td align='right'>contains</td>\n");
hPrintf("<td colspan='%d'>", cols - 4);
hPrintf("<input type='text' name='%s' id='descSearch' value='%s' class='submitOnEnter' "
"onkeyup='findTracks.searchButtonsEnable(true);' "
"style='max-width:536px; width:536px; font-size:.9em;'>",
TRACK_SEARCH_ON_DESCR, descSearch == NULL ? "" : descSearch);
hPrintf("</td></tr>\n");
if (selectedTab==advancedTab && !isEmpty(descSearch))
searchTermsExist = TRUE;
hPrintf("<tr><td colspan=2></td><td align='right'>and </td>\n");
hPrintf("<td><b style='max-width:100px;'>Group:</b></td>");
hPrintf("<td align='right'>is</td>\n");
hPrintf("<td colspan='%d'>", cols - 4);
cgiMakeDropListFull(TRACK_SEARCH_ON_GROUP, labels, groups, numGroups, groupSearch,
"class='groupSearch' style='min-width:40%; font-size:.9em;'");
hPrintf("</td></tr>\n");
if (selectedTab==advancedTab && !isEmpty(groupSearch) && !sameString(groupSearch,ANYLABEL))
searchTermsExist = TRUE;
// Track Type is (drop down)
hPrintf("<tr><td colspan=2></td><td align='right'>and </td>\n");
hPrintf("<td nowrap><b style='max-width:100px;'>Data Format:</b></td>");
hPrintf("<td align='right'>is</td>\n");
hPrintf("<td colspan='%d'>", cols - 4);
char **formatTypes = NULL;
char **formatLabels = NULL;
int formatCount = getFormatTypes(&formatLabels, &formatTypes);
cgiMakeDropListFull(TRACK_SEARCH_ON_TYPE, formatLabels, formatTypes, formatCount, typeSearch,
"class='typeSearch' style='min-width:40%; font-size:.9em;'");
hPrintf("</td></tr>\n");
if (selectedTab==advancedTab && !isEmpty(typeSearch) && !sameString(typeSearch,ANYLABEL))
searchTermsExist = TRUE;
// mdb selects
struct slPair *mdbSelects = NULL;
if (metaDbExists)
{
struct slPair *mdbVars = mdbVarsSearchable(conn,TRUE,FALSE); // Tables but not file only objects
mdbSelects = mdbSelectPairs(cart, mdbVars);
char *output = mdbSelectsHtmlRows(conn,mdbSelects,mdbVars,cols,FALSE); // not a fileSearch
if (output)
{
puts(output);
freeMem(output);
}
slPairFreeList(&mdbVars);
}
hPrintf("</table>\n");
hPrintf("<input type='submit' name='%s' id='searchSubmit' value='search' "
"style='font-size:.8em;'>\n", TRACK_SEARCH);
hPrintf("<input type='button' name='clear' value='clear' class='clear' "
"style='font-size:.8em;' onclick='findTracks.clear();'>\n");
hPrintf("<input type='submit' name='submit' value='cancel' class='cancel' "
"style='font-size:.8em;'>\n");
//hPrintf("<a target='_blank' href='../goldenPath/help/trackSearch.html'>help</a>\n");
hPrintf("</div>\n");
hPrintf("</div>\n");
hPrintf("</form>\n");
hPrintf("</div>"); // Restricts to max-width:1000px;
cgiDown(0.8);
if (measureTiming)
measureTime("Rendered tabs");
if (doSearch)
{
// Now search
struct slRef *tracks = NULL;
if (selectedTab==simpleTab && !isEmpty(simpleEntry))
tracks = simpleSearchForTracksstruct(simpleEntry);
else if (selectedTab==advancedTab)
tracks = advancedSearchForTracks(conn,groupList,nameSearch,typeSearch,descSearch,
groupSearch,mdbSelects);
if (measureTiming)
measureTime("Searched for tracks");
// Sort and Print results
if (selectedTab!=filesTab)
{
enum sortBy sortBy = cartUsualInt(cart,TRACK_SEARCH_SORT,sbRelevance);
tracksFound = slCount(tracks);
if (tracksFound > 1)
findTracksSort(&tracks,sortBy);
displayFoundTracks(cart,tracks,tracksFound,sortBy);
if (measureTiming)
measureTime("Displayed found tracks");
}
slPairFreeList(&mdbSelects);
}
hFreeConn(&conn);
webNewSection("About Track Search");
if (metaDbExists)
hPrintf("<p>Search for terms in track names, descriptions, groups, and ENCODE "
"metadata. If multiple terms are entered, only tracks with all terms "
"will be part of the results.");
else
hPrintf("<p>Search for terms in track descriptions, groups, and names. "
"If multiple terms are entered, only tracks with all terms "
"will be part of the results.");
hPrintf("<BR><a target='_blank' href='../goldenPath/help/trackSearch.html'>more help</a></p>\n");
webEndSectionTables();
}
