/* regurgitate_one_stockholm_entry()
* Read and output an alignment line-by-line without parsing it, stopping when
* we reach the end-of-alignment marker.
*/
static void
regurgitate_one_stockholm_entry(FILE *ofp, ESLX_MSAFILE *afp)
{
char *p;
esl_pos_t n;
int status;
while ( (status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK)
{
fwrite(p, sizeof(char), n, ofp);
fputs("\n", ofp);
if (esl_memstrpfx(p, n, "//")) break;
}
if (status == eslEOF) esl_fatal("Reached end of file before finding // termination line for alignment");
else if (status != eslOK) esl_fatal("Failure in reading alignment line by line");
}
/* regurgitate_pfam_as_afa()
*
* Given an open Pfam formatted msafile, read the next alignment and
* regurgitate it in aligned FASTA (AFA) format without storing
* it in a esl_msa data structure.
*
* We need to do two passes through the file because in Pfam
* sequence accessions (#=GS <seqname> AC) and sequence descriptions
* (#=GS <seqname> DE) appear altogether before any aligned sequence
* data, while in AFA they appear on the same line as the sequence
* name (accession, then description).
*
* Example:
* # STOCKHOLM 1.0
* #=GS tRNA1 AC RF00005-1
* #=GS tRNA2 AC RF00005-2
* #=GS tRNA1 DE first tRNA
* #=GS tRNA2 DE second tRNA
*
* tRNA1 GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
* tRNA2 UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CCGGGGUUCGACUCCCCGUAUCGGAG
*
* converts to AFA:
* >tRNA1 RF00005-1 first tRNA
* GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAU
* CCACAGAAUUCGCA
* >tRNA2 RF00005-2 second tRNA
* UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CCGGGGUUCGAC
* UCCCCGUAUCGGAG
*
* In the first pass, output the sequence names and accessions we find
* as '#=GS <seqname> AC' lines in the Pfam alignment to an accession
* tmpfile, and output sequence names and descriptions we find as
* as '#=GS <seqname> DE' lines in the Pfam alignment to a description
* tmpfile.
*
* In the second pass, rewind all (up to 3) files: <ac_tmpfile>,
* <de_tmpfile> and the Pfam alignment file and start reading them
* again. As we're reading them, output the accessions, descriptions
* and aligned sequence data in the proper order to an aligned FASTA
* file.
*
* Set <ret_reached_eof> as TRUE if the alignment read and reformatted
* appears to be the only one remaining in afp. Set <ret_reached_eof>
* as FALSE if afp appears to include at least one more alignment.
*
* Returns void. Dies upon any input error.
*/
static void
regurgitate_pfam_as_afa(ESLX_MSAFILE *afp, FILE *ofp, char *alifile, char *gapsym, int force_lower, int force_upper, int force_rna, int force_dna, int iupac_to_n, int x_is_bad, char *rename, char *rfrom, char *rto, int *ret_reached_eof)
{
char *p = NULL;
esl_pos_t n = 0;
esl_pos_t gslen, seqnamelen, taglen;
char *seqname = NULL;
char *first_seqname = NULL;
char *tag = NULL;
char *gs = NULL;
int nseq_read = 0;
int reached_eof;
/* variables related to reading accessions */
char ac_tmpfile[16] = "esltmpXXXXXX";
FILE *ac_fp = NULL; /* file ptr for accession tmpfile */
char *ac_buf = NULL; /* buffer for line input w/ sre_fgets() */
int ac_buflen = 0; /* current allocated length for buf */
char *ac_s = NULL;
char *ac_seqname = NULL;
char *ac = NULL;
int have_ac = FALSE;
/* variables related to reading descriptions */
char de_tmpfile[16] = "esltmpXXXXXX";
FILE *de_fp = NULL; /* file ptr for description tmpfile */
char *de_buf = NULL; /* buffer for line input w/ sre_fgets() */
int de_buflen = 0; /* current allocated length for buf */
char *de_s = NULL;
char *de_seqname = NULL;
char *de = NULL;
int have_de = FALSE;
/* variables related to printing out sequences */
char *aseq = NULL;
esl_pos_t aseqlen = 0;
int64_t apos;
char aseqbuf[61];
int cpl = 60; /* number of residues per afa seq line */
int acpl; /* actual number of character per line */
int status;
afp->errmsg[0] = '\0';
/**************************************************************************************************
* First pass, go through each line of the Pfam file and output all GS DE and AC annotation to tmpfiles
**************************************************************************************************/
/* Check the magic Stockholm header line, allowing blank lines */
do {
status = eslx_msafile_GetLine(afp, &p, &n);
if (status == eslEOF) return;
else if (status != eslOK) esl_fatal("small mem parse error. problem reading line %d of msafile", (int) afp->linenumber);
} while (esl_memspn(afp->line, afp->n, " \t") == afp->n || /* skip blank lines */
(esl_memstrpfx(afp->line, afp->n, "#") /* and skip comment lines */
&& ! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM"))); /* but stop on Stockholm header */
if (! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM 1.")) esl_fatal("small mem parse failed (line %d): missing \"# STOCKHOLM\" header", (int) afp->linenumber);
while ((status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK)
{
while (n && ( *p == ' ' || *p == '\t')) { p++; n--; } /* skip leading whitespace */
if (esl_memstrpfx(p, n, "#=GS"))
{ /* only lines we need to check are AC and DE lines, we don't even check other lines for validity */
if (esl_memtok(&p, &n, " \t", &gs, &gslen) != eslOK) esl_fatal("small mem parse failed (line %d) in a way that can't happen", (int) afp->linenumber);
if (esl_memtok(&p, &n, " \t", &seqname, &seqnamelen) != eslOK) esl_fatal("small mem parse failed (line %d): #=GS line missing <seqname>, <tag>, annotation", (int) afp->linenumber);
if (esl_memtok(&p, &n, " \t", &tag, &taglen) != eslOK) esl_fatal("small mem parse failed (line %d): #=GS line missing <tag>, annotation", (int) afp->linenumber);
if (! esl_memstrcmp(gs, gslen, "#=GS")) esl_fatal("small mem parse failed (line %d): faux #=GS line?", (int) afp->linenumber);
if (esl_memstrcmp(tag, taglen, "AC"))
{
if (! ac_fp && esl_tmpfile(ac_tmpfile, &ac_fp) != eslOK) esl_fatal("small mem parse failed, unable to open accession tmpfile");
fprintf(ac_fp, "%.*s %.*s\n", (int) seqnamelen, seqname, (int) n, p);
}
if (esl_memstrcmp(tag, taglen, "DE"))
{
if (! de_fp && esl_tmpfile(de_tmpfile, &de_fp) != eslOK) esl_fatal("small mem parse failed, unable to open description tmpfile");
fprintf(de_fp, "%.*s %.*s\n", (int) seqnamelen, seqname, (int) n, p);
}
}
else if (esl_memstrpfx(p, n, "//")) break;
}
if (status == eslEOF) esl_fatal("small mem parse failed (line %d): missing // terminator", (int) afp->linenumber);
else if (status != eslOK) esl_fatal("small mem parse failed (line %d) with code %d", (int) afp->linenumber, status);
/* The regurgitate_*() functions are limited, and only deal with single-record Pfam files.
* If there appears to be more data in the file, drop the reached_eof flag.
*/
while ((status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK)
{
while (n && ( *p == ' ' || *p == '\t')) { p++; n--; } /* skip leading whitespace */
if (esl_memstrpfx(p, n, "# STOCKHOLM 1.")) break;
if (n && ! esl_memstrpfx(p, n, "#")) esl_fatal("small mem parse failed (line %d): unexpected data", (int) afp->linenumber);
}
if (status == eslOK) reached_eof = FALSE;
else if (status == eslEOF) reached_eof = TRUE;
else esl_fatal("--small parse error. problem reading line %d of msafile", (int) afp->linenumber);
/*****************************************************************
* Pass 1 complete; rewind (close/reopen) all files
*****************************************************************/
eslx_msafile_Close(afp);
if ((status = eslx_msafile_Open(NULL, alifile, NULL, eslMSAFILE_PFAM, NULL, &afp)) != eslOK)
esl_fatal("--small, second pass, unable to open file %s for reading", alifile);
if (ac_fp) { /* open the tmpfile with the seq accessions */
rewind(ac_fp);
if((status = esl_fgets(&(ac_buf), &(ac_buflen), ac_fp)) != eslOK) esl_fatal("--small accession tmpfile parse failed");
ac_s = ac_buf;
if (esl_strtok_adv(&ac_s, " \t\n\r", &ac_seqname, NULL, NULL) != eslOK) esl_fatal("--small accession tmpfile parse failed");
if (esl_strtok_adv(&ac_s, "\n\r", &ac, NULL, NULL) != eslOK) esl_fatal("--small accession tmpfile parse failed");
}
if (de_fp) { /* open the tmpfile with the seq descriptions */
rewind(de_fp);
if((status = esl_fgets(&(de_buf), &(de_buflen), de_fp)) != eslOK) esl_fatal("--small description tmpfile parse failed");
de_s = de_buf;
if (esl_strtok_adv(&de_s, " \t\n\r", &de_seqname, NULL, NULL) != eslOK) esl_fatal("--small description tmpfile parse failed");
if (esl_strtok_adv(&de_s, "\n\r", &de, NULL, NULL) != eslOK) esl_fatal("--small description tmpfile parse failed");
}
/******************************************************************************************
* Pass 2, step through files, outputting appropriately
******************************************************************************************/
do {
status = eslx_msafile_GetLine(afp, &p, &n);
if (status == eslEOF) return;
else if (status != eslOK) esl_fatal("small mem parse pass 2 error. problem reading line %d of msafile", (int) afp->linenumber);
} while (esl_memspn(afp->line, afp->n, " \t") == afp->n || /* skip blank lines */
(esl_memstrpfx(afp->line, afp->n, "#") /* and skip comment lines */
&& ! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM"))); /* but stop on Stockholm header */
if (! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM 1.")) esl_fatal("small mem parse pass 2 failed (line %d): missing \"# STOCKHOLM\" header", (int) afp->linenumber);
while ((status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK)
{
while (n && ( *p == ' ' || *p == '\t')) { p++; n--; } /* skip leading whitespace */
if (!n || *p == '#') continue; /* skip blank lines, comments */
else if (esl_memstrpfx(p, n, "//")) break; /* end of alignment: end of record */
else
{ /* sequence line. parse line into temporary strings */
if (esl_memtok(&p, &n, " \t", &seqname, &seqnamelen) != eslOK) esl_fatal("small mem parse pass 2 failed (line %d): no seq name", (int) afp->linenumber);
if (esl_memtok(&p, &n, " \t", &aseq, &aseqlen) != eslOK) esl_fatal("small mem parse pass 2 failed (line %d): no aseq", (int) afp->linenumber);
/* make sure we haven't just read a second line of the first sequence in file (we must be in Pfam 1 line/seq file) */
if (nseq_read == 0) { if ((status = esl_memstrdup(seqname, seqnamelen, &(first_seqname))) != eslOK) esl_fatal("small mem parse failed: unable to copy seqname"); }
else if (esl_memstrcmp(seqname, seqnamelen, first_seqname)) esl_fatal("--small parse pass 2 failed (line %d): two seqs named %s. Alignment appears to be in interleaved Stockholm (not Pfam) format.", (int) afp->linenumber, seqname);
nseq_read++;
/* determine if we have an accession and/or description for this sequence */
have_de = have_ac = FALSE;
if (ac_seqname && (esl_memstrcmp(seqname, seqnamelen, ac_seqname))) have_ac = TRUE;
if (de_seqname && (esl_memstrcmp(seqname, seqnamelen, de_seqname))) have_de = TRUE;
if (rename) fprintf(ofp, ">%s.%d%s%s%s%s\n", rename, nseq_read, (have_ac ? " " : "") , (have_ac ? ac : ""), (have_de ? " " : "") , (have_de ? de : ""));
else fprintf(ofp, ">%.*s%s%s%s%s\n", (int) seqnamelen, seqname, (have_ac ? " " : "") , (have_ac ? ac : ""), (have_de ? " " : "") , (have_de ? de : ""));
/* load next ac, de */
if (have_ac) {
status = esl_fgets(&(ac_buf), &(ac_buflen), ac_fp);
if (status == eslEOF) ac_seqname = NULL;
else if (status == eslOK) {
ac_s = ac_buf;
if (esl_strtok_adv(&ac_s, " \t\n\r", &ac_seqname, NULL, NULL) != eslOK) esl_fatal("--small accession tmpfile parse failed");
if (esl_strtok_adv(&ac_s, "\n\r", &ac, NULL, NULL) != eslOK) esl_fatal("--small accession tmpfile parse failed");
}
}
if (have_de) {
status = esl_fgets(&(de_buf), &(de_buflen), de_fp);
if(status == eslEOF) de_seqname = NULL;
else if (status == eslOK) {
de_s = de_buf;
if (esl_strtok_adv(&de_s, " \t\n\r", &de_seqname, NULL, NULL) != eslOK) esl_fatal("--small description tmpfile parse failed");
if (esl_strtok_adv(&de_s, "\n\r", &de, NULL, NULL) != eslOK) esl_fatal("--small description tmpfile parse failed");
}
}
/* now print sequence, after converting symbols as nec */
/* remember, aseq itself is part of an ESL_BUFFER and you
can't write to it, so symconverts have to be on the
copy */
for (apos = 0; apos < aseqlen; apos += cpl)
{
acpl = (aseqlen - apos > cpl ? cpl : aseqlen - apos);
strncpy(aseqbuf, aseq + apos, acpl);
aseqbuf[acpl] = '\0';
if (rfrom) symconvert(aseqbuf, rfrom, rto);
if (gapsym) symconvert(aseqbuf, "-_.", gapsym);
if (force_lower) symconvert(aseqbuf,
"ABCDEFGHIJKLMNOPQRSTUVWXYZ",
"abcdefghijklmnopqrstuvwxyz");
if (force_upper) symconvert(aseqbuf,
"abcdefghijklmnopqrstuvwxyz",
"ABCDEFGHIJKLMNOPQRSTUVWXYZ");
if (force_rna) symconvert(aseqbuf, "Tt", "Uu");
if (force_dna) symconvert(aseqbuf, "Uu", "Tt");
if (iupac_to_n) symconvert(aseqbuf,
"RYMKSWHBVDrymkswhbvd",
"NNNNNNNNNNnnnnnnnnnn");
if (x_is_bad) symconvert(aseqbuf, "Xx", "Nn");
fprintf(ofp, "%s\n", aseqbuf);
}
}
}
/* If we saw a normal // end, we would've successfully read a line,
* so when we get here, status (from the line read) should be eslOK.
*/
if (status != eslOK) esl_fatal("--small parse pass 2 failed (line %d): didn't find // at end of alignment", (int) afp->linenumber);
if (ac_seqname) esl_fatal("--small parse pass 2 failed, sequence %s with #=GS AC line does not exist in alignment or is in different order.", ac_seqname);
if (de_seqname) esl_fatal("--small parse pass 2 failed, sequence %s with #=GS DE line does not exist in alignment or is in different order.", de_seqname);
if (ac_fp) fclose(ac_fp);
if (de_fp) fclose(de_fp);
eslx_msafile_Close(afp);
if (first_seqname) free(first_seqname);
if (ac_buf) free(ac_buf);
if (de_buf) free(de_buf);
*ret_reached_eof = reached_eof;
return;
}
/* regurgitate_pfam_as_pfam()
*
* Given an open Pfam formatted msafile, read the next alignment and
* regurgitate it, after modifying it as necessary (change dna to rna,
* wussify SS, etc) in Pfam format.
*
* Returns <eslOK> on success.
* Returns <eslEOF> if there are no more alignments in <afp>.
* Returns <eslEFORMAT> if parse fails because of a file format
* problem, in which case afp->errmsg is set to contain a formatted
* message that indicates the cause of the problem.
*/
static int
regurgitate_pfam_as_pfam(ESLX_MSAFILE *afp, FILE *ofp, char *gapsym, int force_lower, int force_upper, int force_rna, int force_dna, int iupac_to_n, int x_is_bad, int wussify, int dewuss, int fullwuss, char *rfrom, char *rto)
{
char *p;
esl_pos_t n;
char *first_seqname = NULL;
char *gx = NULL;
char *seqname = NULL;
char *tag = NULL;
char *text = NULL;
esl_pos_t gxlen, namelen, taglen, textlen;
int nseq_read = 0;
int parse_gc_and_gr;
int flushpoint = 10000;
int exp_alen = -1;
char *buf = NULL;
esl_pos_t pos, pos2;
int status;
parse_gc_and_gr = (wussify || dewuss || fullwuss) ? TRUE : FALSE; /* should we parse out GR/GC lines and check if they're SS lines? */
afp->errmsg[0] = '\0';
/* Check the magic Stockholm header line.
* We have to skip blank lines here, else we perceive
* trailing blank lines in a file as a format error when
* reading in multi-record mode.
*/
/* Check the magic Stockholm header line, allowing blank lines */
do {
status = eslx_msafile_GetLine(afp, &p, &n);
if (status == eslEOF) return eslEOF;
else if (status != eslOK) esl_fatal("small mem parse error. problem reading line %d of msafile", (int) afp->linenumber);
fprintf(ofp, "%.*s\n", (int) afp->n, afp->line);
} while (esl_memspn(afp->line, afp->n, " \t") == afp->n || /* skip blank lines */
(esl_memstrpfx(afp->line, afp->n, "#") /* and skip comment lines */
&& ! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM"))); /* but stop on Stockholm header */
if (! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM 1.")) esl_fatal("small mem parse failed (line %d): missing \"# STOCKHOLM\" header", (int) afp->linenumber);
/* Read the alignment file one line at a time. */
while ((status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK)
{
if ((int) afp->linenumber % flushpoint == 0) fflush(ofp);
while (n && ( *p == ' ' || *p == '\t')) { p++; n--; } /* skip leading whitespace */
if (!n) fprintf(ofp, "\n");
else if (esl_memstrpfx(p, n, "//")) { fprintf(ofp, "//\n"); break; } /* normal way out */
else if (*p == '#')
{
if (parse_gc_and_gr && esl_memstrpfx(p, n, "#=GC"))
{ /* parse line into temporary strings */
if (esl_memtok(&p, &n, " \t", &gx, &gxlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad #=GC line", (int) afp->linenumber);
if (esl_memtok(&p, &n, " \t", &tag, &taglen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad #=GC line", (int) afp->linenumber);
if (esl_memtok(&p, &n, " \t", &text, &textlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad #=GC line", (int) afp->linenumber);
pos = text - afp->line; /* pos: position of first aligned char on line; total width of annotation tag w/spaces */
/* verify alignment length */
if (exp_alen == -1) exp_alen = textlen;
else if (exp_alen != textlen) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad #=GC line, len %d, expected %d", (int) afp->linenumber, (int) textlen, (int) exp_alen);
/* we need to make a writable string copy of the annotation, to edit it */
ESL_REALLOC(buf, sizeof(char) * (textlen+1));
esl_memstrcpy(text, textlen, buf);
if (esl_memstrcmp(tag, taglen, "SS_cons"))
{
if (wussify) esl_kh2wuss(buf, buf);
else if (dewuss) esl_wuss2kh(buf, buf);
else if (fullwuss)
{
status = esl_wuss_full(buf, buf);
if (status == eslESYNTAX) esl_fatal("Bad SS_cons line: not in WUSS format, alifile line: %d", (int) afp->linenumber);
else if (status != eslOK) esl_fatal("Conversion of SS_cons line failed, code %d, alifile line: %d", status, (int) afp->linenumber);
}
}
fprintf(ofp, "#=GC %.*s%*s%s\n", (int) taglen, tag, (int) (pos-taglen-5), "", buf);
}
else if (parse_gc_and_gr && esl_memstrpfx(p, n, "#=GR") == 0)
{
/* parse line into temporary strings */
if (esl_memtok(&p, &n, " \t", &gx, &gxlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad #=GR line", (int) afp->linenumber);
if (esl_memtok(&p, &n, " \t", &seqname, &namelen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad #=GR line", (int) afp->linenumber);
if (esl_memtok(&p, &n, " \t", &tag, &taglen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad #=GR line", (int) afp->linenumber);
pos = tag - afp->line;
if (esl_memtok(&p, &n, " \t", &text, &textlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad #=GR line", (int) afp->linenumber);
pos2 = text - afp->line;
/* we need to make a writable string copy of the annotation, to edit it */
ESL_REALLOC(buf, sizeof(char) * (textlen+1));
esl_memstrcpy(text, textlen, buf);
/* verify alignment length */
if (exp_alen == -1) exp_alen = textlen;
else if (exp_alen != textlen) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad seq line, len %d, expected %d", (int) afp->linenumber, (int) textlen, (int) exp_alen);
if (esl_memstrcmp(tag, taglen, "SS") == 0)
{
if (wussify) esl_kh2wuss(buf, buf);
else if (dewuss) esl_wuss2kh(buf, buf);
else if (fullwuss) {
status = esl_wuss_full(buf, buf);
if (status == eslESYNTAX) esl_fatal("Bad SS line: not in WUSS format, alifile line: %d", (int) afp->linenumber);
else if (status != eslOK) esl_fatal("Conversion of SS line failed, code %d, alifile line: %d", status, (int) afp->linenumber);
}
}
fprintf(ofp, "#=GR %.*s%*s%.*s%*s%s\n", (int) namelen, seqname, (int) (pos-namelen-5), "", (int) taglen, tag, (int) (pos2-pos-taglen), "", buf);
}
else { /* '#' prefixed line that is not #=GR (or it is #=GR and wussify,dewuss,fullwuss are all FALSE) */
fprintf(ofp, "%.*s\n", (int) afp->n, afp->line); /* print the line */
}
} /* end of 'if (*s == '#')' */
else
{ /* sequence line */
if (esl_memtok(&p, &n, " \t", &seqname, &namelen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad sequence line", (int) afp->linenumber);
if (esl_memtok(&p, &n, " \t", &text, &textlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad sequence line", (int) afp->linenumber);
pos = text - afp->line;
/* verify alignment length */
if (exp_alen == -1) exp_alen = textlen;
else if(exp_alen != textlen) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad seq line, len %d, expected %d", (int) afp->linenumber, (int) textlen, (int) exp_alen);
/* make sure we haven't just read a second line of the first sequence in file (we must be in Pfam 1 line/seq file) */
if (nseq_read == 0) { if ((status = esl_memstrdup(seqname, namelen, &(first_seqname))) != eslOK) goto ERROR; }
else if (esl_memstrcmp(seqname, namelen, first_seqname)) { ESL_XFAIL(eslEFORMAT, afp->errmsg, "parse failed (line %d): two seqs named %s. Alignment appears to be in Stockholm format. Reformat to Pfam with esl-reformat.", (int) afp->linenumber, seqname); }
nseq_read++;
/* we need to make a writable string copy of the annotation, to edit it */
ESL_REALLOC(buf, sizeof(char) * (textlen+1));
esl_memstrcpy(text, textlen, buf);
/* make adjustments as necessary */
if (rfrom) symconvert(buf, rfrom, rto);
if (gapsym) symconvert(buf, "-_.", gapsym);
if (force_lower) symconvert(buf,
"ABCDEFGHIJKLMNOPQRSTUVWXYZ",
"abcdefghijklmnopqrstuvwxyz");
if (force_upper) symconvert(buf,
"abcdefghijklmnopqrstuvwxyz",
"ABCDEFGHIJKLMNOPQRSTUVWXYZ");
if (force_rna) symconvert(buf, "Tt", "Uu");
if (force_dna) symconvert(buf, "Uu", "Tt");
if (iupac_to_n) symconvert(buf,
"RYMKSWHBVDrymkswhbvd",
"NNNNNNNNNNnnnnnnnnnn");
if (x_is_bad) symconvert(buf, "Xx", "Nn");
/* print it out */
fprintf(ofp, "%.*s%*s%s\n", (int) namelen, seqname, (int) (pos-namelen), "", buf);
}
}
/* If we saw a normal // end, we would've successfully read a line,
* so when we get here, status (from the line read) should be eslOK.
*/
if (status != eslOK) esl_fatal("--small parse failed (line %d): didn't find // at end of alignment", (int) afp->linenumber);
if (first_seqname) free(first_seqname);
if (buf) free(buf);
return eslOK;
ERROR:
return status;
}
/* Function: esl_msafile_psiblast_Read()
* Synopsis: Read an alignment in PSI-BLAST's input format.
*
* Purpose: Read an MSA from an open <ESLX_MSAFILE> <afp>, parsing for
* PSI-BLAST input format, starting from the current point.
* Create a new multiple alignment, and return a ptr to
* that alignment via <*ret_msa>. Caller is responsible for
* free'ing this <ESL_MSA>.
*
* The <msa> has a reference line (<msa->rf[]>) that
* corresponds to the uppercase/lowercase columns in the
* alignment: consensus (uppercase) columns are marked 'x',
* and insert (lowercase) columns are marked '.' in this RF
* line.
*
* Args: afp - open <ESL_MSAFILE>
* ret_msa - RETURN: newly parsed <ESL_MSA>
*
* Returns: <eslOK> on success. <*ret_msa> contains the newly
* allocated MSA. <afp> is at EOF.
*
* <eslEOF> if no (more) alignment data are found in
* <afp>, and <afp> is returned at EOF.
*
* <eslEFORMAT> on a parse error. <*ret_msa> is set to
* <NULL>. <afp> contains information sufficient for
* constructing useful diagnostic output:
* | <afp->errmsg> | user-directed error message |
* | <afp->linenumber> | line # where error was detected |
* | <afp->line> | offending line (not NUL-term) |
* | <afp->n> | length of offending line |
* | <afp->bf->filename> | name of the file |
* and <afp> is poised at the start of the following line,
* so (in principle) the caller could try to resume
* parsing.
*
* Throws: <eslEMEM> on allocation error.
* <eslESYS> if a system call fails, such as fread().
* <eslEINCONCEIVABLE> - "impossible" corruption
* On these, <*ret_msa> is returned <NULL>, and the state of
* <afp> is undefined.
*/
int
esl_msafile_psiblast_Read(ESLX_MSAFILE *afp, ESL_MSA **ret_msa)
{
ESL_MSA *msa = NULL;
int idx = 0; /* counter over sequences in a block */
int nblocks = 0; /* counter over blocks */
int64_t alen = 0;
int nseq = 0;
int64_t cur_alen;
esl_pos_t pos; /* position on a line */
esl_pos_t name_start, name_len;
esl_pos_t seq_start, seq_len;
esl_pos_t block_seq_start, block_seq_len;
int status;
ESL_DASSERT1( (afp->format == eslMSAFILE_PSIBLAST) );
afp->errmsg[0] = '\0';
/* allocate a growable MSA. We set msa->{nseq,alen} only when we're done. */
#ifdef eslAUGMENT_ALPHABET
if (afp->abc && (msa = esl_msa_CreateDigital(afp->abc, 16, -1)) == NULL) { status = eslEMEM; goto ERROR; }
#endif
if (! afp->abc && (msa = esl_msa_Create( 16, -1)) == NULL) { status = eslEMEM; goto ERROR; }
/* skip leading blank lines in file */
while ( (status = eslx_msafile_GetLine(afp, NULL, NULL)) == eslOK && esl_memspn(afp->line, afp->n, " \t") == afp->n) ;
if (status != eslOK) goto ERROR; /* includes normal EOF */
/* Read the file a line at a time; if a parsing error occurs, detect immediately, with afp->linenumber set correctly */
do { /* while in the file... */
idx = 0;
do { /* while in a block... */
for (pos = 0; pos < afp->n; pos++) if (! isspace(afp->line[pos])) break; name_start = pos;
for (pos = pos+1; pos < afp->n; pos++) if ( isspace(afp->line[pos])) break; name_len = pos - name_start;
for (pos = pos+1; pos < afp->n; pos++) if (! isspace(afp->line[pos])) break; seq_start = pos;
if (pos >= afp->n) ESL_XFAIL(eslEFORMAT, afp->errmsg, "invalid alignment line");
for (pos = afp->n-1; pos > 0; pos--) if (! isspace(afp->line[pos])) break; seq_len = pos - seq_start + 1;
if (idx == 0) {
block_seq_start = seq_start;
block_seq_len = seq_len;
} else {
if (seq_start != block_seq_start) ESL_XFAIL(eslEFORMAT, afp->errmsg, "sequence start is misaligned");
if (seq_len != block_seq_len) ESL_XFAIL(eslEFORMAT, afp->errmsg, "sequence end is misaligned");
}
/* Process the consensus #=RF line. */
if (idx == 0) {
ESL_REALLOC(msa->rf, sizeof(char) * (alen + seq_len + 1));
for (pos = 0; pos < seq_len; pos++) msa->rf[alen+pos] = '-'; /* anything neutral other than . or x will do. */
msa->rf[alen+pos] = '\0';
}
for (pos = 0; pos < seq_len; pos++)
{
if (afp->line[seq_start+pos] == '-') continue;
if (isupper(afp->line[seq_start+pos])) {
if (msa->rf[alen+pos] == '.') ESL_XFAIL(eslEFORMAT, afp->errmsg, "unexpected upper case residue (#%d on line)", (int) pos+1);
msa->rf[alen+pos] = 'x';
}
if (islower(afp->line[seq_start+pos])) {
if (msa->rf[alen+pos] == 'x') ESL_XFAIL(eslEFORMAT, afp->errmsg, "unexpected lower case residue (#%d on line)", (int) pos+1);
msa->rf[alen+pos] = '.';
}
}
/* Store the sequence name. */
if (nblocks == 0) {
/* make sure we have room for another sequence */
if (idx >= msa->sqalloc && (status = esl_msa_Expand(msa)) != eslOK) goto ERROR;
if ( (status = esl_msa_SetSeqName(msa, idx, afp->line+name_start, name_len)) != eslOK) goto ERROR;
} else {
if (! esl_memstrcmp(afp->line+name_start, name_len, msa->sqname[idx]))
ESL_XFAIL(eslEFORMAT, afp->errmsg, "expected sequence %s on this line, but saw %.*s", msa->sqname[idx], (int) name_len, afp->line+name_start);
}
/* Append the sequence. */
cur_alen = alen;
#ifdef eslAUGMENT_ALPHABET
if (msa->abc) { status = esl_abc_dsqcat(afp->inmap, &(msa->ax[idx]), &(cur_alen), afp->line+seq_start, seq_len); }
#endif
if (! msa->abc) { status = esl_strmapcat (afp->inmap, &(msa->aseq[idx]), &(cur_alen), afp->line+seq_start, seq_len); }
if (status == eslEINVAL) ESL_XFAIL(eslEFORMAT, afp->errmsg, "one or more invalid sequence characters");
else if (status != eslOK) goto ERROR;
if (cur_alen - alen != seq_len) ESL_XFAIL(eslEFORMAT, afp->errmsg, "unexpected number of seq characters");
/* get next line. if it's blank, or if we're EOF, we're done with the block */
idx++;
status = eslx_msafile_GetLine(afp, NULL, NULL);
} while (status == eslOK && esl_memspn(afp->line, afp->n, " \t") < afp->n); /* blank line ends a block. */
if (status != eslOK && status != eslEOF) goto ERROR;
/* End of one block */
if (nblocks == 0) nseq = idx;
else if (idx != nseq) ESL_XFAIL(eslEFORMAT, afp->errmsg, "last block didn't contain same # of seqs as earlier blocks");
alen += block_seq_len;
nblocks++;
/* skip blank lines to start of next block, if any */
while ( (status = eslx_msafile_GetLine(afp, NULL, NULL)) == eslOK && esl_memspn(afp->line, afp->n, " \t") == afp->n) ;
} while (status == eslOK);
if (status != eslEOF) goto ERROR;
msa->nseq = nseq;
msa->alen = alen;
if (( status = esl_msa_SetDefaultWeights(msa)) != eslOK) goto ERROR;
*ret_msa = msa;
return eslOK;
ERROR:
if (msa) esl_msa_Destroy(msa);
*ret_msa = NULL;
return status;
}
