static char *settingsLabel(struct userSettings *us, char *varName)
/* Given varName return corresponding label. */
{
char *spacedString = cloneString(varName + strlen(us->savePrefix));
subChar(spacedString, '_', ' ');
return spacedString;
}
void uToT(struct dnaSeq *seqList)
/* Convert any u's in sequence to t's. */
{
struct dnaSeq *seq;
for (seq = seqList; seq != NULL; seq = seq->next)
subChar(seq->dna, 'u', 't');
}
struct hash *readDescriptionFile(char *fileName)
/* Return two column file keyed by first column with
* values in second column. Strip any tabs from values. */
{
struct lineFile *lf = lineFileOpen(fileName, TRUE);
char *line;
struct hash *hash = newHash(16);
while (lineFileNextReal(lf, &line))
{
char *key = nextWord(&line);
char *val = skipLeadingSpaces(line);
if (val != NULL && val[0] != 0)
{
char *desc = hashFindVal(hash, key);
subChar(val, '\t', ' ');
stripChar(val, '\r');
/* if gene exists in hash */
if (desc != NULL)
{
struct dyString *dy = dyStringNew(1024);
dyStringPrintf(dy, "%s ", desc);
dyStringAppend(dy, val);
val = cloneString(dy->string);
dyStringFree(&dy);
}
/* add to gene and description to hash */
hashAdd(hash, key, cloneString(val));
}
}
lineFileClose(&lf);
return hash;
}
void gsToUcsc(char *gsName, char *ucscName)
/* Convert from
* AC020585.5~1.2 Fragment 2 of 29 (AC020585.5:1..1195)
* to
* AC020585.5_1_2
*/
{
char *s, *e, *d;
int size;
/* Copy in accession and version. */
d = ucscName;
s = gsName;
e = strchr(s, '~');
if (e == NULL)
errAbort("Expecting . in %s", gsName);
size = e - s;
memcpy(d, s, size);
d += size;
/* Skip over tilde and replace it with _ */
s = e+1;
*d++ = '_';
e = skipToSpaces(s);
if (e == NULL)
e = s + strlen(s);
size = e - s;
memcpy(d, s, size);
d[size] = 0;
subChar(d, '.', '_');
return;
}
static void printTabularHeaderRow(const struct vcfInfoDef *def)
/* Parse the column header parts out of def->description and print as table header row;
* call this only when looksTabular returns TRUE. */
{
regmatch_t substrArr[PATH_LEN];
if (regexMatchSubstr(def->description, COL_DESC_REGEX, substrArr, ArraySize(substrArr)))
{
puts("<TR>");
// Make a copy of the part of def->description that matches the regex,
// then chop by '|' and print out header column tags:
int matchSize = substrArr[0].rm_eo - substrArr[0].rm_so;
char copy[matchSize+1];
safencpy(copy, sizeof(copy), def->description + substrArr[0].rm_so, matchSize);
// Turn '_' into ' ' so description words can wrap inside headers, saving some space
subChar(copy, '_', ' ');
char *words[PATH_LEN];
int descColCount = chopByChar(copy, '|', words, ArraySize(words));
int i;
for (i = 0; i < descColCount; i++)
printf("<TH class='withThinBorder'>%s</TH>", words[i]);
puts("</TR>");
}
else
errAbort("printTabularHeaderRow: code bug, if looksTabular returns true then "
"regex should work here");
}
void setupTable(struct sqlConnection *conn)
/* Set up the autoTest table for testing. Call dropTable() later
to remove table. */
{
struct lineFile *lf = lineFileOpen("output/newTest.sql", TRUE);
char *update = NULL;
char *line = NULL;
struct dyString *ds = newDyString(256);
if(sqlTableExists(conn, testTableName))
errAbort("dbLinkTest.c::setupTable() - Table %s.%s already exists. Can't create another.",
sqlGetDatabase(conn), testTableName);
while(lineFileNextReal(lf, &line))
{
char *tmp = strstr(line, "not null");
if(tmp != NULL)
{
*tmp = ',';
tmp++;
*tmp = '\0';
}
subChar(line, '\t', ' ');
dyStringPrintf(ds, "%s", line);
}
update = replaceChars(ds->string, "PRIMARY KEY", "UNIQUE");
sqlUpdate(conn, update);
freez(&update);
dyStringFree(&ds);
lineFileClose(&lf);
}
char *semiUniqName(char *base)
/* Figure out a name likely to be unique.
* Name will have no periods. Returns a static
* buffer, so best to clone result unless using
* immediately. */
{
int pid = getpid();
int num = time(NULL)&0xFFFFF;
char host[512];
strcpy(host, getHost());
char *s = strchr(host, '.');
if (s != NULL)
*s = 0;
subChar(host, '-', '_');
subChar(host, ':', '_');
static char name[PATH_LEN];
safef(name, sizeof(name), "%s_%s_%x_%x",
base, host, pid, num);
return name;
}
char *escapeAltFixTerm(char *term)
/* Special tweaks for SQL search of alt/fix terms that may include '.' and '_' characters. */
{
// If there is a ".", make it into a single-character wildcard so that "GL383518.1"
// can match "chr1_GL383518v1_alt".
char termCpy[strlen(term)+1];
safecpy(termCpy, sizeof termCpy, term);
subChar(termCpy, '.', '?');
// Escape '_' because that is an important character in alt/fix sequence names, and support
// wildcards:
return sqlLikeFromWild(termCpy);
}
int umatch(String ing, String desired){
int j;
if(abs(getSyllables(ing) - getSyllables(desired))<1){
int i;
while(i<ing.length()){
j += subChar(ing[i],desired[i]);
i++;
}
}
else{
j = 257;
}
return j;
}
struct frag *newFrag(char *fullFinfName, struct lineFile *lf)
/* Return a frag based on full name in Finf file. */
{
char *s;
struct frag *frag;
AllocVar(frag);
s = strchr(fullFinfName, '~');
if (s == NULL || strlen(s) > sizeof(frag->name) || !isdigit(s[1]))
errAbort("Badly formated name %s line %d of %s", fullFinfName, lf->lineIx, lf->fileName);
strcpy(frag->name, s+1);
subChar(frag->name, '.', '_');
return frag;
}
void getText(struct kgXref *kg, struct hash *refSeqHash,
struct sqlConnection *conn,
struct sqlConnection *spConn, struct sqlConnection *goConn,
FILE *f)
/* Get loads of text and write it out. */
{
char query[512];
struct hash *uniqHash = hashNew(0);
char *spAcc = spFindAcc(spConn, kg->spID);
subChar(kg->description, '\n', ' ');
fprintf(f, "%s\t%s\t%s\t%s", kg->kgID,
kg->geneSymbol, kg->kgID, kg->description);
hashAdd(uniqHash, kg->geneSymbol, NULL);
hashAdd(uniqHash, kg->kgID, NULL);
addSimple(kg->kgID, "kgAlias", "kgID", "alias", conn, uniqHash, f);
addSimple(kg->kgID, "kgProtAlias", "kgID", "alias", conn, uniqHash, f);
if (refSeqHash != NULL)
{
char *s = hashFindVal(refSeqHash, kg->refseq);
if (s == NULL && strchr(kg->refseq, '.') != NULL)
{
char *accOnly = cloneString(kg->refseq);
chopSuffix(accOnly);
s = hashFindVal(refSeqHash, accOnly);
freeMem(accOnly);
}
if (s == NULL)
s = "";
fprintf(f, "\t%s", s);
}
sqlSafef(query, sizeof(query),
"select commentVal.val from comment,commentVal "
"where comment.acc='%s' and comment.commentVal=commentVal.id"
, spAcc);
addText(query, spConn, f);
sqlSafef(query, sizeof(query),
"select term.name from goaPart,term "
"where goaPart.dbObjectId='%s' "
"and goaPart.goId=term.acc"
, spAcc);
addText(query, goConn, f);
fprintf(f, "\n");
hashFree(&uniqHash);
freeMem(spAcc);
}
char *encodeRnaName(struct track *tg, void *item)
/* Return RNA gene name. */
{
struct encodeRna *el = item;
char *full = el->name;
static char abbrev[SMALLBUF];
char *e;
strcpy(abbrev, skipChr(full));
subChar(abbrev, '_', ' ');
abbr(abbrev, " pseudogene");
if ((e = strstr(abbrev, "-related")) != NULL)
strcpy(e, "-like");
return abbrev;
}
void addText(char *query, struct sqlConnection *conn, FILE *f)
/* Add results of query to line. Convert newlines to spaces. */
{
char **row;
struct sqlResult *sr;
fprintf(f, "\t");
sr = sqlGetResult(conn, query);
while ((row = sqlNextRow(sr)) != NULL)
{
char *val = row[0];
subChar(val, '\n', ' ');
fprintf(f, "%s ", val);
}
sqlFreeResult(&sr);
}
struct hash *getRefSeqSummary(struct sqlConnection *conn)
/* Return hash keyed by refSeq NM_ id, with description values. */
{
struct hash *hash = hashNew(16);
char query[256];
sqlSafef(query, sizeof(query), "select mrnaAcc,summary from %s", summaryTable);
struct sqlResult *sr = sqlGetResult(conn, query);
char **row;
while ((row = sqlNextRow(sr)) != NULL)
{
subChar(row[1], '\n', ' ');
hashAdd(hash, row[0], cloneString(row[1]));
}
sqlFreeResult(&sr);
verbose(1, "%d %s elements\n", hash->elCount, summaryTable);
return hash;
}
struct hash *loadModuleToMotif(struct sqlConnection *conn, char *fileName,
char *table)
/* Load up file which has a line per module. The first word is the module
* number, the rest of the tab-separated fields are motif names.
* Return hash keyed by module&motif. */
{
struct lineFile *lf = lineFileOpen(fileName, TRUE);
char *line, *module, *motif;
FILE *f = hgCreateTabFile(tmpDir, table);
struct dyString *dy = dyStringNew(512);
int motifCount = 0, moduleCount = 0;
struct hash *hash = newHash(18);
while (lineFileNextReal(lf, &line))
{
++moduleCount;
subChar(line, ' ', '_');
module = nextWord(&line);
while ((motif = nextWord(&line)) != NULL)
{
++motifCount;
fprintf(f, "%s\t%s\n", module, motif);
hashAdd2(hash, module, motif, NULL);
}
}
dyStringPrintf(dy,
"CREATE TABLE %s (\n"
" module int not null,\n"
" motif varchar(255) not null,\n"
" #Indices\n"
" INDEX(module),\n"
" INDEX(motif(16))\n"
")\n", table);
sqlRemakeTable(conn, table, dy->string);
verbose(1, "%d modules, %d motifs in modules\n",
moduleCount, motifCount);
hgLoadTabFile(conn, tmpDir, table, &f);
hgRemoveTabFile(tmpDir, table);
verbose(1, "Loaded %s table\n", table);
lineFileClose(&lf);
return hash;
}
char *findVal(struct lineFile *lf, char *group, char *key)
/* Return value that matches key in group or NULL. */
{
char *s, *var, *val;
static char buf[512];
if (strlen(group) >= sizeof(buf))
errAbort("Line too long line %d of %s", lf->lineIx, lf->fileName);
strcpy(buf, group);
s = buf;
for (;;)
{
var = nextWord(&s);
if (var == NULL)
return "";
s = skipLeadingSpaces(s);
if (s == NULL || s[0] == 0)
errAbort("Unmatched key/val pair in group line %d of %s", lf->lineIx, lf->fileName);
val = s;
if (s[0] == '\'' || s[0] == '"')
{
if (!parseQuotedString(val, val, &s))
errAbort("Unmatched quote line %d of %s", lf->lineIx, lf->fileName);
}
else
{
int end;
val = nextWord(&s);
end = strlen(val) - 1;
if (val[end] == ';')
val[end] = 0;
}
s = skipLeadingSpaces(s);
if (s != NULL && s[0] == ';')
s += 1;
if (sameString(key, var))
{
subChar(val, '\t', ' ');
return val;
}
}
}
static struct qaStatus *qaStatusOnPage(struct errCatch *errCatch,
struct htmlPage *page, long startTime, struct htmlPage **retPage)
/* Assuming you have fetched page with the given error catcher,
* starting the fetch at the given startTime, then create a
* qaStatus that describes how the fetch went. If *retPage is non-null
* then return the page there, otherwise free it. */
{
char *errMessage = NULL;
struct qaStatus *qs;
AllocVar(qs);
if (errCatch->gotError || page == NULL)
{
errMessage = errCatch->message->string;
qs->hardError = TRUE;
}
else
{
if (page->status->status != 200)
{
dyStringPrintf(errCatch->message, "HTTP status code %d\n",
page->status->status);
errMessage = errCatch->message->string;
qs->hardError = TRUE;
htmlPageFree(&page);
}
else
{
errMessage = qaScanForErrorMessage(page->fullText);
}
}
qs->errMessage = cloneString(errMessage);
if (qs->errMessage != NULL)
subChar(qs->errMessage, '\n', ' ');
qs->milliTime = clock1000() - startTime;
if (retPage != NULL)
*retPage = page;
else
htmlPageFree(&page);
return qs;
}
int lineToExp(char *line, char *fileName)
/* Convert line to an expression record file.
* Return number of expression records. */
{
FILE *f = mustOpen(fileName, "w");
struct hash *hash = newHash(10); /* Integer valued hash */
char *word;
int wordCount = 0;
struct expCounter *ec;
char *spaced;
char name[128];
while ((word = nextTabWord(&line)) != NULL)
{
if ((ec = hashFindVal(hash, word)) == NULL)
{
AllocVar(ec);
hashAddSaveName(hash, word, ec, &ec->name);
}
spaced = cloneString(word);
subChar(spaced, '_', ' ');
ec->count += 1;
if (ec->count > 1)
safef(name, sizeof(name), "%s %d", spaced, ec->count);
else
safef(name, sizeof(name), "%s", spaced);
fprintf(f, "%d\t", wordCount);
fprintf(f, "%s\t", name);
fprintf(f, "%s\t", name);
fprintf(f, "%s\t", "http://www.affymetrix.com/analysis/index.affx");
fprintf(f, "%s\t", "http://expression.gnf.org");
fprintf(f, "%s\t", "http://www.gnf.org");
fprintf(f, "3\t");
fprintf(f, "%s,%s,%s,\n", chip, "n/a", spaced);
++wordCount;
}
carefulClose(&f);
return wordCount;
}
int lineToExp(char *line, FILE *f)
/* Convert line to an expression record file.
* Return number of expression records. */
{
struct hash *hash = newHash(10); /* Integer valued hash */
char *word;
int wordCount = 0;
struct expCounter *ec;
char *spaced;
char name[128];
while ((word = nextTabWord(&line)) != NULL)
{
if ((ec = hashFindVal(hash, word)) == NULL)
{
AllocVar(ec);
hashAddSaveName(hash, word, ec, &ec->name);
}
spaced = cloneString(word);
subChar(spaced, '_', ' ');
ec->count += 1;
if (ec->count > 1)
safef(name, sizeof(name), "%s %d", spaced, ec->count);
else
safef(name, sizeof(name), "%s", spaced);
fprintf(f, "%d\t", wordCount);
fprintf(f, "%s\t", name);
fprintf(f, "%s\t", name);
fprintf(f, "%s\t", expUrl);
fprintf(f, "%s\t", expRef);
fprintf(f, "%s\t", expCredit);
fprintf(f, "3\t");
fprintf(f, "%s,%s,%s,\n", chip, "n/a", spaced);
++wordCount;
}
return wordCount;
}
boolean doGetBedOrCt(struct sqlConnection *conn, boolean doCt,
boolean doCtFile, boolean redirectToGb)
/* Actually output bed or custom track. Return TRUE unless no results. */
{
char *db = cloneString(database);
char *table = curTable;
struct hTableInfo *hti = getHti(db, table, conn);
struct featureBits *fbList = NULL, *fbPtr;
struct customTrack *ctNew = NULL;
boolean doCtHdr = (cartUsualBoolean(cart, hgtaPrintCustomTrackHeaders, FALSE)
|| doCt || doCtFile);
char *ctWigOutType = cartCgiUsualString(cart, hgtaCtWigOutType, outWigData);
char *fbQual = fbOptionsToQualifier();
char fbTQ[128];
int fields = hTableInfoBedFieldCount(hti);
boolean gotResults = FALSE;
struct region *region, *regionList = getRegions();
boolean isBedGr = isBedGraph(curTable);
boolean isBgWg = isBigWigTable(curTable);
boolean needSubtrackMerge = anySubtrackMerge(database, curTable);
boolean doDataPoints = FALSE;
boolean isWig = isWiggle(database, table);
struct wigAsciiData *wigDataList = NULL;
struct dataVector *dataVectorList = NULL;
boolean doRgb = bedItemRgb(hTrackDbForTrack(db, curTable));
if (!cartUsualBoolean(cart, hgtaDoGreatOutput, FALSE) && !doCt)
{
textOpen();
}
if (cartUsualBoolean(cart, hgtaDoGreatOutput, FALSE))
fputs("#", stdout);
if ((isWig || isBedGr || isBgWg) && sameString(outWigData, ctWigOutType))
doDataPoints = TRUE;
for (region = regionList; region != NULL; region = region->next)
{
struct bed *bedList = NULL, *bed;
struct lm *lm = lmInit(64*1024);
struct dataVector *dv = NULL;
if (isWig && doDataPoints)
{
if (needSubtrackMerge)
{
dv = wiggleDataVector(curTrack, curTable, conn, region);
if (dv != NULL)
slAddHead(&dataVectorList, dv);
}
else
{
int count = 0;
struct wigAsciiData *wigData = NULL;
struct wigAsciiData *asciiData;
struct wigAsciiData *next;
wigData = getWiggleAsData(conn, curTable, region);
for (asciiData = wigData; asciiData; asciiData = next)
{
next = asciiData->next;
if (asciiData->count)
{
slAddHead(&wigDataList, asciiData);
++count;
}
}
slReverse(&wigDataList);
}
}
else if (isBedGr && doDataPoints)
{
dv = bedGraphDataVector(curTable, conn, region);
if (dv != NULL)
slAddHead(&dataVectorList, dv);
}
else if (isBgWg && doDataPoints)
{
dv = bigWigDataVector(curTable, conn, region);
if (dv != NULL)
slAddHead(&dataVectorList, dv);
}
else if (isWig || isBgWg)
{
dv = wiggleDataVector(curTrack, curTable, conn, region);
bedList = dataVectorToBedList(dv);
dataVectorFree(&dv);
}
else if (isBedGr)
{
bedList = getBedGraphAsBed(conn, curTable, region);
}
else
{
bedList = cookedBedList(conn, curTable, region, lm, &fields);
}
/* this is a one-time only initial creation of the custom track
* structure to receive the results. gotResults turns it off after
* the first time.
*/
if (doCtHdr && !gotResults &&
((bedList != NULL) || (wigDataList != NULL) ||
(dataVectorList != NULL)))
{
ctNew = beginCustomTrack(table, fields,
doCt, (isWig || isBedGr || isBgWg), doDataPoints);
}
if (doDataPoints && (wigDataList || dataVectorList))
gotResults = TRUE;
else
{
if ((fbQual == NULL) || (fbQual[0] == 0))
{
for (bed = bedList; bed != NULL; bed = bed->next)
{
if (bed->name != NULL)
{
subChar(bed->name, ' ', '_');
}
if (doCt)
{
struct bed *dupe = cloneBed(bed); /* Out of local memory. */
slAddHead(&ctNew->bedList, dupe);
}
else
{
if (doRgb)
bedTabOutNitemRgb(bed, fields, stdout);
else
bedTabOutN(bed, fields, stdout);
}
gotResults = TRUE;
}
}
else
{
safef(fbTQ, sizeof(fbTQ), "%s:%s", hti->rootName, fbQual);
fbList = fbFromBed(db, fbTQ, hti, bedList, 0, 0, FALSE, FALSE);
if (fields >= 6)
fields = 6;
else if (fields >= 4)
fields = 4;
else
fields = 3;
if (doCt && ctNew)
{
ctNew->fieldCount = fields;
safef(ctNew->tdb->type, strlen(ctNew->tdb->type)+1,
"bed %d", fields);
}
for (fbPtr=fbList; fbPtr != NULL; fbPtr=fbPtr->next)
{
if (fbPtr->name != NULL)
{
char *ptr = strchr(fbPtr->name, ' ');
if (ptr != NULL)
*ptr = 0;
}
if (doCt)
{
struct bed *fbBed = fbToBedOne(fbPtr);
slAddHead(&ctNew->bedList, fbBed );
}
else
{
if (fields >= 6)
hPrintf("%s\t%d\t%d\t%s\t%d\t%c\n",
fbPtr->chrom, fbPtr->start, fbPtr->end, fbPtr->name,
0, fbPtr->strand);
else if (fields >= 4)
hPrintf("%s\t%d\t%d\t%s\n",
fbPtr->chrom, fbPtr->start, fbPtr->end, fbPtr->name);
else
hPrintf("%s\t%d\t%d\n",
fbPtr->chrom, fbPtr->start, fbPtr->end);
}
gotResults = TRUE;
}
featureBitsFreeList(&fbList);
}
}
bedList = NULL;
lmCleanup(&lm);
}
if (!gotResults)
{
hPrintf(NO_RESULTS);
}
else if (doCt)
{
int wigDataSize = 0;
/* Load existing custom tracks and add this new one: */
struct customTrack *ctList = getCustomTracks();
removeNamedCustom(&ctList, ctNew->tdb->table);
if (doDataPoints)
{
if (needSubtrackMerge || isBedGr || isBgWg)
{
slReverse(&dataVectorList);
wigDataSize = dataVectorWriteWigAscii(dataVectorList, ctNew->wigAscii, 0, NULL);
// TODO: see if can make prettier wig output here that
// doesn't necessarily have one value per base
}
else
{
struct wiggleDataStream *wds = NULL;
/* create an otherwise empty wds so we can print out the list */
wds = wiggleDataStreamNew();
wds->ascii = wigDataList;
wigDataSize = wds->asciiOut(wds, db, ctNew->wigAscii, TRUE, FALSE);
#if defined(DEBUG) /* dbg */
/* allow file readability for debug */
chmod(ctNew->wigAscii, 0666);
#endif
wiggleDataStreamFree(&wds);
}
}
else
slReverse(&ctNew->bedList);
slAddHead(&ctList, ctNew);
/* Save the custom tracks out to file (overwrite the old file): */
customTracksSaveCart(db, cart, ctList);
/* Put up redirect-to-browser page. */
if (redirectToGb)
{
char browserUrl[256];
char headerText[512];
int redirDelay = 3;
safef(browserUrl, sizeof(browserUrl),
"%s?%s&db=%s", hgTracksName(), cartSidUrlString(cart), database);
safef(headerText, sizeof(headerText),
"<META HTTP-EQUIV=\"REFRESH\" CONTENT=\"%d;URL=%s\">",
redirDelay, browserUrl);
webStartHeader(cart, database, headerText,
"Table Browser: %s %s: %s", hOrganism(database),
freezeName, "get custom track");
if (doDataPoints)
{
hPrintf("There are %d data points in custom track. ", wigDataSize);
}
else
{
hPrintf("There are %d items in custom track. ",
slCount(ctNew->bedList));
}
hPrintf("You will be automatically redirected to the genome browser in\n"
"%d seconds, or you can \n"
"<A HREF=\"%s\">click here to continue</A>.\n",
redirDelay, browserUrl);
}
}
else if (doDataPoints)
{
if (needSubtrackMerge || isBedGr || isBgWg)
{
slReverse(&dataVectorList);
dataVectorWriteWigAscii(dataVectorList, "stdout", 0, NULL);
}
else
{
/* create an otherwise empty wds so we can print out the list */
struct wiggleDataStream *wds = NULL;
wds = wiggleDataStreamNew();
wds->ascii = wigDataList;
wds->asciiOut(wds, db, "stdout", TRUE, FALSE);
wiggleDataStreamFree(&wds);
}
}
return gotResults;
}
void doGvf(struct trackDb *tdb, char *item)
/* Show details for variants represented as GVF, stored in a bed8Attrs table */
{
struct sqlConnection *conn = hAllocConn(database);
int start = cartInt(cart, "o");
char query[1024];
sqlSafef(query, sizeof(query),
"select * from %s where name = '%s' and chrom = '%s' and chromStart = %d",
tdb->table, item, seqName, start);
struct sqlResult *sr = sqlGetResult(conn, query);
char **row;
if ((row = sqlNextRow(sr)) == NULL)
errAbort("doGvfDetails: can't find item '%s' in %s at %s:%d", item, database, seqName, start);
int rowOffset = hOffsetPastBin(database, seqName, tdb->table);
struct bed8Attrs *ba = bed8AttrsLoad(row+rowOffset);
bedPrintPos((struct bed *)ba, 3, tdb);
int i = 0;
// Note: this loop modifies ba->attrVals[i], assuming we won't use them again:
for (i = 0; i < ba->attrCount; i++)
{
// The ID is the bed8Attrs name and has already been displayed:
if (sameString(ba->attrTags[i], "ID"))
continue;
cgiDecode(ba->attrVals[i], ba->attrVals[i], strlen(ba->attrVals[i]));
char *tag = ba->attrTags[i];
// User-defined keywords used in dbVar's GVF:
if (sameString(tag, "var_type")) // This one isn't anymore, but I add it back (hg18.txt).
tag = "Variant type";
else if (sameString(tag, "clinical_int"))
tag = "Clinical interpretation";
else if (sameString(tag, "var_origin"))
tag = "Variant origin";
else if (islower(tag[0]))
// Uppercase for nice display, assuming user doesn't care which keywords are
// user-defined vs. GVF standard:
tag[0] = toupper(tag[0]);
// GVF standard Start_range and End_range tags (1-based coords):
if (sameString(tag, "Start_range") || sameString(tag, "End_range"))
{
char *copy = cloneString(ba->attrVals[i]);
char *words[3];
int wordCount = chopCommas(copy, words);
if (wordCount == 2 &&
(sameString(".", words[0]) || isInteger(words[0])) &&
(sameString(".", words[1]) || isInteger(words[1])))
{
boolean isStartRange = sameString(tag, "Start_range");
char *rangeStart = words[0], *rangeEnd = words[1];
if (sameString(".", rangeStart))
rangeStart = "unknown";
if (sameString(".", rangeEnd))
rangeEnd = "unknown";
if (isStartRange)
printf("<B>Start range</B>: outer start %s, inner start %s<BR>\n",
rangeStart, rangeEnd);
else
printf("<B>End range</B>: inner end %s, outer end %s<BR>\n",
rangeStart, rangeEnd);
}
else
// not formatted as expected, just print as-is:
printf("<B>%s</B>: %s<BR>\n", tag, htmlEncode(ba->attrVals[i]));
}
// Parent sounds like mom or dad (as in var_origin)... tweak it too:
else if (sameString(tag, "Parent"))
{
printf("<B>Variant region:</B> "
"<A HREF=\"http://www.ncbi.nlm.nih.gov/dbvar/variants/%s/\" "
"TARGET=_BLANK>%s</A><BR>\n", ba->attrVals[i], htmlEncode(ba->attrVals[i]));
}
else if (sameString(tag, "Name"))
{
char *url = trackDbSetting(tdb, "url");
// Show the Name only if it hasn't already appeared in the URL:
if (url == NULL || !stringIn("$$", url))
printf("<B>%s</B>: %s<BR>\n", tag, htmlEncode(ba->attrVals[i]));
}
else if (sameWord(tag, "Phenotype_id") && startsWith("HPO:HP:", ba->attrVals[i]))
{
subChar(tag, '_', ' ');
printf("<B>%s</B>: <A HREF=\"http://www.berkeleybop.org/obo/%s\" "
"TARGET=_BLANK>%s</A><BR>\n", tag, ba->attrVals[i]+strlen("HPO:"),
htmlEncode(ba->attrVals[i]));
}
else
{
subChar(tag, '_', ' ');
printf("<B>%s</B>: %s<BR>\n", tag, htmlEncode(ba->attrVals[i]));
}
}
sqlFreeResult(&sr);
hFreeConn(&conn);
/* printTrackHtml is done in genericClickHandlerPlus. */
}
void hgTrackDb(char *org, char *database, char *trackDbName, char *sqlFile, char *hgRoot,
boolean strict)
/* hgTrackDb - Create trackDb table from text files. */
{
struct trackDb *td;
char tab[PATH_LEN];
safef(tab, sizeof(tab), "%s.tab", trackDbName);
struct trackDb *tdbList = buildTrackDb(org, database, hgRoot, strict);
tdbList = flatten(tdbList);
slSort(&tdbList, trackDbCmp);
verbose(1, "Loaded %d track descriptions total\n", slCount(tdbList));
/* Write to tab-separated file; hold off on html, since it must be encoded */
{
verbose(2, "Starting write of tabs to %s\n", tab);
FILE *f = mustOpen(tab, "w");
for (td = tdbList; td != NULL; td = td->next)
{
hVarSubstTrackDb(td, database);
char *hold = td->html;
td->html = "";
subChar(td->type, '\t', ' '); /* Tabs confuse things. */
subChar(td->shortLabel, '\t', ' '); /* Tabs confuse things. */
subChar(td->longLabel, '\t', ' '); /* Tabs confuse things. */
trackDbTabOut(td, f);
td->html = hold;
}
carefulClose(&f);
verbose(2, "Wrote tab representation to %s\n", tab);
}
/* Update database */
{
char *create, *end;
char query[256];
struct sqlConnection *conn = sqlConnect(database);
/* Load in table definition. */
readInGulp(sqlFile, &create, NULL);
create = trimSpaces(create);
create = substituteTrackName(create, trackDbName);
end = create + strlen(create)-1;
if (*end == ';') *end = 0;
sqlRemakeTable(conn, trackDbName, create);
/* Load in regular fields. */
sqlSafef(query, sizeof(query), "load data local infile '%s' into table %s", tab, trackDbName);
verbose(2, "sending mysql \"%s\"\n", query);
sqlUpdate(conn, query);
verbose(2, "done tab file load");
/* Load in html and settings fields. */
for (td = tdbList; td != NULL; td = td->next)
{
if (isEmpty(td->html))
{
if (strict && !trackDbLocalSetting(td, "parent") && !trackDbLocalSetting(td, "superTrack") &&
!sameString(td->track,"cytoBandIdeo"))
{
fprintf(stderr, "Warning: html missing for %s %s %s '%s'\n",org, database, td->track, td->shortLabel);
}
}
else
{
updateBigTextField(conn, trackDbName, "tableName", td->track, "html", td->html);
}
if (td->settingsHash != NULL)
{
char *settings = settingsFromHash(td->settingsHash);
updateBigTextField(conn, trackDbName, "tableName", td->track,
"settings", settings);
if (showSettings)
{
verbose(1, "%s: type='%s';", td->track, td->type);
if (isNotEmpty(settings))
{
char *oneLine = replaceChars(settings, "\n", "; ");
eraseTrailingSpaces(oneLine);
verbose(1, " %s", oneLine);
freeMem(oneLine);
}
verbose(1, "\n");
}
freeMem(settings);
}
}
sqlDisconnect(&conn);
verbose(1, "Loaded database %s\n", database);
}
}
void txGeneXref(char *genomeDb, char *uniProtDb, char *genePredFile, char *infoFile, char *pickFile,
char *evFile, char *outFile)
/* txGeneXref - Make kgXref type table for genes.. */
{
/* Load picks into hash. We don't use cdsPicksLoadAll because empty fields
* cause that autoSql-generated routine problems. */
struct hash *pickHash = newHash(18);
struct hash *geneToProtHash = makeGeneToProtHash(genePredFile);
struct cdsPick *pick;
struct lineFile *lf = lineFileOpen(pickFile, TRUE);
char *row[CDSPICK_NUM_COLS];
while (lineFileRowTab(lf, row))
{
pick = cdsPickLoad(row);
removePickVersions(pick);
hashAdd(pickHash, pick->name, pick);
}
/* Load evidence into hash */
struct hash *evHash = newHash(18);
struct txRnaAccs *ev, *evList = txRnaAccsLoadAll(evFile);
for (ev = evList; ev != NULL; ev = ev->next)
hashAdd(evHash, ev->name, ev);
/* Open connections to our databases */
struct sqlConnection *gConn = sqlConnect(genomeDb);
struct sqlConnection *uConn = sqlConnect(uniProtDb);
/* Read in info file, and loop through it to make out file. */
struct txInfo *info, *infoList = txInfoLoadAll(infoFile);
FILE *f = mustOpen(outFile, "w");
for (info = infoList; info != NULL; info = info->next)
{
char *kgID = info->name;
char *mRNA = "";
char *spID = "";
char *spDisplayID = "";
char *geneSymbol = NULL;
char *refseq = "";
char *protAcc = "";
char *description = NULL;
char query[256];
char *proteinId = hashMustFindVal(geneToProtHash, info->name);
boolean isAb = sameString(info->category, "antibodyParts");
pick = hashFindVal(pickHash, info->name);
ev = hashFindVal(evHash, info->name);
if (pick != NULL)
{
/* Fill in the relatively straightforward fields. */
refseq = pick->refSeq;
if (info->orfSize > 0)
{
protAcc = pick->refProt;
spID = proteinId;
if (sameString(protAcc, spID))
spID = pick->uniProt;
if (spID[0] != 0)
spDisplayID = spAnyAccToId(uConn, spID);
}
/* Fill in gene symbol and description from refseq if possible. */
if (refseq[0] != 0)
{
struct sqlResult *sr;
safef(query, sizeof(query), "select name,product from refLink where mrnaAcc='%s'",
refseq);
sr = sqlGetResult(gConn, query);
char **row = sqlNextRow(sr);
if (row != NULL)
{
geneSymbol = cloneString(row[0]);
if (!sameWord("unknown protein", row[1]))
description = cloneString(row[1]);
}
sqlFreeResult(&sr);
}
/* If need be try uniProt for gene symbol and description. */
if (spID[0] != 0 && (geneSymbol == NULL || description == NULL))
{
char *acc = spLookupPrimaryAcc(uConn, spID);
if (description == NULL)
description = spDescription(uConn, acc);
if (geneSymbol == NULL)
{
struct slName *nameList = spGenes(uConn, acc);
if (nameList != NULL)
geneSymbol = cloneString(nameList->name);
slFreeList(&nameList);
}
}
}
/* If it's an antibody fragment use that as name. */
if (isAb)
{
geneSymbol = cloneString("abParts");
description = cloneString("Parts of antibodies, mostly variable regions.");
isAb = TRUE;
}
if (ev == NULL)
{
mRNA = cloneString("");
if (!isAb)
{
errAbort("%s is %s but not %s\n", info->name, infoFile, evFile);
}
}
else
{
mRNA = cloneString(ev->primary);
chopSuffix(mRNA);
}
/* Still no joy? Try genbank RNA records. */
if (geneSymbol == NULL || description == NULL)
{
if (ev != NULL)
{
int i;
for (i=0; i<ev->accCount; ++i)
{
char *acc = ev->accs[i];
chopSuffix(acc);
if (geneSymbol == NULL)
{
safef(query, sizeof(query),
"select geneName.name from gbCdnaInfo,geneName "
"where geneName.id=gbCdnaInfo.geneName and gbCdnaInfo.acc = '%s'", acc);
geneSymbol = sqlQuickString(gConn, query);
if (geneSymbol != NULL)
{
if (sameString(geneSymbol, "n/a"))
geneSymbol = NULL;
}
}
if (description == NULL)
{
safef(query, sizeof(query),
"select description.name from gbCdnaInfo,description "
"where description.id=gbCdnaInfo.description "
"and gbCdnaInfo.acc = '%s'", acc);
description = sqlQuickString(gConn, query);
if (description != NULL)
{
if (sameString(description, "n/a"))
description = NULL;
}
}
}
}
}
if (geneSymbol == NULL)
geneSymbol = mRNA;
if (description == NULL)
description = mRNA;
/* Get rid of some characters that will cause havoc downstream. */
stripChar(geneSymbol, '\'');
subChar(geneSymbol, '<', '[');
subChar(geneSymbol, '>', ']');
/* Abbreviate geneSymbol if too long */
if (strlen(geneSymbol) > 40)
strcpy(geneSymbol+37, "...");
fprintf(f, "%s\t", kgID);
fprintf(f, "%s\t", mRNA);
fprintf(f, "%s\t", spID);
fprintf(f, "%s\t", spDisplayID);
fprintf(f, "%s\t", geneSymbol);
fprintf(f, "%s\t", refseq);
fprintf(f, "%s\t", protAcc);
fprintf(f, "%s\n", description);
}
carefulClose(&f);
}
void undosPath(char *path)
/* Convert '\' to '/' in path. */
{
subChar(path, '\\', '/');
}
void printExpression(FILE *f, struct sqlConnection *conn, char *imagePaneKey, char *assayKey)
/* Print associated expression info on assay/pane as indented lines. */
{
struct dyString *query = dyStringNew(0);
struct sqlResult *sr;
char **row;
sqlDyStringPrintf(query,
"select GXD_Structure.printName,GXD_InSituResult._Strength_key,GXD_Pattern.pattern "
"from GXD_Structure,GXD_InSituResult,GXD_InSituResultImage,"
"GXD_ISResultStructure,GXD_Pattern,GXD_Specimen "
"where GXD_InSituResultImage._ImagePane_key = %s "
"and GXD_InSituResultImage._Result_key = GXD_ISResultStructure._Result_key "
"and GXD_InSituResultImage._Result_key = GXD_InSituResult._Result_key "
"and GXD_ISResultStructure._Structure_key = GXD_Structure._Structure_key "
"and GXD_Pattern._Pattern_key = GXD_InSituResult._Pattern_key "
"and GXD_Specimen._Specimen_key = GXD_InSituResult._Specimen_key "
"and GXD_Specimen._Assay_key = %s "
, imagePaneKey, assayKey);
sr = sqlGetResultVerbose(conn, query->string);
while ((row = sqlNextRow(sr)) != NULL)
{
char *bodyPart = skipLeadingSpaces(row[0]);
if (bodyPart[0] != 0)
{
int expression = sqlSigned(row[1]);
char *pattern = skipLeadingSpaces(row[2]);
float level;
int lastChar = strlen(bodyPart)-1;
/* Strip trailing # if any from body part. */
if (bodyPart[lastChar] == '#')
bodyPart[lastChar] = 0;
subChar(bodyPart,';','-');
/* treat expression 2 "present" as full 1.0 so will appear as (+)
* treat -1 and -2 (not applic and not spec) as 1.0 + so won't disappear
* 0 shouldn't happen but we'll catch it anyway */
switch(expression)
{
case 3:
case 4:
case 5:
case 6:
case 7:
level = (float)(expression - 2) / 6.0;
break;
case 1:
level = 0.0;
break;
case -2:
case -1:
case 0:
case 2:
case 8:
default:
level = 1.0;
}
fprintf(f, "\texpression\t%s\t%f\t\t\t%s\n", bodyPart, level, pattern);
}
}
sqlFreeResult(&sr);
}
static void legalizeName(Symbol* sym) {
if (sym->hasFlag(FLAG_EXTERN))
return;
for (const char* ch = sym->cname; *ch != '\0'; ch++) {
switch (*ch) {
case '>': ch = subChar(sym, ch, "_GREATER_"); break;
case '<': ch = subChar(sym, ch, "_LESS_"); break;
case '=':
{
/* To help generated code readability, we'd like to convert =
into "ASSIGN" and == into "EQUALS". Unfortunately, because
of the character-at-a-time approach taken here combined
with the fact that subChar() returns a completely new
string on every call, the way I implemented this is a bit
ugly (in part because I didn't want to spend the time to
reimplement this whole function -BLC */
static const char* equalsStr = "_EQUALS_";
static int equalsLen = strlen(equalsStr);
if (*(ch+1) == '=') {
// If we're in the == case, replace the first = with EQUALS
ch = subChar(sym, ch, equalsStr);
} else {
if ((ch-equalsLen >= sym->cname) &&
strncmp(ch-equalsLen, equalsStr, equalsLen) == 0) {
// Otherwise, if the thing preceding this '=' is the
// string _EQUALS_, we must have been the second '=' and
// we should just replace ourselves with an underscore to
// make things legal.
ch = subChar(sym, ch, "_");
} else {
// Otherwise, this must have simply been a standalone '='
ch = subChar(sym, ch, "_ASSIGN_");
}
}
break;
}
case '*': ch = subChar(sym, ch, "_ASTERISK_"); break;
case '/': ch = subChar(sym, ch, "_SLASH_"); break;
case '%': ch = subChar(sym, ch, "_PERCENT_"); break;
case '+': ch = subChar(sym, ch, "_PLUS_"); break;
case '-': ch = subChar(sym, ch, "_HYPHEN_"); break;
case '^': ch = subChar(sym, ch, "_CARET_"); break;
case '&': ch = subChar(sym, ch, "_AMPERSAND_"); break;
case '|': ch = subChar(sym, ch, "_BAR_"); break;
case '!': ch = subChar(sym, ch, "_EXCLAMATION_"); break;
case '#': ch = subChar(sym, ch, "_POUND_"); break;
case '?': ch = subChar(sym, ch, "_QUESTION_"); break;
case '$': ch = subChar(sym, ch, "_DOLLAR_"); break;
case '~': ch = subChar(sym, ch, "_TILDE_"); break;
case '.': ch = subChar(sym, ch, "_DOT_"); break;
case ' ': ch = subChar(sym, ch, "_SPACE_"); break;
default: break;
}
}
// Add chpl_ to operator names.
if ((sym->cname[0] == '_' &&
(sym->cname[1] == '_' || (sym->cname[1] >= 'A' && sym->cname[1] <= 'Z'))))
{
sym->cname = astr("chpl__", sym->cname);
}
}
static void mafOrAxtClick2(struct sqlConnection *conn, struct sqlConnection *conn2, struct trackDb *tdb, char *axtOtherDb, char *fileName)
/* Display details for MAF or AXT tracks. */
{
hgBotDelay();
if (winEnd - winStart > 30000)
{
printf("Zoom so that window is 30,000 bases or less to see alignments and conservation statistics\n");
}
else
{
struct mafAli *mafList = NULL, *maf, *subList = NULL;
int aliIx = 0, realCount = 0;
char dbChrom[64];
char option[128];
char *capTrack;
struct consWiggle *consWig, *consWiggles;
struct hash *speciesOffHash = NULL;
char *speciesOrder = NULL;
char *speciesTarget = trackDbSetting(tdb, SPECIES_TARGET_VAR);
char buffer[1024];
int useTarg = FALSE;
int useIrowChains = FALSE;
safef(option, sizeof(option), "%s.%s", tdb->track, MAF_CHAIN_VAR);
if (cartCgiUsualBoolean(cart, option, FALSE) &&
trackDbSetting(tdb, "irows") != NULL)
useIrowChains = TRUE;
safef(buffer, sizeof(buffer), "%s.vis",tdb->track);
if (useIrowChains)
{
if (!cartVarExists(cart, buffer) && (speciesTarget != NULL))
useTarg = TRUE;
else
{
char *val;
val = cartUsualString(cart, buffer, "useCheck");
useTarg = sameString("useTarg",val);
}
}
if (sameString(tdb->type, "bigMaf"))
{
char *fileName = trackDbSetting(tdb, "bigDataUrl");
struct bbiFile *bbi = bigBedFileOpen(fileName);
mafList = bigMafLoadInRegion(bbi, seqName, winStart, winEnd);
}
else
mafList = mafOrAxtLoadInRegion2(conn,conn2, tdb, seqName, winStart, winEnd,
axtOtherDb, fileName);
safef(dbChrom, sizeof(dbChrom), "%s.%s", hubConnectSkipHubPrefix(database), seqName);
safef(option, sizeof(option), "%s.speciesOrder", tdb->track);
speciesOrder = cartUsualString(cart, option, NULL);
if (speciesOrder == NULL)
speciesOrder = trackDbSetting(tdb, "speciesOrder");
for (maf = mafList; maf != NULL; maf = maf->next)
{
int mcCount = 0;
struct mafComp *mc;
struct mafAli *subset;
struct mafComp *nextMc;
/* remove empty components and configured off components
* from MAF, and ignore
* the entire MAF if all components are empty
* (solely for gap annotation) */
if (!useTarg)
{
for (mc = maf->components->next; mc != NULL; mc = nextMc)
{
char buf[64];
char *organism;
mafSrcDb(mc->src, buf, sizeof buf);
organism = hOrganism(buf);
if (!organism)
organism = buf;
nextMc = mc->next;
safef(option, sizeof(option), "%s.%s", tdb->track, buf);
if (!cartUsualBoolean(cart, option, TRUE))
{
if (speciesOffHash == NULL)
speciesOffHash = newHash(4);
hashStoreName(speciesOffHash, organism);
}
if (!cartUsualBoolean(cart, option, TRUE))
slRemoveEl(&maf->components, mc);
else
mcCount++;
}
}
if (mcCount == 0)
continue;
if (speciesOrder)
{
int speciesCt;
char *species[2048];
struct mafComp **newOrder, *mcThis;
int i;
mcCount = 0;
speciesCt = chopLine(cloneString(speciesOrder), species);
newOrder = needMem((speciesCt + 1) * sizeof (struct mafComp *));
newOrder[mcCount++] = maf->components;
for (i = 0; i < speciesCt; i++)
{
if ((mcThis = mafMayFindCompSpecies(maf, species[i], '.')) == NULL)
continue;
newOrder[mcCount++] = mcThis;
}
maf->components = NULL;
for (i = 0; i < mcCount; i++)
{
newOrder[i]->next = 0;
slAddHead(&maf->components, newOrder[i]);
}
slReverse(&maf->components);
}
subset = mafSubsetE(maf, dbChrom, winStart, winEnd, TRUE);
if (subset != NULL)
{
/* Reformat MAF if needed so that sequence from current
* database is the first component and on the
* plus strand. */
mafMoveComponentToTop(subset, dbChrom);
if (subset->components->strand == '-')
mafFlipStrand(subset);
subset->score = mafScoreMultiz(subset);
slAddHead(&subList, subset);
++realCount;
}
}
slReverse(&subList);
mafAliFreeList(&mafList);
if (subList != NULL)
{
char *showVarName = "hgc.showMultiBase";
char *showVarVal = cartUsualString(cart, showVarName, "all");
boolean onlyDiff = sameWord(showVarVal, "diff");
#ifdef ADDEXONCAPITAL
char *codeVarName = "hgc.multiCapCoding";
char *codeVarVal = cartUsualString(cart, codeVarName, "coding");
boolean onlyCds = sameWord(codeVarVal, "coding");
#endif
/* add links for conservation score statistics */
consWiggles = wigMafWiggles(database, tdb);
int wigCount = slCount(consWiggles);
if (wigCount == 1)
{
conservationStatsLink(tdb, "Conservation score statistics", consWiggles->table);
}
else if (wigCount > 1)
{
/* multiple wiggles. List all that have been turned on with
* checkboxes */
/* Scan for cart variables -- do any exist, are any turned on ? */
boolean wigSet = FALSE;
boolean wigOn = FALSE;
for (consWig = consWiggles; consWig != NULL;
consWig = consWig->next)
{
char *wigVarSuffix = NULL;
(void)wigMafWiggleVar(tdb->track, consWig, &wigVarSuffix);
if (cartVarExistsAnyLevel(cart, tdb, FALSE, wigVarSuffix))
{
wigSet = TRUE;
if (cartBooleanClosestToHome(cart, tdb, FALSE, wigVarSuffix))
wigOn = TRUE;
}
}
/* If there are no cart vars, turn on the first (default) wig */
if (!wigSet)
{
char *prefix = tdb->track; // use when setting things to the cart
if (tdbIsContainerChild(tdb))
prefix = tdbGetContainer(tdb)->track;
cartSetBoolean(cart, wigMafWiggleVar(prefix, consWiggles, NULL), TRUE);
wigOn = TRUE;
}
if (wigOn)
{
boolean first = TRUE;
for (consWig = consWiggles; consWig != NULL;
consWig = consWig->next)
{
if (first)
{
printf("Conservation score statistics:");
first = FALSE;
}
char *wigVarSuffix = NULL;
(void)wigMafWiggleVar(tdb->track, consWig, &wigVarSuffix);
if (cartUsualBooleanClosestToHome(cart, tdb, FALSE, wigVarSuffix,FALSE))
{
printf(" ");
subChar(consWig->uiLabel, '_', ' ');
conservationStatsLink(tdb,
consWig->uiLabel, consWig->table);
}
}
}
}
puts("</P>\n");
/* no alignment to display when in visibilities where only wiggle is shown */
char *vis = cartOptionalString(cart, tdb->track);
if (vis)
{
enum trackVisibility tv = hTvFromStringNoAbort(vis);
if (tv == tvSquish || tv == tvDense)
return;
}
#ifdef ADDEXONCAPITAL
puts("<FORM ACTION=\"../cgi-bin/hgc\" NAME=\"gpForm\" METHOD=\"GET\">");
cartSaveSession(cart);
cgiContinueHiddenVar("g");
cgiContinueHiddenVar("c");
cgiContinueHiddenVar("i");
printf("Capitalize ");
cgiMakeDropListFull(codeVarName, codeAll, codeAll,
ArraySize(codeAll), codeVarVal, autoSubmit);
printf("exons based on ");
capTrack = genePredDropDown(cart, trackHash,
"gpForm", "hgc.multiCapTrack");
#endif
printf("show ");
cgiMakeDropListFull(showVarName, showAll, showAll,
ArraySize(showAll), showVarVal, autoSubmit);
printf("bases");
printf("<BR>\n");
printf("</FORM>\n");
#ifdef REVERSESTRAND
/* notify if bases are complemented (hgTracks is on reverse strand) */
if (cartCgiUsualBoolean(cart, COMPLEMENT_BASES_VAR, FALSE))
puts("<EM>Alignment displayed on reverse strand</EM><BR>");
#endif
puts("Place cursor over species for alignment detail. Click on 'B' to link to browser ");
puts("for aligned species, click on 'D' to get DNA for aligned species.<BR>");
printf("<TT><PRE>");
/* notify if species removed from alignment */
if (speciesOffHash)
{
char *species;
struct hashCookie hc = hashFirst(speciesOffHash);
puts("<B>Components not displayed:</B> ");
while ((species = hashNextName(&hc)) != NULL)
printf("%s ", species);
puts("<BR>");
}
for (maf = subList; maf != NULL; maf = maf->next)
{
mafLowerCase(maf);
#ifdef ADDEXONCAPITAL
if (capTrack != NULL)
capMafOnTrack(maf, capTrack, onlyCds);
#endif
printf("<B>Alignment block %d of %d in window, %d - %d, %d bps </B>\n",
++aliIx,realCount,maf->components->start + 1,
maf->components->start + maf->components->size, maf->components->size);
mafPrettyOut(stdout, maf, 70,onlyDiff, aliIx);
}
mafAliFreeList(&subList);
}
else
{
printf("No multiple alignment in browser window");
}
printf("</PRE></TT>");
}
}
void blatSeq(char *userSeq, char *organism)
/* Blat sequence user pasted in. */
{
FILE *f;
struct dnaSeq *seqList = NULL, *seq;
struct tempName pslTn, faTn;
int maxSingleSize, maxTotalSize, maxSeqCount;
int minSingleSize = minMatchShown;
char *genome, *db;
char *type = cgiString("type");
char *seqLetters = cloneString(userSeq);
struct serverTable *serve;
int conn;
int oneSize, totalSize = 0, seqCount = 0;
boolean isTx = FALSE;
boolean isTxTx = FALSE;
boolean txTxBoth = FALSE;
struct gfOutput *gvo;
boolean qIsProt = FALSE;
enum gfType qType, tType;
struct hash *tFileCache = gfFileCacheNew();
boolean feelingLucky = cgiBoolean("Lucky");
getDbAndGenome(cart, &db, &genome, oldVars);
if(!feelingLucky)
cartWebStart(cart, db, "%s BLAT Results", trackHubSkipHubName(organism));
/* Load user sequence and figure out if it is DNA or protein. */
if (sameWord(type, "DNA"))
{
seqList = faSeqListFromMemText(seqLetters, TRUE);
uToT(seqList);
isTx = FALSE;
}
else if (sameWord(type, "translated RNA") || sameWord(type, "translated DNA"))
{
seqList = faSeqListFromMemText(seqLetters, TRUE);
uToT(seqList);
isTx = TRUE;
isTxTx = TRUE;
txTxBoth = sameWord(type, "translated DNA");
}
else if (sameWord(type, "protein"))
{
seqList = faSeqListFromMemText(seqLetters, FALSE);
isTx = TRUE;
qIsProt = TRUE;
}
else
{
seqList = faSeqListFromMemTextRaw(seqLetters);
isTx = !seqIsDna(seqList);
if (!isTx)
{
for (seq = seqList; seq != NULL; seq = seq->next)
{
seq->size = dnaFilteredSize(seq->dna);
dnaFilter(seq->dna, seq->dna);
toLowerN(seq->dna, seq->size);
subChar(seq->dna, 'u', 't');
}
}
else
{
for (seq = seqList; seq != NULL; seq = seq->next)
{
seq->size = aaFilteredSize(seq->dna);
aaFilter(seq->dna, seq->dna);
toUpperN(seq->dna, seq->size);
}
qIsProt = TRUE;
}
}
if (seqList != NULL && seqList->name[0] == 0)
{
freeMem(seqList->name);
seqList->name = cloneString("YourSeq");
}
trimUniq(seqList);
/* If feeling lucky only do the first on. */
if(feelingLucky && seqList != NULL)
{
seqList->next = NULL;
}
/* Figure out size allowed. */
maxSingleSize = (isTx ? 10000 : 75000);
maxTotalSize = maxSingleSize * 2.5;
#ifdef LOWELAB
maxSeqCount = 200;
#else
maxSeqCount = 25;
#endif
/* Create temporary file to store sequence. */
trashDirFile(&faTn, "hgSs", "hgSs", ".fa");
faWriteAll(faTn.forCgi, seqList);
/* Create a temporary .psl file with the alignments against genome. */
trashDirFile(&pslTn, "hgSs", "hgSs", ".pslx");
f = mustOpen(pslTn.forCgi, "w");
gvo = gfOutputPsl(0, qIsProt, FALSE, f, FALSE, TRUE);
serve = findServer(db, isTx);
/* Write header for extended (possibly protein) psl file. */
if (isTx)
{
if (isTxTx)
{
qType = gftDnaX;
tType = gftDnaX;
}
else
{
qType = gftProt;
tType = gftDnaX;
}
}
else
{
qType = gftDna;
tType = gftDna;
}
pslxWriteHead(f, qType, tType);
if (qType == gftProt)
{
minSingleSize = 14;
}
else if (qType == gftDnaX)
{
minSingleSize = 36;
}
/* Loop through each sequence. */
for (seq = seqList; seq != NULL; seq = seq->next)
{
printf(" "); fflush(stdout); /* prevent apache cgi timeout by outputting something */
oneSize = realSeqSize(seq, !isTx);
if ((seqCount&1) == 0) // Call bot delay every 2nd time starting with first time
hgBotDelay();
if (++seqCount > maxSeqCount)
{
warn("More than 25 input sequences, stopping at %s.",
seq->name);
break;
}
if (oneSize > maxSingleSize)
{
warn("Sequence %s is %d letters long (max is %d), skipping",
seq->name, oneSize, maxSingleSize);
continue;
}
if (oneSize < minSingleSize)
{
warn("Warning: Sequence %s is only %d letters long (%d is the recommended minimum)",
seq->name, oneSize, minSingleSize);
// we could use "continue;" here to actually enforce skipping,
// but let's give the short sequence a chance, it might work.
// minimum possible length = tileSize+stepSize, so mpl=16 for dna stepSize=5, mpl=10 for protein.
if (qIsProt && oneSize < 1) // protein does not tolerate oneSize==0
continue;
}
totalSize += oneSize;
if (totalSize > maxTotalSize)
{
warn("Sequence %s would take us over the %d letter limit, stopping here.",
seq->name, maxTotalSize);
break;
}
conn = gfConnect(serve->host, serve->port);
if (isTx)
{
gvo->reportTargetStrand = TRUE;
if (isTxTx)
{
gfAlignTransTrans(&conn, serve->nibDir, seq, FALSE, 5,
tFileCache, gvo, !txTxBoth);
if (txTxBoth)
{
reverseComplement(seq->dna, seq->size);
conn = gfConnect(serve->host, serve->port);
gfAlignTransTrans(&conn, serve->nibDir, seq, TRUE, 5,
tFileCache, gvo, FALSE);
}
}
else
{
gfAlignTrans(&conn, serve->nibDir, seq, 5, tFileCache, gvo);
}
}
else
{
gfAlignStrand(&conn, serve->nibDir, seq, FALSE, minMatchShown, tFileCache, gvo);
reverseComplement(seq->dna, seq->size);
conn = gfConnect(serve->host, serve->port);
gfAlignStrand(&conn, serve->nibDir, seq, TRUE, minMatchShown, tFileCache, gvo);
}
gfOutputQuery(gvo, f);
}
carefulClose(&f);
showAliPlaces(pslTn.forCgi, faTn.forCgi, serve->db, qType, tType,
organism, feelingLucky);
if(!feelingLucky)
cartWebEnd();
gfFileCacheFree(&tFileCache);
}
void loadGeneToMotif(struct sqlConnection *conn, char *fileName, char *table,
struct hash *geneToModuleHash, struct hash *moduleAndMotifHash,
struct hash *motifHash, struct hash *positionsHash,
char *regionTable)
/* Load file which is a big matrix with genes for rows and motifs for
* columns. There is a semicolon-separated list of numbers in the matrix
* where a gene has the motif, and an empty (tab separated) field
* where there is no motif. The numbers are relative to the
* region associated with the gene in the positionsHash.
* Only load bits of this where motif actually occurs in module associated
* with gene. */
{
struct lineFile *lf = lineFileOpen(fileName, TRUE);
char *line;
FILE *f = hgCreateTabFile(tmpDir, table);
char *motifNames[32*1024], *row[32*1024];
int motifCount, rowSize, i;
char *gene, *module;
int geneCount = 0, total = 0;
struct dyString *dy = dyStringNew(512);
struct genomePos *motifPosList = NULL, *motifPosForGene;
struct genomePos *regionPosList = NULL, *regionPos;
/* Read first line, which is labels. */
if (!lineFileNextReal(lf, &line))
errAbort("Empty file %s", fileName);
subChar(line, ' ', '_');
motifCount = chopLine(line, motifNames);
if (motifCount >= ArraySize(motifNames))
errAbort("Too many motifs line 1 of %s", fileName);
lineFileExpectAtLeast(lf, 2, motifCount);
motifNames[0] = NULL;
for (i=1; i<motifCount; ++i)
{
char name[64];
motifNames[i] = cloneString(fixMotifName(motifNames[i],name,sizeof(name)));
if (!hashLookup(motifHash, motifNames[i]))
errAbort("Motif %s is in %s but not modules_motifs.gxm",
motifNames[i], fileName);
}
/* Read subsequent lines. */
while ((rowSize = lineFileChopTab(lf, row)) != 0)
{
lineFileExpectWords(lf, motifCount, rowSize);
gene = row[0];
module = hashFindVal(geneToModuleHash, gene);
if (module == NULL)
{
warn("WARNING: Gene %s in line %d of %s but not module_assignments.tab",
gene, lf->lineIx, lf->fileName);
continue;
}
regionPos = NULL;
for (i=1; i<rowSize; ++i)
{
if (row[i][0] != 0)
{
if (hashLookup2(moduleAndMotifHash, module, motifNames[i]))
{
regionPos = hashFindVal(positionsHash, gene);
if (regionPos == NULL)
{
warn("WARNING: %s in %s but not gene_positions.tab",
gene, fileName);
i = rowSize; continue;
}
motifPosForGene = convertMotifPos(row[i], regionPos,
hashMustFindVal(motifHash, motifNames[i]), lf);
motifPosList = slCat(motifPosForGene, motifPosList);
++total;
}
}
}
if (regionPos != NULL)
{
slAddHead(®ionPosList, regionPos);
}
++geneCount;
}
lineFileClose(&lf);
/* Output sorted table of all motif hits. */
{
struct genomePos *pos;
slSort(&motifPosList, genomePosCmp);
for (pos = motifPosList; pos != NULL; pos = pos->next)
{
int start = pos->start;
int end = pos->end;
if (start < 0) start = 0;
fprintf(f, "%d\t", binFromRange(start, end));
fprintf(f, "%s\t", pos->chrom);
fprintf(f, "%d\t%d\t", start, end);
fprintf(f, "%s\t", pos->motif);
fprintf(f, "%d\t", pos->score);
fprintf(f, "%c\t", pos->strand);
fprintf(f, "%s\n", pos->name);
}
dyStringPrintf(dy,
"CREATE TABLE %s (\n"
" bin smallInt unsigned not null,\n"
" chrom varChar(255) not null,\n"
" chromStart int not null,\n"
" chromEnd int not null,\n"
" name varchar(255) not null,\n"
" score int not null,\n"
" strand char(1) not null,\n"
" gene varchar(255) not null,\n"
" #Indices\n"
" INDEX(gene(12)),\n"
" INDEX(name(16)),\n"
" INDEX(chrom(8),bin)\n"
")\n", table);
sqlRemakeTable(conn, table, dy->string);
verbose(1, "%d genes, %d motifs, %d motifs in genes\n",
geneCount, motifCount-1, total);
hgLoadTabFile(conn, tmpDir, table, &f);
// hgRemoveTabFile(tmpDir, table);
verbose(1, "Loaded %s table\n", table);
slFreeList(&motifPosList);
}
/* Now output sorted table of upstream regions. */
{
FILE *f = hgCreateTabFile(tmpDir, regionTable);
struct genomePos *pos;
dyStringClear(dy);
dyStringPrintf(dy,
"CREATE TABLE %s (\n"
" bin smallInt unsigned not null,\n"
" chrom varChar(255) not null,\n"
" chromStart int not null,\n"
" chromEnd int not null,\n"
" name varchar(255) not null,\n"
" score int not null,\n"
" strand char(1) not null,\n"
" #Indices\n"
" INDEX(name(16)),\n"
" INDEX(chrom(8),bin)\n"
")\n", regionTable);
sqlRemakeTable(conn, regionTable, dy->string);
slSort(®ionPosList, genomePosCmp);
for (pos = regionPosList; pos != NULL; pos = pos->next)
{
int start = pos->start;
int end = pos->end;
if (start < 0) start = 0;
fprintf(f, "%d\t", binFromRange(start, end));
fprintf(f, "%s\t", pos->chrom);
fprintf(f, "%d\t%d\t", start, end);
fprintf(f, "%s\t", pos->name);
fprintf(f, "%d\t", pos->score);
fprintf(f, "%c\n", pos->strand);
}
hgLoadTabFile(conn, tmpDir, regionTable, &f);
// hgRemoveTabFile(tmpDir, regionTable);
}
}
void submitRefToFiles(struct sqlConnection *conn, struct sqlConnection *conn2, struct sqlConnection *connSp,
char *ref, char *fileRoot, char *inJax)
/* Create a .ra and a .tab file for given reference. */
{
/* Initially the tab file will have some duplicate lines, so
* write to temp file, and then filter. */
char raName[PATH_LEN], tabName[PATH_LEN], capName[PATH_LEN];
FILE *ra = NULL, *tab = NULL, *cap = NULL;
struct dyString *query = dyStringNew(0);
struct sqlResult *sr;
char **row;
char *pubMed;
struct slName *list, *el;
boolean gotAny = FALSE;
struct hash *uniqImageHash = newHash(0);
struct hash *captionHash = newHash(0);
int imageWidth = 0, imageHeight = 0;
char path[PATH_LEN];
struct dyString *caption = dyStringNew(0);
struct dyString *copyright = dyStringNew(0);
struct dyString *probeNotes = dyStringNew(0);
boolean lookedForCopyright = FALSE;
safef(raName, sizeof(raName), "%s.ra", fileRoot);
safef(tabName, sizeof(tabName), "%s.tab", fileRoot);
safef(capName, sizeof(capName), "%s.txt", fileRoot);
tab = mustOpen(tabName, "w");
cap = mustOpen(capName, "w");
sqlDyStringPrintf(query, "select authors,journal,title,year from BIB_Refs where ");
sqlDyStringPrintf(query, "_Refs_key = '%s'", ref);
sr = sqlGetResultVerbose(conn, query->string);
row = sqlNextRow(sr);
if (row == NULL)
errAbort("Can't find _Refs_key %s in BIB_Refs", ref);
/* Make ra file with stuff common to whole submission set. */
ra = mustOpen(raName, "w");
fprintf(ra, "submissionSource MGI\n");
fprintf(ra, "acknowledgement Thanks to the Gene Expression Database group at "
"Mouse Genome Informatics (MGI) for collecting, annotating and sharing "
"this image. The MGI images were last updated in VisiGene on March 28, 2006. "
"Additional and more up to date annotations and images may be available "
"directly at <A HREF='http://www.informatics.jax.org' target='_blank'>MGI.</A>\n");
fprintf(ra, "submitSet jax%s\n", ref);
fprintf(ra, "taxon 10090\n"); /* Mus musculus taxon */
fprintf(ra, "fullDir http://hgwdev.gi.ucsc.edu/visiGene/full/inSitu/Mouse/jax\n");
fprintf(ra, "thumbDir http://hgwdev.gi.ucsc.edu/visiGene/200/inSitu/Mouse/jax\n");
fprintf(ra, "setUrl http://www.informatics.jax.org/\n");
fprintf(ra, "itemUrl http://www.informatics.jax.org/searches/image.cgi?%%s\n");
fprintf(ra, "abUrl http://www.informatics.jax.org/searches/antibody.cgi?%%s\n");
fprintf(ra, "journal %s\n", row[1]);
fprintf(ra, "publication %s\n", row[2]);
fprintf(ra, "year %s\n", row[3]);
/* The contributor (author) list is in format Kent WJ; Haussler DH; format in
* Jackson. We convert it to Kent W.J.,Haussler D.H., format for visiGene. */
fprintf(ra, "contributor ");
list = charSepToSlNames(row[0], ';');
for (el = list; el != NULL; el = el->next)
{
char *lastName = skipLeadingSpaces(el->name);
char *initials = strrchr(lastName, ' ');
if (initials == NULL)
initials = "";
else
*initials++ = 0;
fprintf(ra, "%s", lastName);
if (initials[0] != 0)
{
char c;
fprintf(ra, " ");
while ((c = *initials++) != 0)
fprintf(ra, "%c.", c);
}
fprintf(ra, ",");
}
fprintf(ra, "\n");
slNameFreeList(&list);
sqlFreeResult(&sr);
/* Add in link to PubMed record on publication. */
dyStringClear(query);
sqlDyStringPrintf(query,
"select ACC_Accession.accID from ACC_Accession,ACC_LogicalDB "
"where ACC_Accession._Object_key = %s "
"and ACC_Accession._LogicalDB_key = ACC_LogicalDB._LogicalDB_key "
"and ACC_LogicalDB.name = 'PubMed'", ref);
pubMed = sqlQuickStringVerbose(conn, query->string);
if (pubMed != NULL)
fprintf(ra, "pubUrl https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=%s\n", pubMed);
freez(&pubMed);
dyStringClear(query);
sqlDyStringPrintf(query,
"select distinct MRK_Marker.symbol as gene,"
"GXD_Specimen.sex as sex,"
"GXD_Specimen.age as age,"
"GXD_Specimen.ageMin as ageMin,"
"GXD_Specimen.ageMax as ageMax,"
"IMG_ImagePane.paneLabel as paneLabel,"
"ACC_Accession.numericPart as fileKey,"
"IMG_Image._Image_key as imageKey,"
"GXD_Assay._ProbePrep_key as probePrepKey,"
"GXD_Assay._AntibodyPrep_key as antibodyPrepKey,"
"GXD_Assay._ReporterGene_key as reporterGeneKey,"
"GXD_FixationMethod.fixation as fixation,"
"GXD_EmbeddingMethod.embeddingMethod as embedding,"
"GXD_Assay._Assay_key as assayKey,"
"GXD_Specimen.hybridization as sliceType,"
"GXD_Specimen._Genotype_key as genotypeKey,"
"IMG_ImagePane._ImagePane_key as imagePaneKey\n"
"from MRK_Marker,"
"GXD_Assay,"
"GXD_Specimen,"
"GXD_InSituResult,"
"GXD_InSituResultImage,"
"GXD_FixationMethod,"
"GXD_EmbeddingMethod,"
"IMG_ImagePane,"
"IMG_Image,"
"ACC_Accession\n"
"where MRK_Marker._Marker_key = GXD_Assay._Marker_key "
"and GXD_Assay._Assay_key = GXD_Specimen._Assay_key "
"and GXD_Specimen._Specimen_key = GXD_InSituResult._Specimen_key "
"and GXD_InSituResult._Result_key = GXD_InSituResultImage._Result_key "
"and GXD_InSituResultImage._ImagePane_key = IMG_ImagePane._ImagePane_key "
"and GXD_FixationMethod._Fixation_key = GXD_Specimen._Fixation_key "
"and GXD_EmbeddingMethod._Embedding_key = GXD_Specimen._Embedding_key "
"and IMG_ImagePane._Image_key = IMG_Image._Image_key "
"and IMG_Image._Image_key = ACC_Accession._Object_key "
"and ACC_Accession.prefixPart = 'PIX:' "
"and GXD_Assay._ImagePane_key is NULL "
);
sqlDyStringPrintf(query, "and GXD_Assay._Refs_key = '%s'", ref);
sr = sqlGetResultVerbose(conn, query->string);
fprintf(tab, "#");
fprintf(tab, "gene\t");
fprintf(tab, "probeColor\t");
fprintf(tab, "sex\t");
fprintf(tab, "age\t");
fprintf(tab, "ageMin\t");
fprintf(tab, "ageMax\t");
fprintf(tab, "paneLabel\t");
fprintf(tab, "fileName\t");
fprintf(tab, "submitId\t");
fprintf(tab, "fPrimer\t");
fprintf(tab, "rPrimer\t");
fprintf(tab, "abName\t");
fprintf(tab, "abTaxon\t");
fprintf(tab, "abSubmitId\t");
fprintf(tab, "fixation\t");
fprintf(tab, "embedding\t");
fprintf(tab, "bodyPart\t");
fprintf(tab, "sliceType\t");
fprintf(tab, "genotype\t");
fprintf(tab, "strain\t");
fprintf(tab, "priority\t");
fprintf(tab, "captionId\t");
fprintf(tab, "imageWidth\t");
fprintf(tab, "imageHeight\n");
while ((row = sqlNextRow(sr)) != NULL)
{
char *gene = row[0];
char *sex = row[1];
char *age = row[2];
char *ageMin = row[3];
char *ageMax = row[4];
char *paneLabel = row[5];
char *fileKey = row[6];
char *imageKey = row[7];
char *probePrepKey = row[8];
char *antibodyPrepKey = row[9];
char *reporterGeneKey = row[10];
char *fixation = row[11];
char *embedding = row[12];
char *assayKey = row[13];
char *sliceType = row[14];
char *genotypeKey = row[15];
char *imagePaneKey = row[16];
double calcAge = -1;
char *probeColor = "";
char *bodyPart = "";
char *abName = NULL;
char *rPrimer = NULL, *fPrimer = NULL;
char *genotype = NULL;
char *strain = NULL;
char *priority = NULL;
char abTaxon[32];
char *captionId = "";
char *abSubmitId = NULL;
verbose(3, " "); dumpRow(row, 16);
if (age == NULL)
continue;
if (!lookedForCopyright)
{
struct sqlResult *sr = NULL;
char **row;
lookedForCopyright = TRUE;
dyStringClear(query);
sqlDyStringPrintf(query,
"select note from MGI_NoteChunk,MGI_Note,MGI_NoteType,ACC_MGIType "
"where MGI_Note._Object_key = %s "
"and ACC_MGIType.name = 'Image' "
"and ACC_MGIType._MGIType_key = MGI_Note._MGIType_key "
"and MGI_NoteType.noteType='Copyright' "
"and MGI_Note._NoteType_key = MGI_NoteType._NoteType_key "
"and MGI_Note._Note_key = MGI_NoteChunk._Note_key "
"order by sequenceNum"
, imageKey);
sr = sqlGetResultVerbose(conn2, query->string);
while ((row = sqlNextRow(sr)) != NULL)
dyStringAppend(copyright, row[0]);
sqlFreeResult(&sr);
verbose(2,"imageKey=%s\n",imageKey);
if (copyright->stringSize != 0)
{
fprintf(ra, "copyright %s\n", copyright->string);
}
}
/* Massage sex */
{
if (sameString(sex, "Male"))
sex = "male";
else if (sameString(sex, "Female"))
sex = "female";
else
sex = "";
}
/* Massage age */
{
char *embryoPat = "embryonic day ";
char *newbornPat = "postnatal newborn";
char *dayPat = "postnatal day ";
char *weekPat = "postnatal week ";
char *adultPat = "postnatal adult";
double calcMinAge = atof(ageMin);
double calcMaxAge = atof(ageMax);
double mouseBirthAge = 21.0;
//double mouseAdultAge = 63.0; /* Relative to conception, not birth */
if (age[0] == 0)
{
warn("age null, ageMin %s, ageMax %s\n", ageMin, ageMax);
calcAge = (calcMinAge + calcMaxAge) * 0.5;
}
else if (startsWith(embryoPat, age))
calcAge = atof(age+strlen(embryoPat));
else if (sameString(newbornPat, age))
calcAge = mouseBirthAge;
else if (startsWith(dayPat, age))
calcAge = atof(age+strlen(dayPat)) + mouseBirthAge;
else if (startsWith(weekPat, age))
calcAge = 7.0 * atof(age+strlen(weekPat)) + mouseBirthAge;
else if (sameString(adultPat, age) && calcMaxAge - calcMinAge > 1000
&& calcMinAge < 365)
calcAge = 365; /* Most adult mice are relatively young */
else
{
warn("Calculating age from %s", age);
calcAge = (calcMinAge + calcMaxAge) * 0.5;
}
if (calcAge < calcMinAge)
calcAge = calcMinAge;
if (calcAge > calcMaxAge)
calcAge = calcMaxAge;
}
/* Massage probeColor */
{
if (!isStrNull(reporterGeneKey))
{
/* Fixme: make sure that reporterGene's end up in probeType table. */
char *name = NULL;
dyStringClear(query);
sqlDyStringPrintf(query,
"select term from VOC_Term where _Term_key = %s",
reporterGeneKey);
name = sqlQuickStringVerbose(conn2, query->string);
if (name == NULL)
warn("Can't find _ReporterGene_key %s in VOC_Term",
reporterGeneKey);
else if (sameString(name, "GFP"))
probeColor = "green";
else if (sameString(name, "lacZ"))
probeColor = "blue";
else
warn("Don't know color of reporter gene %s", name);
freez(&name);
}
if (!isStrNull(probePrepKey))
{
char *name = NULL;
dyStringClear(query);
sqlDyStringPrintf(query,
"select GXD_VisualizationMethod.visualization "
"from GXD_VisualizationMethod,GXD_ProbePrep "
"where GXD_ProbePrep._ProbePrep_key = %s "
"and GXD_ProbePrep._Visualization_key = GXD_VisualizationMethod._Visualization_key"
, probePrepKey);
name = sqlQuickStringVerbose(conn2, query->string);
if (name == NULL)
warn("Can't find visualization from _ProbePrep_key %s", probePrepKey);
probeColor = colorFromLabel(name, gene);
freez(&name);
if (probeColor[0] == 0)
{
dyStringClear(query);
sqlDyStringPrintf(query,
"select GXD_Label.label from GXD_Label,GXD_ProbePrep "
"where GXD_ProbePrep._ProbePrep_key = %s "
"and GXD_ProbePrep._Label_key = GXD_Label._Label_key"
, probePrepKey);
name = sqlQuickStringVerbose(conn2, query->string);
if (name == NULL)
warn("Can't find label from _ProbePrep_key %s",
probePrepKey);
probeColor = colorFromLabel(name, gene);
}
freez(&name);
}
if (!isStrNull(antibodyPrepKey) && probeColor[0] == 0 )
{
char *name = NULL;
dyStringClear(query);
sqlDyStringPrintf(query,
"select GXD_Label.label from GXD_Label,GXD_AntibodyPrep "
"where GXD_AntibodyPrep._AntibodyPrep_key = %s "
"and GXD_AntibodyPrep._Label_key = GXD_Label._Label_key"
, antibodyPrepKey);
name = sqlQuickStringVerbose(conn2, query->string);
if (name == NULL)
warn("Can't find label from _AntibodyPrep_key %s", antibodyPrepKey);
probeColor = colorFromLabel(name, gene);
freez(&name);
}
}
/* Get abName, abTaxon, abSubmitId */
abTaxon[0] = 0;
if (!isStrNull(antibodyPrepKey))
{
struct sqlResult *sr = NULL;
int orgKey = 0;
char **row;
dyStringClear(query);
sqlDyStringPrintf(query,
"select antibodyName,_Organism_key,GXD_Antibody._Antibody_key "
"from GXD_AntibodyPrep,GXD_Antibody "
"where GXD_AntibodyPrep._AntibodyPrep_key = %s "
"and GXD_AntibodyPrep._Antibody_key = GXD_Antibody._Antibody_key"
, antibodyPrepKey);
sr = sqlGetResultVerbose(conn2, query->string);
row = sqlNextRow(sr);
if (row != NULL)
{
abName = cloneString(row[0]);
orgKey = atoi(row[1]);
abSubmitId = cloneString(row[2]);
}
sqlFreeResult(&sr);
if (orgKey > 0)
{
char *latinName = NULL, *commonName = NULL;
int spTaxon = 0;
dyStringClear(query);
sqlDyStringPrintf(query, "select latinName from MGI_Organism "
"where _Organism_key = %d", orgKey);
latinName = sqlQuickStringVerbose(conn2, query->string);
if (latinName != NULL
&& !sameString(latinName, "Not Specified")
&& !sameString(latinName, "Not Applicable"))
{
char *e = strchr(latinName, '/');
if (e != NULL)
*e = 0; /* Chop off / and after. */
spTaxon = spBinomialToTaxon(connSp, latinName);
}
else
{
dyStringClear(query);
sqlDyStringPrintf(query, "select commonName from MGI_Organism "
"where _Organism_key = %d", orgKey);
commonName = sqlQuickStringVerbose(conn2, query->string);
if (commonName != NULL
&& !sameString(commonName, "Not Applicable")
&& !sameString(commonName, "Not Specified"))
{
spTaxon = spCommonToTaxon(connSp, commonName);
}
}
if (spTaxon != 0)
safef(abTaxon, sizeof(abTaxon), "%d", spTaxon);
freez(&latinName);
freez(&commonName);
}
}
if (abName == NULL)
abName = cloneString("");
if (abSubmitId == NULL)
abSubmitId = cloneString("");
/* Get rPrimer, lPrimer */
if (!isStrNull(probePrepKey))
{
struct sqlResult *sr = NULL;
char **row;
dyStringClear(query);
sqlDyStringPrintf(query,
"select primer1sequence,primer2sequence "
"from PRB_Probe,GXD_ProbePrep "
"where PRB_Probe._Probe_key = GXD_ProbePrep._Probe_key "
"and GXD_ProbePrep._ProbePrep_key = %s"
, probePrepKey);
sr = sqlGetResultVerbose(conn2, query->string);
row = sqlNextRow(sr);
if (row != NULL)
{
fPrimer = cloneString(row[0]);
rPrimer = cloneString(row[1]);
}
sqlFreeResult(&sr);
}
/* Note Jackson database actually stores the primers very
* erratically. In all the cases I can find for in situs
* the primers are actually stored in free text in the PRB_Notes
* e.g. ... primers CGCGGATCCAGGGGAAACAGAAGGGCTGCG and CCCAAGCTTAGACTGTACAGGCTGAGCC ...
*/
if (fPrimer == NULL || fPrimer[0]==0)
{
struct sqlResult *sr = NULL;
char **row;
dyStringClear(query);
sqlDyStringPrintf(query,
"select PRB_Notes.note from GXD_ProbePrep, PRB_Notes"
" where GXD_ProbePrep._ProbePrep_key = %s"
" and GXD_ProbePrep._Probe_key = PRB_Notes._Probe_key"
" order by PRB_Notes.sequenceNum"
, probePrepKey);
sr = sqlGetResultVerbose(conn2, query->string);
dyStringClear(probeNotes);
while ((row = sqlNextRow(sr)) != NULL)
dyStringAppend(probeNotes, row[0]);
sqlFreeResult(&sr);
if (probeNotes->stringSize > 0)
{
char f[256];
char r[256];
int i = 0;
char *s = strstr(probeNotes->string," primers ");
if (s)
{
s += strlen(" primers ");
i = 0;
while (strchr("ACGT",*s) && (i<sizeof(f)))
f[i++] = *s++;
f[i]=0;
if (strstr(s," and ")==s)
{
s += strlen(" and ");
i = 0;
while (strchr("ACGT",*s) && (i<sizeof(r)))
r[i++] = *s++;
r[i]=0;
if (strlen(f) >= 10 && strlen(r) >= 10)
{
fPrimer = cloneString(f);
rPrimer = cloneString(r);
}
else
{
verbose(1, "bad primer parse:_ProbePrep_key=%s fPrimer=[%s], rPrimer=[%s]\n",
probePrepKey,f,r);
}
}
}
}
}
if (fPrimer == NULL)
fPrimer = cloneString("");
if (rPrimer == NULL)
rPrimer = cloneString("");
fixation = blankOutUnknown(fixation);
embedding = blankOutUnknown(embedding);
/* Massage body part and slice type. We only handle whole mounts. */
if (sameString(sliceType, "whole mount"))
{
bodyPart = "whole";
priority = "100";
}
else
{
sliceType = "";
priority = "1000";
}
genotypeAndStrainFromKey(genotypeKey, conn2, &genotype, &strain);
if (isStrNull(paneLabel))
paneLabel = cloneString(""); /* trying to suppress nulls in output */
stripChar(paneLabel, '"'); /* Get rid of a difficult quote to process. */
/* Fetch image dimensions from file. */
imageWidth=0;
imageHeight=0;
safef(path, sizeof(path), "%s/%s.jpg", inJax, fileKey);
if (fileExists(path))
jpegSize(path,&imageWidth,&imageHeight); /* will errAbort if no valid .jpeg exists */
else
warn("Picture Missing! %s ",path);
/* Deal caption if any. Most of the work only happens the
* first time see the image. */
if (!hashLookup(uniqImageHash, imageKey))
{
struct sqlResult *sr = NULL;
char **row;
hashAdd(uniqImageHash, imageKey, NULL);
dyStringClear(caption);
dyStringClear(query);
sqlDyStringPrintf(query,
"select note from MGI_NoteChunk,MGI_Note,MGI_NoteType,ACC_MGIType "
"where MGI_Note._Object_key = %s "
"and ACC_MGIType.name = 'Image' "
"and ACC_MGIType._MGIType_key = MGI_Note._MGIType_key "
"and MGI_NoteType.noteType='Caption' "
"and MGI_Note._NoteType_key = MGI_NoteType._NoteType_key "
"and MGI_Note._Note_key = MGI_NoteChunk._Note_key "
"order by sequenceNum"
, imageKey);
sr = sqlGetResultVerbose(conn2, query->string);
while ((row = sqlNextRow(sr)) != NULL)
dyStringAppend(caption, row[0]);
sqlFreeResult(&sr);
if (caption->stringSize > 0)
{
subChar(caption->string, '\t', ' ');
subChar(caption->string, '\n', ' ');
fprintf(cap, "%s\t%s\n", imageKey, caption->string);
hashAdd(captionHash, imageKey, imageKey);
}
}
if (hashLookup(captionHash, imageKey))
captionId = imageKey;
else
captionId = "";
fprintf(tab, "%s\t", gene);
fprintf(tab, "%s\t", probeColor);
fprintf(tab, "%s\t", sex);
fprintf(tab, "%3.2f\t", calcAge);
fprintf(tab, "%s\t", ageMin);
fprintf(tab, "%s\t", ageMax);
fprintf(tab, "%s\t", paneLabel); /* may have to change NULL to empty string or "0" ? */
fprintf(tab, "%s.jpg\t", fileKey);
fprintf(tab, "%s\t", imageKey);
fprintf(tab, "%s\t", fPrimer);
fprintf(tab, "%s\t", rPrimer);
fprintf(tab, "%s\t", abName);
fprintf(tab, "%s\t", abTaxon);
fprintf(tab, "%s\t", abSubmitId);
fprintf(tab, "%s\t", fixation);
fprintf(tab, "%s\t", embedding);
fprintf(tab, "%s\t", bodyPart);
fprintf(tab, "%s\t", sliceType);
fprintf(tab, "%s\t", genotype);
fprintf(tab, "%s\t", strain);
fprintf(tab, "%s\t", priority);
fprintf(tab, "%s\t", captionId);
fprintf(tab, "%d\t", imageWidth);
fprintf(tab, "%d\n", imageHeight);
printExpression(tab, conn2, imagePaneKey, assayKey);
gotAny = TRUE;
freez(&genotype);
freez(&abName);
freez(&abSubmitId);
freez(&rPrimer);
freez(&fPrimer);
}
sqlFreeResult(&sr);
carefulClose(&ra);
carefulClose(&tab);
carefulClose(&cap);
if (!gotAny)
{
remove(raName);
remove(capName);
remove(tabName);
}
dyStringFree(&probeNotes);
dyStringFree(©right);
dyStringFree(&caption);
dyStringFree(&query);
hashFree(&uniqImageHash);
hashFree(&captionHash);
}
