// Parse path and create FileFilter, calls die() with msg on error
// fltr should be zero'd before call
void file_filter_open(FileFilter *fltr, const char *path)
{
const char *path_start, *path_end;
size_t path_len;
// Duplicate input string and file path
strbuf_set(&fltr->input, path);
file_filter_deconstruct_path(path, &path_start, &path_end);
path_len = path_end - path_start;
strbuf_ensure_capacity(&fltr->path, path_len);
memcpy(fltr->path.b, path_start, path_len);
fltr->path.b[fltr->path.end = path_len] = '\0';
}
// Strip indels ('-') from allele and add to string buffer
static inline void print_vcf_allele(const char *allele, size_t len,
int8_t prev_base, int8_t next_base,
StrBuf *sbuf)
{
size_t i;
if(prev_base > 0) strbuf_append_char(sbuf, char_to_vcf_char(prev_base));
strbuf_ensure_capacity(sbuf, sbuf->end+len);
for(i = 0; i < len; i++) {
if(allele[i] != '-')
sbuf->b[sbuf->end++] = char_to_vcf_char(allele[i]);
}
sbuf->b[sbuf->end] = 0;
if(next_base > 0) strbuf_append_char(sbuf, char_to_vcf_char(next_base));
}
static void branch_to_str(const dBNode *nodes, size_t len, bool print_first_kmer,
StrBuf *sbuf, const dBGraph *db_graph)
{
size_t i = print_first_kmer, kmer_size = db_graph->kmer_size;
Nucleotide nuc;
BinaryKmer bkmer;
if(print_first_kmer) {
strbuf_ensure_capacity(sbuf, sbuf->end + kmer_size);
bkmer = db_node_oriented_bkmer(db_graph, nodes[0]);
binary_kmer_to_str(bkmer, kmer_size, sbuf->b+sbuf->end);
sbuf->end += kmer_size;
}
// i == 1 if print_first_kmer, otherwise 0
strbuf_ensure_capacity(sbuf, sbuf->end + len + 1); // +1 for '\n'
for(; i < len; i++) {
nuc = db_node_get_last_nuc(nodes[i], db_graph);
sbuf->b[sbuf->end++] = dna_nuc_to_char(nuc);
}
sbuf->b[sbuf->end++] = '\n';
sbuf->b[sbuf->end] = '\0';
}
static void _check_alleles(GraphCache *cache, GCacheStepPtrBuf *steps,
const char **alleles, size_t num_alleles,
dBNodeBuffer *nbuf, StrBuf *sbuf)
{
TASSERT2(steps->len == num_alleles, "Number of alleles doesn't match");
size_t i, j;
for(i = 0; i < steps->len; i++)
{
db_node_buf_reset(nbuf);
gc_step_fetch_nodes(cache, steps->b[i], nbuf);
strbuf_ensure_capacity(sbuf, nbuf->len+MAX_KMER_SIZE+1);
db_nodes_to_str(nbuf->b, nbuf->len, cache->db_graph, sbuf->b);
// Find this node
for(j = 0; j < num_alleles && strcasecmp(sbuf->b,alleles[j]); j++) {}
TASSERT2(j < num_alleles, "Couldn't find allele: %s", sbuf->b);
}
}
void test_graph_crawler()
{
test_status("Testing graph crawler...");
// Construct 1 colour graph with kmer-size=11
dBGraph graph;
const size_t kmer_size = 11, ncols = 3;
db_graph_alloc(&graph, kmer_size, ncols, 1, 2048,
DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL | DBG_ALLOC_BKTLOCKS);
char graphseq[3][77] =
// < X X X...............
{"GTTCCAGAGCGGAGGTCTCCCAACAACATGGTATAAGTTGTCTAGCCCCGGTTCGCGCGGGTACTTCTTACAGCGC",
"GTTCCAGAGCGGAGGTCTCCCAACAACTTGGTATAAGTTGTCTAGTCCCGGTTCGCGCGGCATTTCAGCATTGTTA",
"GTTCCAGAGCGCGACAGAGTGCATATCACGCTAAGCACAGCCCTCTTCTATCTGCTTTTAAATGGATCAATAATCG"};
build_graph_from_str_mt(&graph, 0, graphseq[0], strlen(graphseq[0]));
build_graph_from_str_mt(&graph, 1, graphseq[1], strlen(graphseq[1]));
build_graph_from_str_mt(&graph, 2, graphseq[2], strlen(graphseq[2]));
// Crawl graph
GraphCrawler crawler;
graph_crawler_alloc(&crawler, &graph);
dBNode node = db_graph_find_str(&graph, graphseq[0]);
dBNode next_node = db_graph_find_str(&graph, graphseq[0]+1);
TASSERT(node.key != HASH_NOT_FOUND);
TASSERT(next_node.key != HASH_NOT_FOUND);
BinaryKmer bkey = db_node_get_bkmer(&graph, node.key);
Edges edges = db_node_get_edges(&graph, node.key, 0);
dBNode next_nodes[4];
Nucleotide next_nucs[4];
size_t i, p, num_next, next_idx;
num_next = db_graph_next_nodes(&graph, bkey, node.orient, edges,
next_nodes, next_nucs);
next_idx = 0;
while(next_idx < num_next && !db_nodes_are_equal(next_nodes[next_idx],next_node))
next_idx++;
TASSERT(next_idx < num_next && db_nodes_are_equal(next_nodes[next_idx],next_node));
// Crawl in all colours
graph_crawler_fetch(&crawler, node, next_nodes, next_idx, num_next,
NULL, graph.num_of_cols, NULL, NULL, NULL);
TASSERT2(crawler.num_paths == 2, "crawler.num_paths: %u", crawler.num_paths);
// Fetch paths
dBNodeBuffer nbuf;
db_node_buf_alloc(&nbuf, 16);
StrBuf sbuf;
strbuf_alloc(&sbuf, 128);
for(p = 0; p < crawler.num_paths; p++) {
db_node_buf_reset(&nbuf);
graph_crawler_get_path_nodes(&crawler, p, &nbuf);
strbuf_ensure_capacity(&sbuf, nbuf.len+graph.kmer_size);
sbuf.end = db_nodes_to_str(nbuf.b, nbuf.len, &graph, sbuf.b);
for(i = 0; i < 3 && strcmp(graphseq[i]+1,sbuf.b) != 0; i++) {}
TASSERT2(i < 3, "seq: %s", sbuf.b);
TASSERT2(sbuf.end == 75, "sbuf.end: %zu", sbuf.end);
TASSERT2(nbuf.len == 65, "nbuf.len: %zu", nbuf.len);
}
strbuf_dealloc(&sbuf);
db_node_buf_dealloc(&nbuf);
graph_crawler_dealloc(&crawler);
db_graph_dealloc(&graph);
}
/**
* Print paths to a string buffer. Paths are sorted before being written.
*
* @param hkey All paths associated with hkey are written to the buffer
* @param sbuf paths are written this string buffer
* @param subset is a temp variable that is reused each time
* @param nbuf temporary buffer, if not NULL, used to add seq=... to output
* @param jposbuf temporary buffer, if not NULL, used to add juncpos=... to output
*/
void gpath_save_sbuf(hkey_t hkey, StrBuf *sbuf, GPathSubset *subset,
dBNodeBuffer *nbuf, SizeBuffer *jposbuf,
const dBGraph *db_graph)
{
ctx_assert(db_graph->num_of_cols == 1 || nbuf == NULL);
ctx_assert(db_graph->num_of_cols == 1 || jposbuf == NULL);
const GPathStore *gpstore = &db_graph->gpstore;
const GPathSet *gpset = &gpstore->gpset;
const size_t ncols = gpstore->gpset.ncols;
GPath *first_gpath = gpath_store_fetch(gpstore, hkey);
const GPath *gpath;
size_t i, j, col;
// Load and sort paths for given kmer
gpath_subset_reset(subset);
gpath_subset_load_llist(subset, first_gpath);
gpath_subset_sort(subset);
if(subset->list.len == 0) return;
// Print "<kmer> <npaths>"
BinaryKmer bkmer = db_graph->ht.table[hkey];
char bkstr[MAX_KMER_SIZE+1];
binary_kmer_to_str(bkmer, db_graph->kmer_size, bkstr);
// strbuf_sprintf(sbuf, "%s %zu\n", bkstr, subset->list.len);
strbuf_append_strn(sbuf, bkstr, db_graph->kmer_size);
strbuf_append_char(sbuf, ' ');
strbuf_append_ulong(sbuf, subset->list.len);
strbuf_append_char(sbuf, '\n');
char orchar[2] = {0};
orchar[FORWARD] = 'F';
orchar[REVERSE] = 'R';
const uint8_t *nseenptr;
for(i = 0; i < subset->list.len; i++)
{
gpath = subset->list.b[i];
nseenptr = gpath_set_get_nseen(gpset, gpath);
// strbuf_sprintf(sbuf, "%c %zu %u %u", orchar[gpath->orient], klen,
// gpath->num_juncs, (uint32_t)nseenptr[0]);
strbuf_append_char(sbuf, orchar[gpath->orient]);
strbuf_append_char(sbuf, ' ');
strbuf_append_ulong(sbuf, gpath->num_juncs);
strbuf_append_char(sbuf, ' ');
strbuf_append_ulong(sbuf, nseenptr[0]);
for(col = 1; col < ncols; col++) {
// strbuf_sprintf(sbuf, ",%u", (uint32_t)nseenptr[col]);
strbuf_append_char(sbuf, ',');
strbuf_append_ulong(sbuf, nseenptr[col]);
}
strbuf_append_char(sbuf, ' ');
strbuf_ensure_capacity(sbuf, sbuf->end + gpath->num_juncs + 2);
binary_seq_to_str(gpath->seq, gpath->num_juncs, sbuf->b+sbuf->end);
sbuf->end += gpath->num_juncs;
if(nbuf)
{
// Trace this path through the graph
// First, find a colour this path is in
for(col = 0; col < ncols && !gpath_has_colour(gpath, ncols, col); col++) {}
if(col == ncols) die("path is not in any colours");
dBNode node = {.key = hkey, .orient = gpath->orient};
db_node_buf_reset(nbuf);
if(jposbuf) size_buf_reset(jposbuf); // indices of junctions in nbuf
gpath_fetch(node, gpath, nbuf, jposbuf, col, db_graph);
strbuf_append_str(sbuf, " seq=");
strbuf_ensure_capacity(sbuf, sbuf->end + db_graph->kmer_size + nbuf->len);
sbuf->end += db_nodes_to_str(nbuf->b, nbuf->len, db_graph,
sbuf->b+sbuf->end);
if(jposbuf) {
strbuf_append_str(sbuf, " juncpos=");
strbuf_append_ulong(sbuf, jposbuf->b[0]);
for(j = 1; j < jposbuf->len; j++) {
strbuf_append_char(sbuf, ',');
strbuf_append_ulong(sbuf, jposbuf->b[j]);
}
}
}
strbuf_append_char(sbuf, '\n');
}
}
// @subset is a temp variable that is reused each time
// @sbuf is a temp variable that is reused each time
static inline int _gpath_gzsave_node(hkey_t hkey,
StrBuf *sbuf, GPathSubset *subset,
dBNodeBuffer *nbuf, SizeBuffer *jposbuf,
gzFile gzout, pthread_mutex_t *outlock,
const dBGraph *db_graph)
{
gpath_save_sbuf(hkey, sbuf, subset, nbuf, jposbuf, db_graph);
if(sbuf->end > DEFAULT_IO_BUFSIZE)
_gpath_save_flush(gzout, sbuf, outlock);
return 0; // => keep iterating
}
