Example #1
0
boolean cleanTable(char *table)
/* clean a specific table */
{

struct sqlResult *sr;
char **row;
char query[256];
int *ids;
int totalRows = 0;
boolean squealed = FALSE;
time_t cleanStart = time(NULL);

verbose(1, "-------------------\n");
verbose(1, "Cleaning table %s\n", table);
verbose(1, "%s\n", ctime(&cleanStart));


totalRows = sqlTableSize(conn, table);
verbose(1,"totalRows=%d\n", totalRows);

if (totalRows==0)
    {
    verbose(1,"table %s is empty!", table);
    return FALSE;
    }

AllocArray(ids, totalRows);

// This is a super-fast query because it only needs to read the index which is cached in memory.
sqlSafef(query,sizeof(query), "select id from %s" , table);
sr = sqlGetResult(conn, query);
int i = 0;
while ((row = sqlNextRow(sr)) != NULL)
    {
    ids[i++] = sqlUnsigned(row[0]);
    if (i >= totalRows)
	break;
    }
sqlFreeResult(&sr);
totalRows = i;  // in case they differed.

int purgeRangeStart = -1;
int purgeRangeEnd = -1;
if (optionExists("purgeStart"))   // manual purge range specified
    {
    purgeStart = optionInt("purgeStart", -1);
    purgeEnd = optionInt("purgeEnd", -1);
    if (purgeStart < 1 || purgeStart > 720)
	errAbort("Invalid purgeStart");
    if (purgeEnd < 0)
	purgeEnd = 0;
    if (purgeStart < purgeEnd)
	errAbort("purgeStart should be greater than purgeEnd (in days ago)");
    purgeRangeStart = binaryIdSearch(ids, totalRows, table, purgeStart);
    purgeRangeEnd   = binaryIdSearch(ids, totalRows, table, purgeEnd);
    verbose(1, "manual purge range: purgeStart %d purgeEnd %d rangeStart %d rangeEnd %d rangeSize=%d ids[rs]=%d\n", 
                                    purgeStart,   purgeEnd, purgeRangeStart, purgeRangeEnd, purgeRangeEnd-purgeRangeStart, ids[purgeRangeStart]);
    if (!optionExists("dryRun"))
	cleanTableSection(table, ids[purgeRangeStart], ids[purgeRangeEnd]);
    }
else  // figure out purge-ranges automatically
    {

    int firstUseAge = 0;
    if (sameString(table, sessionDbTableName))
	firstUseAge = 14;
    if (sameString(table, userDbTableName))
	firstUseAge = 365;

    int day = sqlQuickNum(conn, NOSQLINJ "select dayofweek(now())");

    // These old records take a long time to go through, 5k sessionDb to 55k userDb old recs to look at,
    //  and typically produce only a few hundred deletions.
    //  they are growing slowly and expire rarely, so we don't need to scan them
    //  frequently and aggressively.  So ONLY scan them once per week by doing 1/7 per day.
    // Also don't need to worry much about the 
    //  borders of the split-over-7-days divisions shifting much because the set is so nearly static.  YAWN.
    int firstUseIndex = binaryIdSearch(ids, totalRows, table, firstUseAge);
    int oldRangeSize = (firstUseIndex - 0) / 7;
    int oldRangeStart = oldRangeSize * (day-1);
    int oldRangeEnd = oldRangeStart + oldRangeSize;
    verbose(1, "old cleaner: firstUseAge=%d firstUseIndex = %d day %d: rangeStart %d rangeEnd %d rangeSize=%d ids[oldRangeStart]=%d\n", 
        firstUseAge, firstUseIndex, day, oldRangeStart, oldRangeEnd, oldRangeEnd-oldRangeStart, ids[oldRangeStart]);
    //int oldRangeStart = 0;
    //int oldRangeEnd = firstUseIndex;
    //verbose(1, "old cleaner: firstUseAge=%d firstUseIndex = %d rangeStart %d rangeEnd %d rangeSize=%d ids[firstUseIndex]=%d\n", 
	//firstUseAge, firstUseIndex, oldRangeStart, oldRangeEnd, oldRangeEnd-oldRangeStart, ids[firstUseIndex]);

    // newly old can be expected to have some delete action
    //  these records have newly crossed the threshold into being old enough to have possibly expired.
    int newOldRangeStart = firstUseIndex;
    int newOldRangeEnd = binaryIdSearch(ids, totalRows, table, firstUseAge - 1);
    verbose(1, "newOld cleaner: firstUseAge=%d rangeStart %d rangeEnd %d rangeSize=%d ids[newOldRangeStart]=%d\n", 
	firstUseAge, newOldRangeStart, newOldRangeEnd, newOldRangeEnd-newOldRangeStart, ids[newOldRangeStart]);
   

    // this is the main delete action of cleaning out new robots (20k to 50k or more)
    int robo1RangeStart = binaryIdSearch(ids, totalRows, table, 2);
    int robo1RangeEnd   = binaryIdSearch(ids, totalRows, table, 1);
    verbose(1, "robot cleaner1: twoDayIndex = %d oneDayIndex %d rangeSize=%d ids[rs]=%d\n", 
      robo1RangeStart, robo1RangeEnd, robo1RangeEnd-robo1RangeStart, ids[robo1RangeStart]);

    int robo2RangeStart = -1;
    int robo2RangeEnd = -1;
    if (sameString(table, userDbTableName))
	{  // secondary robot cleaning only for userDb., produces a somewhat lesser, perhaps 3 to 5k deletions
	robo2RangeStart = binaryIdSearch(ids, totalRows, table, 7);
	robo2RangeEnd   = binaryIdSearch(ids, totalRows, table, 6);
	verbose(1, "robot cleaner2: sevenDayIndex = %d sixDayIndex %d rangeSize=%d ids[rs]=%d\n", 
	  robo2RangeStart, robo2RangeEnd, robo2RangeEnd-robo2RangeStart, ids[robo2RangeStart]);
	}

    /* cannot clean until we have all the ranges determined since deleting messes up binSearch */
    if (!optionExists("dryRun"))
	{
	verbose(1, "old cleaner:\n");
	cleanTableSection(table, ids[oldRangeStart], ids[oldRangeEnd]);
	}

    if (!optionExists("dryRun"))
	{
	verbose(1, "newOld cleaner:\n");
	cleanTableSection(table, ids[newOldRangeStart], ids[newOldRangeEnd]);
	}

    if (!optionExists("dryRun"))
	{
	verbose(1, "robot cleaner1:\n");
	cleanTableSection(table, ids[robo1RangeStart], ids[robo1RangeEnd]);
	}

    if (sameString(table, userDbTableName))
	{
	if (!optionExists("dryRun"))
	    {
	    verbose(1, "robot cleaner2:\n");
	    cleanTableSection(table, ids[robo2RangeStart], ids[robo2RangeEnd]);
	    }
	}

    }

/*
int found = binaryIdSearch(ids, totalRows, table, 1);
if ((found >= 0) && (found < totalRows))
    verbose(1, "1 days ago found = %d, id == ids[found] = %d \n", found, ids[found]);

found = binaryIdSearch(ids, totalRows, table, 2);
if ((found >= 0) && (found < totalRows))
    verbose(1, "2 days ago found = %d, id == ids[found] = %d \n", found, ids[found]);

found = binaryIdSearch(ids, totalRows, table, 30);
if ((found >= 0) && (found < totalRows))
    verbose(1, "30 days ago found = %d, id == ids[found] = %d \n", found, ids[found]);

*/


	    /*
	    if (daysAgoFirstUse < 14)
		{
		hitEnd = TRUE;
                break;
		}
	    */

            /*
	    if (daysAgoFirstUse < 365)
		{
		hitEnd = TRUE;
                break;
		}
            */

// may need to pass back this data from the cleanTableSection call TODO
//verbose(1, "%s: #rows count=%d  delCount=%d\n\n", table, count, delCount);

time_t cleanEnd = time(NULL);
int minutes = difftime(cleanEnd, cleanStart) / 60; 
verbose(1, "%s\n", ctime(&cleanEnd));
verbose(1, "%d minutes total\n\n", minutes);

squealed = checkMaxTableSizeExceeded(table);

return squealed;

}
void bioImageLoad(char *setRaFile, char *itemTabFile)
/* bioImageLoad - Load data into bioImage database. */
{
struct hash *raHash = raReadSingle(setRaFile);
struct hash *rowHash;
struct lineFile *lf = lineFileOpen(itemTabFile, TRUE);
char *line, *words[256];
struct sqlConnection *conn = sqlConnect(database);
int rowSize;
int submissionSetId;
struct hash *fullDirHash = newHash(0);
struct hash *screenDirHash = newHash(0);
struct hash *thumbDirHash = newHash(0);
struct hash *treatmentHash = newHash(0);
struct hash *bodyPartHash = newHash(0);
struct hash *sliceTypeHash = newHash(0);
struct hash *imageTypeHash = newHash(0);
struct hash *sectionSetHash = newHash(0);
struct dyString *dy = dyStringNew(0);

/* Read first line of tab file, and from it get all the field names. */
if (!lineFileNext(lf, &line, NULL))
    errAbort("%s appears to be empty", lf->fileName);
if (line[0] != '#')
    errAbort("First line of %s needs to start with #, and then contain field names",
    	lf->fileName);
rowHash = hashRowOffsets(line+1);
rowSize = rowHash->elCount;
if (rowSize >= ArraySize(words))
    errAbort("Too many fields in %s", lf->fileName);

/* Check that have all required fields */
    {
    char *fieldName;
    int i;

    for (i=0; i<ArraySize(requiredSetFields); ++i)
        {
	fieldName = requiredSetFields[i];
	if (!hashLookup(raHash, fieldName))
	    errAbort("Field %s is not in %s", fieldName, setRaFile);
	}

    for (i=0; i<ArraySize(requiredItemFields); ++i)
        {
	fieldName = requiredItemFields[i];
	if (!hashLookup(rowHash, fieldName))
	    errAbort("Field %s is not in %s", fieldName, itemTabFile);
	}

    for (i=0; i<ArraySize(requiredFields); ++i)
        {
	fieldName = requiredFields[i];
	if (!hashLookup(rowHash, fieldName) && !hashLookup(raHash, fieldName))
	    errAbort("Field %s is not in %s or %s", fieldName, setRaFile, itemTabFile);
	}
    }

/* Create/find submission record. */
submissionSetId = saveSubmissionSet(conn, raHash);

/* Process rest of tab file. */
while (lineFileNextRowTab(lf, words, rowSize))
    {
    int fullDir = cachedId(conn, "location", "name", 
    	fullDirHash, "fullDir", raHash, rowHash, words);
    int screenDir = cachedId(conn, "location", "name", 
    	screenDirHash, "screenDir", raHash, rowHash, words);
    int thumbDir = cachedId(conn, "location", 
    	"name", thumbDirHash, "thumbDir", raHash, rowHash, words);
    int bodyPart = cachedId(conn, "bodyPart", 
    	"name", bodyPartHash, "bodyPart", raHash, rowHash, words);
    int sliceType = cachedId(conn, "sliceType", 
    	"name", sliceTypeHash, "sliceType", raHash, rowHash, words);
    int imageType = cachedId(conn, "imageType", 
    	"name", imageTypeHash, "imageType", raHash, rowHash, words);
    int treatment = cachedId(conn, "treatment", 
    	"conditions", treatmentHash, "treatment", raHash, rowHash, words);
    char *fileName = getVal("fileName", raHash, rowHash, words, NULL);
    char *submitId = getVal("submitId", raHash, rowHash, words, NULL);
    char *taxon = getVal("taxon", raHash, rowHash, words, NULL);
    char *isEmbryo = getVal("isEmbryo", raHash, rowHash, words, NULL);
    char *age = getVal("age", raHash, rowHash, words, NULL);
    char *sectionSet = getVal("sectionSet", raHash, rowHash, words, "");
    char *sectionIx = getVal("sectionIx", raHash, rowHash, words, "0");
    char *gene = getVal("gene", raHash, rowHash, words, "");
    char *locusLink = getVal("locusLink", raHash, rowHash, words, "");
    char *refSeq = getVal("refSeq", raHash, rowHash, words, "");
    char *genbank = getVal("genbank", raHash, rowHash, words, "");
    char *priority = getVal("priority", raHash, rowHash, words, "200");
    int sectionId = 0;
    int oldId;
    // char *xzy = getVal("xzy", raHash, rowHash, words, xzy);

    if (sectionSet[0] != 0 && !sameString(sectionSet, "0"))
        {
	struct hashEl *hel = hashLookup(sectionSetHash, sectionSet);
	if (hel != NULL)
	    sectionId = ptToInt(hel->val);
	else
	    {
	    sqlUpdate(conn, "insert into sectionSet values(default)");
	    sectionId = sqlLastAutoId(conn);
	    hashAdd(sectionSetHash, sectionSet, intToPt(sectionId));
	    }
	}

    dyStringClear(dy);
    dyStringAppend(dy, "select id from image ");
    dyStringPrintf(dy, "where fileName = '%s' ", fileName);
    dyStringPrintf(dy, "and fullLocation = %d",  fullDir);
    oldId = sqlQuickNum(conn, dy->string);
    if (oldId != 0)
        {
	if (replace)
	    {
	    dyStringClear(dy);
	    dyStringPrintf(dy, "delete from image where id = %d", oldId);
	    sqlUpdate(conn, dy->string);
	    }
	else
	    errAbort("%s is already in database line %d of %s", 
	    	fileName, lf->lineIx, lf->fileName);
	}

    dyStringClear(dy);
    dyStringAppend(dy, "insert into image set\n");
    dyStringPrintf(dy, " id = default,\n");
    dyStringPrintf(dy, " fileName = '%s',\n", fileName);
    dyStringPrintf(dy, " fullLocation = %d,\n", fullDir);
    dyStringPrintf(dy, " screenLocation = %d,\n", screenDir);
    dyStringPrintf(dy, " thumbLocation = %d,\n", thumbDir);
    dyStringPrintf(dy, " submissionSet = %d,\n", submissionSetId);
    dyStringPrintf(dy, " sectionSet = %d,\n", sectionId);
    dyStringPrintf(dy, " sectionIx = %s,\n", sectionIx);
    dyStringPrintf(dy, " submitId = '%s',\n", submitId);
    dyStringPrintf(dy, " gene = '%s',\n", gene);
    dyStringPrintf(dy, " locusLink = '%s',\n", locusLink);
    dyStringPrintf(dy, " refSeq = '%s',\n", refSeq);
    dyStringPrintf(dy, " genbank = '%s',\n", genbank);
    dyStringPrintf(dy, " priority = %s,\n", priority);
    dyStringPrintf(dy, " taxon = %s,\n", taxon);
    dyStringPrintf(dy, " isEmbryo = %s,\n", isEmbryo);
    dyStringPrintf(dy, " age = %s,\n", age);
    dyStringPrintf(dy, " bodyPart = %d,\n", bodyPart);
    dyStringPrintf(dy, " sliceType = %d,\n", sliceType);
    dyStringPrintf(dy, " imageType = %d,\n", imageType);
    dyStringPrintf(dy, " treatment = %d\n", treatment);

    sqlUpdate(conn, dy->string);
    }
}
Example #3
0
void tryToDeprecate(struct sqlConnection *conn)
/* CGI variables are set - if possible deprecate, otherwise put up error message. */
{
pushWarnHandler(localWarn);
fileList = cgiString("fileList");
reason = cloneString(trimSpaces(cgiString("reason")));
if (isEmpty(reason))
   {
   warn("Please enter a reason for deprecation.");
   getFileListAndReason(conn);
   }
else
   {
   /* Go through list of accessions and make sure they are all well formed and correspond to files that exist. */
   boolean ok = TRUE;
   struct slName *accList = slNameListOfUniqueWords(cloneString(fileList), FALSE);
   struct slName *acc;
   struct slInt *idList = NULL, *idEl;
   for (acc = accList; acc != NULL; acc = acc->next)
       {
       char *licensePlate = acc->name;
       if (!startsWith(edwLicensePlatePrefix, licensePlate))
           {
	   ok = FALSE;
	   warn("%s is not an accession, doesn't start with %s", licensePlate, edwLicensePlatePrefix);
	   break;
	   }
	char query[256];
	sqlSafef(query, sizeof(query), "select fileId from edwValidFile where licensePlate='%s'", licensePlate);
	int id = sqlQuickNum(conn, query);
	if (id == 0)
	   {
	   ok = FALSE;
	   warn("%s - no such accession. ", licensePlate);
	   break;
	   }
	/* check to see is it ok tor deprecate this file */
	if (!okToDeprecateThisFile(conn, id, userEmail))
	    {
	    ok = FALSE;
	    warn("You can not deprecate %s which was originally uploaded by %s.\n",
	    licensePlate, edwFindOwnerNameFromFileId(conn, id));
	    warn("Please click the check box below to override this rule.");
	    break;
	    }

	idEl = slIntNew(id);
	slAddTail(&idList, idEl);
	}

    if (accList == NULL)
        {
	warn("Please enter some file accessions");
	ok = FALSE;
	}

    /* If a problem then put up page to try again,   otherwise do deprecation. */
    if (!ok)
        getFileListAndReason(conn);
    else
        {
	deprecateFileList(conn, idList, reason);
	printf("Deprecated %d files<BR>\n", slCount(idList));
	cgiMakeButton("submit", "Deprecate More Files");
	printf(" ");
	edwPrintLogOutButton();
	}
    }
}
static void processMrnaFa(struct sqlConnection *conn, int taxon, char *type, char *db)
/* process isPcr results  */
{

struct dyString *dy = dyStringNew(0);
struct lineFile *lf = lineFileOpen("mrna.fa", TRUE);
int lineSize;
char *line;
char *name;
char *dna;
boolean more = lineFileNext(lf, &line, &lineSize);
while(more)
    {
    if (line[0] != '>')
	errAbort("unexpected error out of phase\n");
    name = cloneString(line+1);
    verbose(2,"name=%s\n",name);
    dyStringClear(dy);
    while((more=lineFileNext(lf, &line, &lineSize)))
	{
	if (line[0] == '>')
	    {
	    break;
	    }
	dyStringAppend(dy,line);	    
	}
    dna = cloneString(dy->string);

    while(1)
	{
	int oldProbe = 0;
	dyStringClear(dy);
	dyStringPrintf(dy, "select id from vgPrb "
	   "where taxon=%d and type='%s' and tName='%s' and state='new'",taxon,type,name);
	oldProbe = sqlQuickNum(conn,dy->string);
	if (oldProbe==0)
	    break;       /* no more records match */
	    
	/* record exists and hasn't already been updated */
	
	int vgPrb = findVgPrbBySeq(conn,dna,taxon);
	
	if (vgPrb == 0)
	    {
	    dyStringClear(dy);
	    dyStringAppend(dy, "update vgPrb set");
	    dyStringAppend(dy, " seq = '");
	    dyStringAppend(dy, dna);
	    dyStringAppend(dy, "',\n");
	    dyStringPrintf(dy, " db = '%s',\n", db);
	    dyStringAppend(dy, " state = 'seq'\n");
	    dyStringPrintf(dy, " where id=%d\n", oldProbe);
	    dyStringPrintf(dy, " and state='%s'\n", "new");
	    verbose(2, "%s\n", dy->string);
	    sqlUpdate(conn, dy->string);
	    }
	else  /* probe seq already exists */ 
	    { 
	    /* just re-map the probe table recs to it */
	    dyStringClear(dy);
	    dyStringPrintf(dy, "update vgPrbMap set vgPrb=%d where vgPrb=%d",vgPrb,oldProbe);
	    sqlUpdate(conn, dy->string);
	    /* and delete it from vgPrb */
	    dyStringClear(dy);
	    dyStringPrintf(dy, "delete from vgPrb where id=%d",oldProbe);
	    sqlUpdate(conn, dy->string);
	    }
	    
	}    

    freez(&name);
    freez(&dna);
    }
lineFileClose(&lf);

dyStringFree(&dy);
}
Example #5
0
void initStep(struct sqlConnection *conn, struct stepInit *init)
/* Create step based on initializer */
{
/* Do a little validation on while counting up inputs and outputs */
int inCount = commaSepCount(init->inputTypes);
int matchCount = commaSepCount(init->inputFormats);
if (inCount != matchCount)
    errAbort("inputTypes has %d elements but inputFormats has %d in step %s", 
	    inCount, matchCount, init->name);
int outCount = commaSepCount(init->outputTypes);
matchCount = commaSepCount(init->outputFormats);
if (outCount != matchCount)
    errAbort("outputTypes has %d elements but outputFormats has %d in step %s", 
	    outCount, matchCount, init->name);
matchCount = commaSepCount(init->outputNamesInTempDir);
if (outCount != matchCount)
    errAbort("outputTypes has %d elements but outputNamesInTempDir has %d in step %s", 
	    outCount, matchCount, init->name);

struct dyString *query = dyStringNew(0);
dyStringPrintf(query, "select count(*) from eapStep where name='%s'", init->name);
int existingCount = sqlQuickNum(conn, query->string);
if (existingCount > 0)
    {
    warn("%s already exists in eapStep", init->name);
    dyStringFree(&query);
    return;
    }

/* Parse out software part and make sure that all pieces are there. */
char **softwareArray;
int softwareCount;
sqlStringDynamicArray(init->software, &softwareArray, &softwareCount);
unsigned softwareIds[softwareCount];
int i;
for (i=0; i<softwareCount; ++i)
    {
    char *name = softwareArray[i];
    dyStringClear(query);
    dyStringPrintf(query, "select id from eapSoftware where name='%s'", name);
    unsigned softwareId = sqlQuickNum(conn, query->string);
    if (softwareId == 0)
        errAbort("Software %s doesn't exist by that name in eapSoftware", name);
    softwareIds[i] = softwareId;
    }

/* Make step record. */
dyStringClear(query);
dyStringAppend(query,
	"insert eapStep (name,cpusRequested,"
        " inCount,inputTypes,inputFormats,"
	" outCount,outputNamesInTempDir,outputTypes,outputFormats)"
	" values (");
dyStringPrintf(query, "'%s',", init->name);
dyStringPrintf(query, "%d,", init->cpusRequested);
dyStringPrintf(query, "%d,", inCount);
dyStringPrintf(query, "'%s',", init->inputTypes);
dyStringPrintf(query, "'%s',", init->inputFormats);
dyStringPrintf(query, "%d,", outCount);
dyStringPrintf(query, "'%s',", init->outputNamesInTempDir);
dyStringPrintf(query, "'%s',", init->outputTypes);
dyStringPrintf(query, "'%s'", init->outputFormats);
dyStringPrintf(query, ")");
sqlUpdate(conn, query->string);

/* Make software/step associations. */
for (i=0; i<softwareCount; ++i)
    {
    dyStringClear(query);
    dyStringPrintf(query, "insert eapStepSoftware (step,software) values ('%s','%s')",
	    init->name, softwareArray[i]);
    sqlUpdate(conn, query->string);
    }

/* Force step version stuff to be made right away */
eapCurrentStepVersion(conn, init->name);

/* Clean up. */
dyStringFree(&query);
freez(&softwareArray[0]);
freez(&softwareArray);
}
Example #6
0
void txGeneAlias(char *genomeDb, char *uniProtDb, char *xrefFile, 
	char *evFile, char *oldToNew, char *aliasFile, char *protAliasFile)
/* txGeneAlias - Make kgAlias and kgProtAlias tables.. */
{
/* Read and hash oldToNew */
struct hash *newToOldHash = loadNewToOldHash(oldToNew);

/* Load evidence into hash */
struct hash *evHash = newHash(18);
struct txRnaAccs *ev, *evList = txRnaAccsLoadAll(evFile);
for (ev = evList; ev != NULL; ev = ev->next)
    hashAdd(evHash, ev->name, ev);

/* Open connections to our databases */
struct sqlConnection *gConn = sqlConnect(genomeDb);
struct sqlConnection *uConn = sqlConnect(uniProtDb);
struct sqlResult *sr;
char **row;
char query[256];

/* Open files. */
struct lineFile *lf = lineFileOpen(xrefFile, TRUE);
FILE *fAlias = mustOpen(aliasFile, "w");
FILE *fProt = mustOpen(protAliasFile, "w");

/* Stream through xref file, which has much of the info we need,
 * and which contains a line for each gene. */
char *words[KGXREF_NUM_COLS];
while (lineFileRowTab(lf, words))
    {
    /* Load the xref, and output most of it's fields as aliases. */
    struct kgXref *x = kgXrefLoad(words);
    char *id = x->kgID;
    outAlias(fAlias, id, x->kgID);
    outAlias(fAlias, id, x->mRNA);
    outAlias(fAlias, id, x->spID);
    outAlias(fAlias, id, x->spDisplayID);
    outAlias(fAlias, id, x->geneSymbol);
    outAlias(fAlias, id, x->refseq);
    outAlias(fAlias, id, x->protAcc);
    char *old = hashFindVal(newToOldHash, id);
    if (old != NULL)
        outAlias(fAlias, id, old);

    /* If we've got a uniProt ID, use that to get more info from uniProt. */
    char *acc = x->spID;
    if ((acc[0] != 0)  && (acc = spLookupPrimaryAccMaybe(uConn, acc)) != NULL)
        {
	/* Get current accession and output a bunch of easy protein aliases. */
	outProt(fProt, id, acc, acc);
	outProt(fProt, id, acc, x->spDisplayID);
	outProt(fProt, id, acc, x->geneSymbol);
	outProt(fProt, id, acc, x->protAcc);
	if (old != NULL)
	    outProt(fProt, id, acc, old);

	/* Throw in old swissProt accessions. */
	sqlSafef(query, sizeof(query), "select val from otherAcc where acc = '%s'", acc);
	sr = sqlGetResult(uConn, query);
	while ((row = sqlNextRow(sr)) != NULL)
	    {
	    outAlias(fAlias, id, row[0]);
	    outProt(fProt, id, acc, row[0]);
	    }

	/* Throw in gene names that SwissProt knows about */
	struct slName *gene, *geneList = spGenes(uConn, acc);
	for (gene = geneList; gene != NULL; gene = gene->next)
	    {
	    outAlias(fAlias, id, gene->name);
	    outProt(fProt, id, acc, gene->name);
	    }
	slFreeList(&geneList);
	}
    /* Throw in gene names from genbank. */
    /* At some point we may want to restrict this to the primary transcript in a cluster. */
    ev = hashFindVal(evHash,  id);
    if (ev != NULL)
	{
	int i;
	for (i=0; i<ev->accCount; ++i)
	    {
	    sqlSafef(query, sizeof(query), "select geneName from gbCdnaInfo where acc='%s'", acc);
	    int nameId = sqlQuickNum(gConn, query);
	    if (nameId != 0)
		{
		char name[64];
		sqlSafef(query, sizeof(query), "select name from geneName where id=%d", nameId);
		if (sqlQuickQuery(gConn, query, name, sizeof(name)))
		    outAlias(fAlias, id, name);
		}
	    }
	}

    kgXrefFree(&x);
    }

carefulClose(&fAlias);
carefulClose(&fProt);
}
Example #7
0
void cartSimNoInsert(char *host, char *user, char *password, char *database, char *milliDelayString,
	char *iterationString)
/* cartSimNoInsert - simulates N users accessing cart at regular intervals
 * where cart data is read and then written back unchanged */
{
int milliDelay = sqlUnsigned(milliDelayString);
int iterations = sqlUnsigned(iterationString);

/* Figure out size of tables. */
struct sqlConnection *conn = sqlConnectRemote(host, user, password, database);
int userDbSize = sqlQuickNum(conn, "NOSQLINJ select count(*) from userDb");
int sessionDbSize = sqlQuickNum(conn, "NOSQLINJ select count(*) from sessionDb");
int sampleSize = min(userDbSize, sessionDbSize);
int maxSampleSize = 8*1024;
sampleSize = min(sampleSize, maxSampleSize);
verbose(2, "# userDb has %d rows,  sessionDb has %d rows, sampling %d\n"
	, userDbSize, sessionDbSize, sampleSize);

/* Get sample of user id's. */
int *userIds = getSomeInts(conn, "userDb", "id", sampleSize);
int *sessionIds = getSomeInts(conn, "sessionDb", "id", sampleSize);

/* Get userCount random indexes. */
int *randomIxArray, ix;
AllocArray(randomIxArray, userCount);
verbose(2, "random user ix:\n");
for (ix=0; ix<userCount; ++ix)
    {
    randomIxArray[ix] = rand() % sampleSize;
    verbose(2, "%d ", randomIxArray[ix]);
    }
verbose(2, "\n");

sqlDisconnect(&conn);

int iteration = 0;
int querySize = 1024*1024*16;
char *query = needLargeMem(querySize);
for (;;)
    {
    for (ix = 0; ix < userCount; ++ix)
	{
	int randomIx = randomIxArray[ix];
	long startTime = clock1000();
	struct sqlConnection *conn = sqlConnectRemote(host, user, password, database);
	long connectTime = clock1000();

	sqlSafef(query, querySize, "select contents from userDb where id=%d", 
		userIds[randomIx]);
	char *userContents = sqlQuickString(conn, query);
	long userReadTime = clock1000();

	sqlSafef(query, querySize, "select contents from sessionDb where id=%d", 
		sessionIds[randomIx]);
	char *sessionContents = sqlQuickString(conn, query);
	long sessionReadTime = clock1000();

	sqlSafef(query, querySize, "update userDb set contents='%s' where id=%d",
		userContents, userIds[randomIx]);
	if (!readOnly)
	    sqlUpdate(conn, query);
	long userWriteTime = clock1000();

	sqlSafef(query, querySize, "update sessionDb set contents='%s' where id=%d",
		sessionContents, sessionIds[randomIx]);
	if (!readOnly)
	    sqlUpdate(conn, query);
	long sessionWriteTime = clock1000();

	sqlDisconnect(&conn);
	long disconnectTime = clock1000();

	printf("%ld total, %ld size, %ld connect, %ld userRead, %ld sessionRead, %ld userWrite, %ld sessionWrite\n",
		disconnectTime - startTime,
		(long) strlen(userContents) + strlen(sessionContents),
		connectTime - startTime,
		userReadTime - connectTime,
		sessionReadTime - userReadTime,
		userWriteTime - sessionReadTime,
		sessionWriteTime - userReadTime);

	freez(&userContents);
	freez(&sessionContents);

	sleep1000(milliDelay);
	if (++iteration >= iterations)
	    return;
	}
    }
}
Example #8
0
int edwFileFetch(struct sqlConnection *conn, struct edwFile *ef, int fd, 
	char *submitFileName, unsigned submitId, unsigned submitDirId, unsigned hostId)
/* Fetch file and if successful update a bunch of the fields in ef with the result. 
 * Returns fileId. */
{
ef->id = makeNewEmptyFileRecord(conn, submitId, submitDirId, ef->submitFileName, ef->size);

/* Update edwSubmit with file in transit info */
char query[256];
sqlSafef(query, sizeof(query), "update edwSubmit set fileIdInTransit=%lld where id=%u",
    (long long)ef->id, submitId);
sqlUpdate(conn, query);

sqlSafef(query, sizeof(query), "select paraFetchStreams from edwHost where id=%u", hostId);
int paraFetchStreams = sqlQuickNum(conn, query);
struct paraFetchInterruptContext interruptContext = {.conn=conn, .submitId=submitId};

/* Wrap getting the file, the actual data transfer, with an error catcher that
 * will remove partly uploaded files.  Perhaps some day we'll attempt to rescue
 * ones that are just truncated by downloading the rest,  but not now. */
struct errCatch *errCatch = errCatchNew();
char tempName[PATH_LEN] = "";
char edwFile[PATH_LEN] = "", edwPath[PATH_LEN];
if (errCatchStart(errCatch))
    {
    /* Now make temp file name and open temp file in an atomic operation */
    char *tempDir = edwTempDir();
    safef(tempName, PATH_LEN, "%sedwSubmitXXXXXX", tempDir);
    int localFd = mustMkstemp(tempName);

    /* Update file name in database with temp file name so web app can track us. */
    char query[PATH_LEN+128];
    sqlSafef(query, sizeof(query), 
	"update edwFile set edwFileName='%s' where id=%lld", 
	tempName + strlen(edwRootDir), (long long)ef->id);
    sqlUpdate(conn, query);

    /* Do actual upload tracking how long it takes. */
    ef->startUploadTime = edwNow();

    mustCloseFd(&localFd);
    if (!parallelFetchInterruptable(submitFileName, tempName, paraFetchStreams, 4, FALSE, FALSE,
	paraFetchInterruptFunction, &interruptContext))
	{
	if (interruptContext.isInterrupted)
	    errAbort("Submission stopped by user.");
	else
	    errAbort("parallel fetch of %s failed", submitFileName);
	}

    ef->endUploadTime = edwNow();

    /* Rename file both in file system and (via ef) database. */
    edwMakeFileNameAndPath(ef->id, submitFileName, edwFile, edwPath);
    mustRename(tempName, edwPath);
    if (endsWith(edwPath, ".gz") && !encode3IsGzipped(edwPath))
         errAbort("%s has .gz suffix, but is not gzipped", submitFileName);
    ef->edwFileName = cloneString(edwFile);
    }
errCatchEnd(errCatch);
if (errCatch->gotError)
    {
    /* Attempt to remove any partial file. */
    if (tempName[0] != 0)
	{
	verbose(1, "Removing partial %s\n", tempName);
	parallelFetchRemovePartial(tempName);
	remove(tempName);
	}
    handleSubmitError(conn, submitId, errCatch->message->string);  // Throws further
    assert(FALSE);  // We never get here
    }
errCatchFree(&errCatch);

/* Now we got the file.  We'll go ahead and save the file name and stuff. */
sqlSafef(query, sizeof(query),
       "update edwFile set"
       "  edwFileName='%s', startUploadTime=%lld, endUploadTime=%lld"
       "  where id = %d"
       , ef->edwFileName, ef->startUploadTime, ef->endUploadTime, ef->id);
sqlUpdate(conn, query);

/* Wrap the validations in an error catcher that will save error to file table in database */
errCatch = errCatchNew();
boolean success = FALSE;
if (errCatchStart(errCatch))
    {
    /* Check MD5 sum here.  */
    unsigned char md5bin[16];
    md5ForFile(edwPath, md5bin);
    char md5[33];
    hexBinaryString(md5bin, sizeof(md5bin), md5, sizeof(md5));
    if (!sameWord(md5, ef->md5))
        errAbort("%s has md5 mismatch: %s != %s.  File may be corrupted in upload, or file may have "
	         "been changed since validateManifest was run.  Please check that md5 of file "
		 "before upload is really %s.  If it is then try submitting again,  otherwise "
		 "rerun validateManifest and then try submitting again. \n", 
		 ef->submitFileName, ef->md5, md5, ef->md5);

    /* Finish updating a bunch more of edwFile record. Note there is a requirement in 
     * the validFile section that ef->updateTime be updated last.  A nonzero ef->updateTime
     * is used as a sign of record complete. */
    struct dyString *dy = dyStringNew(0);  /* Includes tag so query may be long */
    sqlDyStringPrintf(dy, "update edwFile set md5='%s',size=%lld,updateTime=%lld",
	    md5, ef->size, ef->updateTime);
    dyStringAppend(dy, ", tags='");
    dyStringAppend(dy, ef->tags);
    dyStringPrintf(dy, "' where id=%d", ef->id);
    sqlUpdate(conn, dy->string);
    dyStringFree(&dy);

    /* Update edwSubmit so file no longer shown as in transit */
    sqlSafef(query, sizeof(query), "update edwSubmit set fileIdInTransit=0 where id=%u", submitId);
    sqlUpdate(conn, query);

    success = TRUE;
    }
errCatchEnd(errCatch);
if (errCatch->gotError)
    {
    handleFileError(conn, submitId, ef->id, errCatch->message->string);
    }
return ef->id;
}
Example #9
0
int checkTableCoords(char *db)
/* Check several invariants (see comments in check*() above), 
 * summarize errors, return nonzero if there are errors. */
{
struct sqlConnection *conn = hAllocConn(db);
struct slName *tableList = NULL, *curTable = NULL;
struct slName *allChroms = NULL;
boolean gotError = FALSE;

allChroms = hAllChromNames(db);
if (theTable == NULL)
    tableList = getTableNames(conn);
else if (sqlTableExists(conn, theTable))
    tableList = newSlName(theTable);
else
    errAbort("Error: specified table \"%s\" does not exist in database %s.",
	     theTable, db);

for (curTable = tableList;  curTable != NULL;  curTable = curTable->next)
    {
    struct hTableInfo *hti = NULL;
    struct slName *chromList = NULL, *chromPtr = NULL;
    char *table = curTable->name;
    char tableChrom[32], trackName[128], tableChromPrefix[33];
    hParseTableName(db, table, trackName, tableChrom);
    hti = hFindTableInfo(db, tableChrom, trackName);
    if (hti != NULL && hti->isPos)
	{
	/* watch out for presence of both split and non-split tables; 
	 * hti for non-split will be replaced with hti of split. */
	if (splitAndNonSplitExist(conn, table, tableChrom))
	    continue;
	safef(tableChromPrefix, sizeof(tableChromPrefix), "%s_", tableChrom);
	if (hti->isSplit)
	    chromList = newSlName(tableChrom);
	else
	    chromList = allChroms;
	/* invariant: chrom must be described in chromInfo. */
        /* items with bad chrom will be invisible to hGetBedRange(), so 
	 * catch them here by SQL query. */
	/* The SQL query is too huge for scaffold-based db's, check count: */
	if (hChromCount(db) <= MAX_SEQS_SUPPORTED)
	    {
	    if (isNotEmpty(hti->chromField))
		{
		struct dyString *bigQuery = newDyString(1024);
		dyStringClear(bigQuery);
		sqlDyStringPrintf(bigQuery, "select count(*) from %s where ",
			       table);
		for (chromPtr=chromList; chromPtr != NULL;
		       chromPtr=chromPtr->next)
		    {
		    sqlDyStringPrintf(bigQuery, "%s != '%s' ",
				   hti->chromField, chromPtr->name);
		    if (chromPtr->next != NULL)
			dyStringAppend(bigQuery, "AND ");
		    }
		gotError |= reportErrors(BAD_CHROM, table,
					 sqlQuickNum(conn, bigQuery->string));
		dyStringFree(&bigQuery);
		}
	    for (chromPtr=chromList; chromPtr != NULL; chromPtr=chromPtr->next)
		{
		char *chrom = chromPtr->name;
		struct bed *bedList = hGetBedRange(db, table, chrom, 0, 0, NULL);
		if (hti->isSplit && isNotEmpty(hti->chromField))
		    gotError |= checkSplitTableOnlyChrom(bedList, table, hti,
							 tableChrom);
		gotError |= checkStartEnd(bedList, table, hti,
					  testChromSize(chrom));
		if (hti->hasCDS)
		    gotError |= checkCDSStartEnd(bedList, table, hti);
		if (hti->hasBlocks && !ignoreBlocks)
		    gotError |= checkBlocks(bedList, table, hti);
		bedFreeList(&bedList);
		}
	    }
	}
    }
return gotError;
}
char *getKnownGeneUrl(struct sqlConnection *conn, int geneId)
/* Given gene ID, try and find known gene on browser in same
 * species. */
{
char query[256];
int taxon;
char *url = NULL;
char *genomeDb = NULL;

/* Figure out taxon. */
safef(query, sizeof(query), 
    "select taxon from gene where id = %d", geneId);
taxon = sqlQuickNum(conn, query);

genomeDb = hDbForTaxon(conn, taxon);
if (genomeDb != NULL)
    {
    /* Make sure known genes track exists - we may need
     * to tweak this at some point for model organisms. */
    safef(query, sizeof(query), "%s.knownToVisiGene", genomeDb);
    if (!sqlTableExists(conn, query))
	genomeDb = NULL;
    }

/* If no db for that organism revert to human. */
if (genomeDb == NULL)
    genomeDb = hDefaultDb();

safef(query, sizeof(query), "%s.knownToVisiGene", genomeDb);
if (sqlTableExists(conn, query))
    {
    struct dyString *dy = dyStringNew(0);
    char *knownGene = NULL;
    if (sqlCountColumnsInTable(conn, query) == 3)
	{
	dyStringPrintf(dy, 
	   "select name from %s.knownToVisiGene where geneId = %d", genomeDb, geneId);
	}
    else
	{
	struct slName *imageList, *image;
	safef(query, sizeof(query), 
	    "select imageProbe.image from probe,imageProbe "
	    "where probe.gene=%d and imageProbe.probe=probe.id", geneId);
	imageList = sqlQuickList(conn, query);
	if (imageList != NULL)
	    {
	    dyStringPrintf(dy, 
	       "select name from %s.knownToVisiGene ", genomeDb);
	    dyStringAppend(dy,
	       "where value in(");
	    for (image = imageList; image != NULL; image = image->next)
		{
		dyStringPrintf(dy, "'%s'", image->name);
		if (image->next != NULL)
		    dyStringAppendC(dy, ',');
		}
	    dyStringAppend(dy, ")");
	    slFreeList(&imageList);
	    }
	}
    if (dy->stringSize > 0)
	{
	knownGene = sqlQuickString(conn, dy->string);
	if (knownGene != NULL)
	    {
	    dyStringClear(dy);
	    dyStringPrintf(dy, "../cgi-bin/hgGene?db=%s&hgg_gene=%s&hgg_chrom=none",
		genomeDb, knownGene);
	    url = dyStringCannibalize(&dy);
	    }
	}
    dyStringFree(&dy);
    }
freez(&genomeDb);
return url;
}
char *visiGeneHypertextGenotype(struct sqlConnection *conn, int id)
/* Return genotype of organism if any in nifty hypertext format. */
{
int genotypeId;
struct slName *geneIdList, *geneId;
char query[256];
struct dyString *html;

/* Look up genotype ID. */
safef(query, sizeof(query),
    "select specimen.genotype from image,specimen "
    "where image.id=%d and image.specimen = specimen.id", id);
genotypeId = sqlQuickNum(conn, query);
if (genotypeId == 0)
    return NULL;

/* Get list of genes involved. */
safef(query, sizeof(query),
    "select distinct allele.gene from genotypeAllele,allele "
    "where genotypeAllele.genotype=%d "
    "and genotypeAllele.allele = allele.id"
    , genotypeId);
geneIdList = sqlQuickList(conn, query);
if (geneIdList == NULL)
    return cloneString("wild type");

/* Loop through each gene adding information to html. */
html = dyStringNew(0);
for (geneId = geneIdList; geneId != NULL; geneId = geneId->next)
    {
    char *geneName;
    struct slName *alleleList, *allele;
    int alleleCount;
    boolean needsSlash = FALSE;

    /* Get gene name. */
    safef(query, sizeof(query), "select name from gene where id=%s",
        geneId->name);
    geneName = sqlQuickString(conn, query);
    if (geneName == NULL)
        internalErr();

    /* Process each allele of gene. */
    safef(query, sizeof(query), 
    	"select allele.name from genotypeAllele,allele "
	"where genotypeAllele.genotype=%d "
	"and genotypeAllele.allele = allele.id "
	"and allele.gene=%s"
	, genotypeId, geneId->name);
    alleleList = sqlQuickList(conn, query);
    alleleCount = slCount(alleleList);
    for (allele = alleleList; allele != NULL; allele = allele->next)
        {
	char *simplifiedAllele = getSimplifiedAllele(geneName, allele->name);
	int repCount = 1, rep;
	if (alleleCount == 1)
	    repCount = 2;
	for (rep = 0; rep < repCount; ++rep)
	    {
	    if (needsSlash)
	        dyStringAppendC(html, '/');
	    else
	        needsSlash = TRUE;
	    dyStringAppend(html, geneName);
	    dyStringPrintf(html, "<SUP>%s</SUP>", simplifiedAllele);
	    }
	freeMem(simplifiedAllele);
	}

    if (geneId->next != NULL)
        dyStringAppendC(html, ' ');
    slFreeList(&alleleList);
    freeMem(geneName);
    }

slFreeList(&geneIdList);
return dyStringCannibalize(&html);
}
static struct slName *getProbeList(struct sqlConnection *conn, int id)
/* Get list of probes with hyperlinks to probe info page. */
{
struct slName *returnList = NULL;
char query[256];
char *sidUrl = cartSidUrlString(cart);
struct dyString *dy = dyStringNew(0);
struct slInt *probeList = NULL, *probe;
int submissionSource = 0;

/* Make up a list of all probes in this image. */
safef(query, sizeof(query),
   "select probe from imageProbe where image=%d", id);
probeList = sqlQuickNumList(conn, query);

safef(query, sizeof(query),
   "select submissionSet.submissionSource from image, submissionSet"
   " where image.submissionSet = submissionSet.id and image.id=%d", id);
submissionSource = sqlQuickNum(conn, query);

for (probe = probeList; probe != NULL; probe = probe->next)
    {
    char *type;

    /* Create hyperlink to probe page around gene name. */
    dyStringClear(dy);
    dyStringPrintf(dy, "<A HREF=\"%s?%s&%s=%d&%s=%d\" target=_parent>",
    	hgVisiGeneCgiName(), sidUrl, hgpDoProbe, probe->val, hgpSs, submissionSource);
    safef(query, sizeof(query), 
    	"select probeType.name from probeType,probe where probe.id = %d "
	"and probe.probeType = probeType.id", 
	probe->val);
    type = sqlQuickString(conn, query);
    dyStringPrintf(dy, "%s", naForEmpty(type));
    if (sameWord(type, "antibody"))
        {
	char *abName;
	safef(query, sizeof(query), 
	   "select antibody.name from probe,antibody "
	   "where probe.id = %d and probe.antibody = antibody.id"
	   , probe->val);
	abName = sqlQuickString(conn, query);
	if (abName != NULL)
	    {
	    dyStringPrintf(dy, " %s", abName);
	    freeMem(abName);
	    }
	}
    else if (sameWord(type, "RNA"))
        {
	safef(query, sizeof(query),
	    "select length(seq) from probe where id=%d", probe->val);
	if (sqlQuickNum(conn, query) > 0)
	    dyStringPrintf(dy, " sequenced");
	else
	    {
	    safef(query, sizeof(query),
		"select length(fPrimer) from probe where id=%d", probe->val);
	    if (sqlQuickNum(conn, query) > 0)
	        dyStringPrintf(dy, " from primers");
	    }
	}
    else if (sameWord(type, "BAC"))
        {
	char *name;
	safef(query, sizeof(query), 
	   "select bac.name from probe,bac "
	   "where probe.id = %d and probe.bac = bac.id"
	   , probe->val);
	name = sqlQuickString(conn, query);
	if (name != NULL)
	    {
	    dyStringPrintf(dy, " %s", name);
	    freeMem(name);
	    }
	}
    dyStringPrintf(dy, "</A>");
    freez(&type);

    /* Add to return list. */
    slNameAddTail(&returnList, dy->string);
    }

slFreeList(&probeList);
slReverse(&returnList);
return returnList;
}
static struct slName *geneProbeList(struct sqlConnection *conn, int id)
/* Get list of gene names with hyperlinks to probe info page. */
{
struct slName *returnList = NULL;
char query[256], **row;
struct sqlResult *sr;
struct dyString *dy = dyStringNew(0);
struct probeAndColor *pcList = NULL, *pc;
int probeCount = 0;

/* Make up a list of all probes in this image. */
safef(query, sizeof(query),
   "select probe,probeColor from imageProbe where image=%d", id);
sr = sqlGetResult(conn, query);
while ((row = sqlNextRow(sr)) != NULL)
    {
    AllocVar(pc);
    pc->probe = sqlUnsigned(row[0]);
    pc->probeColor = sqlUnsigned(row[1]);
    slAddHead(&pcList, pc);
    ++probeCount;
    }
slReverse(&pcList);

for (pc = pcList; pc != NULL; pc = pc->next)
    {
    int geneId;
    char *geneName;
    int probe = pc->probe;
    char *geneUrl = NULL;

    /* Get gene ID and name. */
    safef(query, sizeof(query), 
    	"select gene from probe where id = %d", probe);
    geneId = sqlQuickNum(conn, query);
    geneName = vgGeneNameFromId(conn, geneId);
    
    /* Get url for known genes page if any. */
    geneUrl = getKnownGeneUrl(conn, geneId);

    /* Print gene name, surrounded by hyperlink to known genes
     * page if possible. */
    dyStringClear(dy);
    if (geneUrl != NULL)
	dyStringPrintf(dy, "<A HREF=\"%s\" target=_parent>",
	    geneUrl);
    dyStringPrintf(dy, "%s", geneName);
    if (geneUrl != NULL)
	dyStringAppend(dy, "</A>");
    freez(&geneName);

    /* Add color if there's more than one probe for this image. */
    if (probeCount > 1)
        {
	char *color;
	safef(query, sizeof(query), 
	    "select probeColor.name from probeColor "
	    "where probeColor.id = %d"
	    , pc->probeColor);
	color = sqlQuickString(conn, query);
	if (color != NULL)
	    dyStringPrintf(dy, " (%s)", color);
	freez(&color);
	}

    /* Add to return list. */
    slNameAddTail(&returnList, dy->string);
    }

slFreeList(&pcList);
slReverse(&returnList);
return returnList;
}
Example #14
0
static void displayMappingInfo(struct sqlConnection *conn, struct mappingInfo *mi)
/* display information from a transMap table */
{
struct ucscRetroInfo *pg = mi->pg;
double  wt[12];     /* weights on score function*/
char query[512];
char *name;
char alignTbl[128];
char scoreSql[128];
struct psl *psl;
float coverFactor = 0;
float maxOverlap = 0;
if (mi->suffix == NULL)
    {
    safef(alignTbl, sizeof(alignTbl), "%s%sAli", mi->tblPre, mi->geneSet);
    sqlSafef(scoreSql, sizeof(scoreSql), "select max(score) from %s%sInfo", mi->tblPre, mi->geneSet);
    }
else
    {
    safef(alignTbl, sizeof(alignTbl), "%s%sAli%s", mi->tblPre, mi->geneSet, mi->suffix);
    sqlSafef(scoreSql, sizeof(scoreSql), "select max(score) from %s%sInfo%s", mi->tblPre, mi->geneSet, mi->suffix);
    }
printf("<TABLE class=\"transMap\">\n");
printf("<H3>Retrogene Statistics:</H3>\n");
printf("<THEAD>\n");
printf("<TR><TH>Feature<TH>Value </TR>\n");
printf("</THEAD><TBODY>\n");
if (sameString(pg->type, "singleExon"))
    printf("<TR><TH>Type of Parent<TD>%s</tr>\n",pg->type);
else 
    printf("<TR><TH>Expression of Retrogene<TD>%s</TR>\n",pg->type);
printf("<TR><TH>Score <TD>%d (range from 0 - %d)</TR>\n",  
        pg->score,
        sqlQuickNum(conn, scoreSql) );
printf("<TR><TH>Parent Gene Alignment Coverage (Bases&nbsp;Matching Parent) <TD>%d %% &nbsp;(%d bp) </TR>\n", pg->coverage, pg->matches);
printf("<TR><TH>Introns Processed Out <TD>%d out of %d (%d exons covered)\n", pg->processedIntrons, (pg->parentSpliceCount/2), pg->exonCover);
printf("<TR><TH>Possible Introns or Gaps in Retrogene<TD>%d,%d\n", pg->intronCount, pg->alignGapCount);
printf("<TR><TH>Conserved Splice Sites<TD>%d</TR>\n",  pg->conservedSpliceSites);
printf("<TR><TH>Parent Splice Sites<TD>%d</TR>\n",  pg->parentSpliceCount);
psl = getAlignments(conn, alignTbl, mi->pg->name);
if (psl != NULL)
    {
    maxOverlap = (float)pg->maxOverlap/(float)(psl->match+psl->misMatch+psl->repMatch)  ;
    coverFactor = ((float)(psl->qSize-psl->qEnd)/(float)psl->qSize);
    }
else 
    {
    maxOverlap = 0;
    }
wt[0] = 0; wt[1] = 0.85; wt[2] = 0.2; wt[3] = 0.3; wt[4] = 0.8; 
wt[5] = 1; wt[6] = 1  ; wt[7] = 0.5; wt[8] = 0.5; wt[9] = 1; wt[10] = 1;
#ifdef debug
char table[512];
struct psl *pslList = getParentAligns(conn, mi, &table);
if (psl != NULL)
    {
    printf("<TR><TH>Blocks in retro:gap%%/intronsSpliced <TD>\n");
    printBlocks(psl, MAXBLOCKGAP, pslList);
    printf("</td></TR>\n");  
    }
if (pslList != NULL)
    {
    printf("<TR><TH>Exons in parent:gap%% <TD>\n");
    printBlocks(pslList, MAXBLOCKGAP, NULL);
    printf("</td></TR>\n");  
    pslFreeList(&pslList);
    }
#endif
printf("<TR><TH>Length of PolyA Tail<TD>%d As&nbsp;out&nbsp;of&nbsp;%d&nbsp;bp </TR><TR><TH>%% A's from Parent PolyA tail (Position)<TD>%5.1f&nbsp;%%\n",pg->polyA,pg->polyAlen, (float)pg->polyA*100/(float)pg->polyAlen);
if (pg->polyAstart < 0)
    printf("&nbsp;(%d&nbsp;bp&nbsp;before&nbsp;end&nbsp;of&nbsp;retrogene)<br>\n",-(pg->polyAstart));
else
    printf("&nbsp;(%d&nbsp;bp&nbsp;past&nbsp;end&nbsp;of&nbsp;retrogene)<br>\n",pg->polyAstart);

printf("<tr><th>mRNA Expression Evidence<td>");
if (!sameString(pg->overName, "none"))
    printf("%s&nbsp;(overlap:&nbsp;&nbsp;%d&nbsp;bp)\n", pg->overName, pg->maxOverlap);
else
    printf("No&nbsp;overlapping");
printf("<TR><TH>BESTORF Score (>50 is good)<TD>%4.0f</td></TR>\n",pg->posConf);
#ifdef score
printf("<TR><TH>score function<TD>1:xon %d %4.1f conSS %d 2: ax %4.1f 3: pA %4.1f 4: net + %4.1f max (%d, %d) 5: procIntrons %d %4.1f 6:in.cnt %d -%4.1f 7:overlap - %4.1f  8:cov %d*(qe %d- qsz %d)/%d=%4.1f 9:tRep - %4.1f 10:oldintron %d %4.1f </td></TR>\n",
                pg->exonCover,
                wt[1]*(log(pg->exonCover+1)/log(2))*200 , 
                pg->conservedSpliceSites,
                wt[2]*(((log(pg->axtScore>0?pg->axtScore:1)/log(2))*170)-1000),
                wt[3]*(log(pg->polyAlen+2)*200) ,
                wt[4]*overlapOrtholog*10 , pg->overlapMouse, pg->overlapDog,
                pg->processedIntrons,
                wt[5]*(((log(pg->processedIntrons > 0 ? pg->processedIntrons : 1))/log(2))*600) ,
                pg->intronCount, 
                wt[6]*pow(pg->intronCount,0.5)*750 ,
                wt[7]*(maxOverlap*300),
                pg->coverage, pg->qEnd, pg->qSize , pg->qSize,
                wt[8]*((pg->coverage/100.0)*(1.0-coverFactor)*300.0),
                wt[9]*(pg->tReps*10), 
                pg->alignGapCount,
                wt[10]*pg->alignGapCount);
printf("<TR><TH>score function<TD>%4.1f+ %4.1f+ %4.1f+ %4.1f+ %4.1f - %4.1f - %4.1f+ %4.1f - %4.1f - %4.1f</td></TR>\n",
                wt[1]*(log(pg->exonCover+1)/log(2))*200 , 
                wt[2]*(((log(pg->axtScore>0?pg->axtScore:1)/log(2))*170)-1000),
                wt[3]*(log(pg->polyAlen+2)*200) ,
                wt[4]*overlapOrtholog*10 , 
                wt[5]*(((log(pg->processedIntrons > 0 ? pg->processedIntrons : 1))/log(2))*600) ,
                (float)wt[6]*pow(pg->intronCount,0.5)*750 ,
                (float)wt[7]*(maxOverlap*300),
                wt[8]*((pg->coverage/100.0)*(1.0-coverFactor)*300.0),
                wt[9]*(pg->tReps*10), 
                wt[10]*pg->alignGapCount);
if (pg->kaku > 0 && pg->kaku < 1000000)
    printf("<TR><TH>KA/KU mutation rate in non-syn sites vs utr with repect to parent gene<TD>%4.2f</TR>\n",  pg->kaku);
#endif
#ifdef xxx
sqlSafef(query, sizeof(query), "select * from refGene where chrom = '%d' and txEnd > %d and txStart %d and name = '%s'", 
        pg->chrom, pg->gStart, pg->gEnd , pg->overName );
sr = sqlGetResult(conn, query);
if ((row = sqlNextRow(sr)) != NULL)
    overlappingGene = genePredLoad(row);
if (overlappingGene != NULL)
    {
    printf ("CDS exons %d ",genePredcountCdsExons(overlappingGene));
    }

#endif
printf("</tr>\n");
if ( differentString("none",pg->overName) &&
    sqlFieldIndex(conn, "refGene", "exonFrames") != -1)
    {
    sqlSafef(query, sizeof(query), 
            "select concat(exonFrames,'(',cdsStart,')') from refGene where name = '%s' and chrom = '%s'" , 
            pg->overName, pg->chrom);
    if (sqlQuickString(conn, query) != NULL)
        printf("<TR><TH>Frame of retro %s (start)<TD>%s</TR>\n",  
            pg->overName, sqlQuickString(conn, query));
    }

name = cloneString(pg->name);
chopSuffix(name);
sqlSafef(query, sizeof(query), 
        "select concat(exonFrames,'(',cdsStart,')') from rbRetroParent where name like '%s%%' and chrom = '%s'" , 
        name, pg->chrom);
if (hTableExists(database, "rbRetroParent"))
    {
    if ( sqlQuickString(conn, query) != NULL)
        printf("<TR><TH>Frames of mapped parent %s (start)<TD>%s</TR>\n",  
            name, sqlQuickString(conn, query));
    }
printf("</TBODY></TABLE>\n");
}
Example #15
0
void edwScriptSubmitStatus()
/* edwScriptSubmitStatus - Programatically check status of submission.. */
{
/* Pause a second - prevent inadvertent harsh denial of service from scripts. */
sleep(2);

edwScriptRegistryFromCgi();

/* Get submission from url. */
struct sqlConnection *conn = edwConnect();
char query[512];
char *url = cgiString("url");
struct edwSubmit *sub = edwMostRecentSubmission(conn, url);
char *status = NULL;
if (sub == NULL)
    {
    int posInQueue = edwSubmitPositionInQueue(conn, url, NULL);
    if (posInQueue == -1)
         errAbort("%s has not been submitted", url);
    else
         status = "pending";
    }
else
    {
    time_t endUploadTime = sub->endUploadTime;
    if (!isEmpty(sub->errorMessage))
        {
	status = "error";
	}
    else if (endUploadTime == 0)  
	{
	status = "uploading";
	}
    else
        {
	safef(query, sizeof(query), 
	    "select count(*) from edwFile where submitId=%u and errorMessage != ''",
	    sub->id);
	int errCount = sqlQuickNum(conn, query);
	int newValid = edwSubmitCountNewValid(sub, conn);
	if (newValid + errCount < sub->newFiles)
	    status = "validating";
	else if (errCount > 0)
	    status = "error";
	else
	    status = "success";
	}
    }

/* Construct JSON result */
struct dyString *dy = dyStringNew(0);
dyStringPrintf(dy, "{\n");
dyStringPrintf(dy, "    \"status\": \"%s\"", status);
if (sameString(status, "error"))
    {
    dyStringPrintf(dy, ",\n");
    dyStringPrintf(dy, "    \"errors\": [\n");
    int errCount = 0;
    if (!isEmpty(sub->errorMessage))
        {
	addErrFile(dy, errCount, sub->url, sub->errorMessage);
	++errCount;
	}
    safef(query, sizeof(query), "select * from edwFile where submitId=%u and errorMessage != ''",
	sub->id);
    struct edwFile *file, *fileList = edwFileLoadByQuery(conn, query);
    for (file = fileList; file != NULL; file = file->next)
        {
	addErrFile(dy, errCount, file->submitFileName, file->errorMessage);
	++errCount;
	}
    dyStringPrintf(dy, "\n    ]\n");
    dyStringPrintf(dy, "}\n");
    }
else
    {
    dyStringPrintf(dy, "\n}\n");
    }

/* Write out HTTP response */
printf("Content-Length: %d\r\n", dy->stringSize);
puts("Content-Type: application/json; charset=UTF-8\r");
puts("\r");
printf("%s", dy->string);
}
static void processIsPcr(struct sqlConnection *conn, int taxon, char *db)
/* process isPcr results  */
{

/* >NM_010919:371+1088 2 718bp CGCGGATCCAAGGACATCTTGGACCTTCCG CCCAAGCTTGCATGTGCTGCAGCGACTGCG */

struct dyString *dy = dyStringNew(0);
struct lineFile *lf = lineFileOpen("isPcr.fa", TRUE);
int lineSize;
char *line;
char *name;
char *dna;
char *word, *end;
char *tName;
int tStart;
int tEnd;
char *tStrand;
int probeid=0;  /* really a vgPrb id */
boolean more = lineFileNext(lf, &line, &lineSize);
while(more)
    {
    if (line[0] != '>')
	errAbort("unexpected error out of phase\n");
    name = cloneString(line);
    verbose(1,"name=%s\n",name);
    dyStringClear(dy);
    while((more=lineFileNext(lf, &line, &lineSize)))
	{
	if (line[0] == '>')
	    {
	    break;
	    }
	dyStringAppend(dy,line);	    
	}
    dna = cloneString(dy->string);
    word = name+1;
    end = strchr(word,':');
    tName = cloneStringZ(word,end-word); 
    word = end+1;
    end = strchr(word,'+');
    tStrand = "+";
    if (!end)
	{
	end = strchr(word,'-');
	tStrand = "-";
	}
    tStart = atoi(word); 
    word = end+1;
    end = strchr(word,' ');
    tEnd = atoi(word); 
    word = end+1;
    end = strchr(word,' ');
    probeid = atoi(word); 

    dyStringClear(dy);
    dyStringPrintf(dy, "select count(*) from vgPrb where id=%d and state='new'",probeid);
    if (sqlQuickNum(conn,dy->string)>0)
	{
	/* record exists and hasn't already been updated */

	int vgPrb = findVgPrbBySeq(conn,dna,taxon);
	
	if (vgPrb == 0)
	    {
	    dyStringClear(dy);
	    dyStringAppend(dy, "update vgPrb set");
	    dyStringAppend(dy, " seq='");
	    dyStringAppend(dy, dna);
	    dyStringAppend(dy, "',\n");
	    dyStringPrintf(dy, " tName='%s',\n", tName);
	    dyStringPrintf(dy, " tStart=%d,\n", tStart);
	    dyStringPrintf(dy, " tEnd=%d,\n", tEnd);
	    dyStringPrintf(dy, " tStrand='%s',\n", tStrand);
	    dyStringPrintf(dy, " db='%s',\n", db);
	    dyStringPrintf(dy, " state='%s'\n", "seq");
	    dyStringPrintf(dy, " where id=%d\n", probeid);
	    dyStringPrintf(dy, " and state='%s'\n", "new");
	    verbose(2, "%s\n", dy->string);
	    sqlUpdate(conn, dy->string);
	    }
	else  /* probe seq already exists */ 
	    { 
	    /* just re-map the probe table recs to it */
	    dyStringClear(dy);
	    dyStringPrintf(dy, "update vgPrbMap set vgPrb=%d where vgPrb=%d",vgPrb,probeid);
	    sqlUpdate(conn, dy->string);
	    /* and delete it from vgPrb */
	    dyStringClear(dy);
	    dyStringPrintf(dy, "delete from vgPrb where id=%d",probeid);
	    sqlUpdate(conn, dy->string);
	    }
	}
    
    freez(&tName);
    freez(&name);
    freez(&dna);
    }
lineFileClose(&lf);

dyStringFree(&dy);
}
Example #17
0
void cartSimulate(char *host, char *user, char *password, char *database)
/* Simulate action of various UCSC Genome Browser CGIs on cart. */
{
/* Figure out size of tables. */
struct sqlConnection *conn = sqlConnectRemote(host, user, password, database);
int userDbSize = sqlQuickNum(conn, "NOSQLINJ select count(*) from userDb");
if (userDbSize == 0)
    errAbort("%s.%s table is empty", database, userTable);
int maxSampleSize = 1024*1024;
int sampleSize = min(userDbSize, maxSampleSize);
verbose(2, "# userDb has %d rows, sampling %d\n"
	, userDbSize, sampleSize);

/* Get sample of user id's. */
int *userIds = getSomeInts(conn, "userDb", "id", sampleSize);

/* Get userCount random indexes. */
int *randomIxArray, ix;
AllocArray(randomIxArray, userCount);
verbose(2, "random user ix:\n");
for (ix=0; ix<userCount; ++ix)
    {
    randomIxArray[ix] = rand() % sampleSize;
    verbose(2, "%d ", randomIxArray[ix]);
    }
verbose(2, "\n");

sqlDisconnect(&conn);

int iteration = 0;
for (;;)
    {
    for (ix = 0; ix < userCount; ++ix)
	{
	int randomIx = rand()%sampleSize;
	boolean doNew = randomBitFromProb(newRatio);
	long startTime = clock1000();
	struct sqlConnection *conn = sqlConnectRemote(host, user, password, database);
	long connectTime = clock1000();
	struct dyString *contents = fakeCart(randomFakeSize());

	char *userContents = NULL;
	int userId = userIds[randomIx];
	if (doNew)
	    userId = userIds[randomIx] = dummyInsert(conn, userTable);
	int userUseCount = dummyQuery(conn, userTable, userId, &userContents);
	long userReadTime = clock1000();

	sleep1000(cgiDelay);
	long cgiSleepTime = clock1000();

	updateOne(conn, userTable, contents->string, userId, userUseCount);
	long userWriteTime = clock1000();

	sqlDisconnect(&conn);
	long disconnectTime = clock1000();

	printf("%ld total, %ld oldSize, %ld newSize, %ld connect, %ld userRead, %ld userWrite, %ld disconnect\n",
		disconnectTime - startTime - (cgiSleepTime - userReadTime),
		(long) strlen(userContents),
		(long)contents->stringSize,
		connectTime - startTime,
		userReadTime - connectTime,
		userWriteTime - cgiSleepTime,
		disconnectTime - userWriteTime );

	dyStringFree(&contents);
	freez(&userContents);

	sleep1000(hitDelay);
	if (++iteration >= iterations)
	    return;
	}
    }

errAbort("cartSimulate(%s %s %s %s) not implemented", host, user, password, database);
}
static int doBacs(struct sqlConnection *conn, int taxon, char *db)
/* fetch available sequence for bacEndPairs */
{
struct dyString *dy = dyStringNew(0);
struct dnaSeq *chromSeq = NULL;
struct bac *bacs = bacRead(conn, taxon, db);
struct bac *bac = NULL;
char *chrom = cloneString("");
int count = 0;

verbose(1,"bac list read done.\n");

for(bac=bacs;bac;bac=bac->next)
    {
    
    if (differentWord(chrom,bac->chrom))
	{
	verbose(1,"switching to chrom %s\n",bac->chrom);
	dnaSeqFree(&chromSeq); 
	chromSeq = hLoadChrom(bac->chrom,db);
	freez(&chrom);
	chrom = cloneString(bac->chrom);
	}

    char *dna = checkAndFetchBacDna(chromSeq, bac);
    if (sameString(bac->strand,"-"))
	{
	reverseComplement(dna,strlen(dna));
	}


    dyStringClear(dy);
    dyStringPrintf(dy, "select count(*) from vgPrb where id=%d and state='new'",bac->probe);
    if (sqlQuickNum(conn,dy->string)>0)
	{
	/* record exists and hasn't already been updated */

	int vgPrb = findVgPrbBySeq(conn,dna,taxon);
	
	if (vgPrb == 0)
	    {
	    dyStringClear(dy);
	    dyStringAppend(dy, "update vgPrb set");
	    dyStringAppend(dy, " seq='");
	    dyStringAppend(dy, dna);
	    dyStringAppend(dy, "',\n");
	    dyStringPrintf(dy, " tName='%s',\n", bac->chrom);
	    dyStringPrintf(dy, " tStart=%d,\n", bac->chromStart);
	    dyStringPrintf(dy, " tEnd=%d,\n", bac->chromEnd);
	    dyStringPrintf(dy, " tStrand='%s',\n", bac->strand);
	    dyStringPrintf(dy, " db='%s',\n", db);
	    dyStringPrintf(dy, " state='%s'\n", "seq");
	    dyStringPrintf(dy, " where id=%d\n", bac->probe);
	    dyStringPrintf(dy, " and state='%s'\n", "new");
	    //verbose(2, "%s\n", dy->string); // the sql string could be quite large
	    sqlUpdate(conn, dy->string);
	    }
	else  /* probe seq already exists */ 
	    { 
	    /* just re-map the probe table recs to it */
	    dyStringClear(dy);
	    dyStringPrintf(dy, "update vgPrbMap set vgPrb=%d where vgPrb=%d",vgPrb,bac->probe);
	    sqlUpdate(conn, dy->string);
	    /* and delete it from vgPrb */
	    dyStringClear(dy);
	    dyStringPrintf(dy, "delete from vgPrb where id=%d",bac->probe);
	    sqlUpdate(conn, dy->string);
	    }
	    
	++count; 
	
    
	verbose(2,"%d finished bac for probe id %d size %d\n", 
	    count, bac->probe, bac->chromEnd - bac->chromStart);
	}

    freez(&dna);
    }

freez(&chrom);
dnaSeqFree(&chromSeq);

bacFreeList(&bacs);

dyStringFree(&dy);

return count;  
}
void vgRemoveSubmission(char *database, char *submissionSetId)
/* vgRemoveSubmission - Remove submissionSet and associated images.. */
{
struct sqlConnection *conn = sqlConnect(database);
int submitId = atoi(submissionSetId);
char *submitName;
struct dyString *query = dyStringNew(0);
struct slInt *imageList = NULL, *imageProbeList = NULL;
int imageFileCount, contributorCount;

/* As a sanity check get the name of submission set and print it */
sqlDyStringPrintf(query, "select name from submissionSet where id=%d",
	submitId);
submitName = sqlQuickString(conn, query->string);
if (submitName == NULL)
    errAbort("No submissionSetId %s in %s", submissionSetId, database);
verbose(1, "Removing submissionSet named %s\n", submitName);

/* Figure out how many submissionContributors we'll delete. */
dyStringClear(query);
sqlDyStringPrintf(query, 
	"select count(*) from submissionContributor where submissionSet=%d",
	submitId);
contributorCount = sqlQuickNum(conn, query->string);

/* Actually delete submissionContributors. */
dyStringClear(query);
sqlDyStringPrintf(query, 
    "delete from submissionContributor where submissionSet=%d", submitId);
maybeUpdate(conn, query->string);
verbose(1, "Deleted %d submissionContributors\n", contributorCount);

/* Get list of images we'll delete. */
dyStringClear(query);
sqlDyStringPrintf(query, 
    "select id from image where submissionSet=%d", submitId);
imageList = sqlQuickNumList(conn, query->string);

/* Get list of imageProbes. */
if (imageList != NULL)
    {
    dyStringClear(query);
    sqlDyStringPrintf(query, 
	"select id from imageProbe where image ");
    intInClause(query, imageList);
    imageProbeList = sqlQuickNumList(conn, query->string);
    }


/* Delete expressionLevel's tied to imageProbes. */
if (imageProbeList != NULL)
    {
    int oldExpLevel = sqlQuickNum(conn, NOSQLINJ "select count(*) from expressionLevel");
    int newExpLevel;
    dyStringClear(query);
    sqlDyStringPrintf(query, 
	"delete from expressionLevel where imageProbe ");
    intInClause(query, imageProbeList);
    maybeUpdate(conn, query->string);
    newExpLevel = sqlQuickNum(conn, NOSQLINJ "select count(*) from expressionLevel");
    verbose(1, "Deleted %d expressionLevels\n", oldExpLevel - newExpLevel);
    }

/* Delete image probes. */
if (imageProbeList != NULL)
    {
    dyStringClear(query);
    sqlDyStringPrintf(query, 
	"delete from imageProbe where image ");
    intInClause(query, imageList);
    maybeUpdate(conn, query->string);
    }
verbose(1, "Deleted %d image probes.\n", slCount(imageProbeList));

/* Delete images. */
dyStringClear(query);
sqlDyStringPrintf(query, "delete from image where submissionSet=%d", submitId);
maybeUpdate(conn, query->string);
verbose(1, "Deleted %d images.\n", slCount(imageList));

/* Delete imageFiles. */
dyStringClear(query);
sqlDyStringPrintf(query, "select count(*) from imageFile where submissionSet=%d", 
	submitId);
imageFileCount = sqlQuickNum(conn, query->string);
dyStringClear(query);
sqlDyStringPrintf(query, "delete from imageFile where submissionSet=%d", 
	submitId);
maybeUpdate(conn, query->string);
verbose(1, "Deleted %d imageFile records.\n", imageFileCount);

/* Delete submissionSet record. */
dyStringClear(query);
sqlDyStringPrintf(query, "delete from submissionSet where id=%d", submitId);
maybeUpdate(conn, query->string);

dyStringFree(&query);
slFreeList(&imageList);
sqlDisconnect(&conn);
}
Example #20
0
void showCdsEvidence(char *geneName, struct trackDb *tdb, char *evTable)
/* Print out stuff from cdsEvidence table. */
{
struct sqlConnection *conn = hAllocConn(database);
double bestScore = 0;
if (sqlTableExists(conn, evTable))
    {
    webNewSection("CDS Prediction Information");
    char query[512];
    sqlSafef(query, sizeof(query), 
	    "select count(*) from %s where name='%s'", evTable, geneName);
    if (sqlQuickNum(conn, query) > 0)
	{
	sqlSafef(query, sizeof(query), 
		"select * from %s where name='%s' order by score desc", evTable, geneName);
	struct sqlResult *sr = sqlGetResult(conn, query);
	char **row;

	webPrintLinkTableStart();
	webPrintLabelCell("ORF<BR>size");
	webPrintLabelCell("start in<BR>transcript");
	webPrintLabelCell("end in<BR>transcript");
	webPrintLabelCell("source");
	webPrintLabelCell("accession");
	webPrintLabelCell("ad-hoc<BR>score");
	webPrintLabelCell("start<BR>codon");
	webPrintLabelCell("end<BR>codon");
	webPrintLabelCell("piece<BR>count");
	webPrintLabelCell("piece list");
	webPrintLabelCell("frame");
	webPrintLinkTableNewRow();

	while ((row = sqlNextRow(sr)) != NULL)
	    {
	    struct cdsEvidence *ev = cdsEvidenceLoad(row);
	    webPrintIntCell(ev->end - ev->start);
	    int i;
	    webPrintIntCell(ev->start+1);
	    webPrintIntCell(ev->end);
	    webPrintLinkCell(ev->source);
	    webPrintLinkCell(ev->accession);
	    webPrintLinkCellRightStart();
	    printf("%3.2f", ev->score);
	    bestScore = max(ev->score, bestScore);
	    webPrintLinkCellEnd();
	    webPrintLinkCell(ev->startComplete ? "yes" : "no");
	    webPrintLinkCell(ev->endComplete ? "yes" : "no");
	    webPrintIntCell(ev->cdsCount);
	    webPrintLinkCellRightStart();
	    for (i=0; i<ev->cdsCount; ++i)
		{
		int start = ev->cdsStarts[i];
		int end = start + ev->cdsSizes[i];
		printf("%d-%d ", start+1, end);
		}
	    webPrintLinkCellEnd();
	    webPrintLinkCellRightStart();
	    for (i=0; i<ev->cdsCount; ++i)
	        {
		if (i>0) printf(",");
	        printf("%d", ev->cdsStarts[i]%3 + 1);
		}
	    webPrintLinkCellEnd();
	    webPrintLinkTableNewRow();
	    }
	sqlFreeResult(&sr);
	webPrintLinkTableEnd();
	printf("This table shows CDS predictions for this transcript from a number of "
	    "sources including alignments against UniProtKB proteins, alignments against Genbank "
	    "mRNAs with CDS regions annotated by the sequence submitter, and "
	    "Victor Solovyev's bestorf program. Each prediction is assigned an ad-hoc score "
	    "score is based on several factors including the quality of "
	    "any associated alignments, the quality of the source, and the length of the "
	    "prediction.  For RefSeq transcripts with annotated CDSs the ad-hoc score "
	    "is over a million unless there are severe problems mapping the mRNA to the "
	    "genome.  In other cases the score generally ranges from 0 to 50,000. "
	    "The highest scoring prediction in this table is used to define the CDS "
	    "boundaries for this transcript.<P>If no score is 2000 or more, the transcript "
	    "is considered non-coding. In cases where the CDS is subject to "
	    "nonsense-mediated decay the CDS is removed.  The CDS is also removed "
	    "from transcripts when evidence points to it being in an artifact of an "
	    "incompletely processed transcript.  Specifically if the CDS is entirely "
	    "enclosed in the 3' UTR or an intron of a refSeq or other high quality "
	    "transcript, the CDS is removed.");
	}
    else
        {
	printf("no significant CDS prediction found, likely %s is noncoding",
		geneName);
	}
    }
hFreeConn(&conn);
}