/* regurgitate_one_stockholm_entry() * Read and output an alignment line-by-line without parsing it, stopping when * we reach the end-of-alignment marker. */ static void regurgitate_one_stockholm_entry(FILE *ofp, ESLX_MSAFILE *afp) { char *p; esl_pos_t n; int status; while ( (status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK) { fwrite(p, sizeof(char), n, ofp); fputs("\n", ofp); if (esl_memstrpfx(p, n, "//")) break; } if (status == eslEOF) esl_fatal("Reached end of file before finding // termination line for alignment"); else if (status != eslOK) esl_fatal("Failure in reading alignment line by line"); }
/* regurgitate_pfam_as_afa() * * Given an open Pfam formatted msafile, read the next alignment and * regurgitate it in aligned FASTA (AFA) format without storing * it in a esl_msa data structure. * * We need to do two passes through the file because in Pfam * sequence accessions (#=GS <seqname> AC) and sequence descriptions * (#=GS <seqname> DE) appear altogether before any aligned sequence * data, while in AFA they appear on the same line as the sequence * name (accession, then description). * * Example: * # STOCKHOLM 1.0 * #=GS tRNA1 AC RF00005-1 * #=GS tRNA2 AC RF00005-2 * #=GS tRNA1 DE first tRNA * #=GS tRNA2 DE second tRNA * * tRNA1 GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA * tRNA2 UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CCGGGGUUCGACUCCCCGUAUCGGAG * * converts to AFA: * >tRNA1 RF00005-1 first tRNA * GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAU * CCACAGAAUUCGCA * >tRNA2 RF00005-2 second tRNA * UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CCGGGGUUCGAC * UCCCCGUAUCGGAG * * In the first pass, output the sequence names and accessions we find * as '#=GS <seqname> AC' lines in the Pfam alignment to an accession * tmpfile, and output sequence names and descriptions we find as * as '#=GS <seqname> DE' lines in the Pfam alignment to a description * tmpfile. * * In the second pass, rewind all (up to 3) files: <ac_tmpfile>, * <de_tmpfile> and the Pfam alignment file and start reading them * again. As we're reading them, output the accessions, descriptions * and aligned sequence data in the proper order to an aligned FASTA * file. * * Set <ret_reached_eof> as TRUE if the alignment read and reformatted * appears to be the only one remaining in afp. Set <ret_reached_eof> * as FALSE if afp appears to include at least one more alignment. * * Returns void. Dies upon any input error. */ static void regurgitate_pfam_as_afa(ESLX_MSAFILE *afp, FILE *ofp, char *alifile, char *gapsym, int force_lower, int force_upper, int force_rna, int force_dna, int iupac_to_n, int x_is_bad, char *rename, char *rfrom, char *rto, int *ret_reached_eof) { char *p = NULL; esl_pos_t n = 0; esl_pos_t gslen, seqnamelen, taglen; char *seqname = NULL; char *first_seqname = NULL; char *tag = NULL; char *gs = NULL; int nseq_read = 0; int reached_eof; /* variables related to reading accessions */ char ac_tmpfile[16] = "esltmpXXXXXX"; FILE *ac_fp = NULL; /* file ptr for accession tmpfile */ char *ac_buf = NULL; /* buffer for line input w/ sre_fgets() */ int ac_buflen = 0; /* current allocated length for buf */ char *ac_s = NULL; char *ac_seqname = NULL; char *ac = NULL; int have_ac = FALSE; /* variables related to reading descriptions */ char de_tmpfile[16] = "esltmpXXXXXX"; FILE *de_fp = NULL; /* file ptr for description tmpfile */ char *de_buf = NULL; /* buffer for line input w/ sre_fgets() */ int de_buflen = 0; /* current allocated length for buf */ char *de_s = NULL; char *de_seqname = NULL; char *de = NULL; int have_de = FALSE; /* variables related to printing out sequences */ char *aseq = NULL; esl_pos_t aseqlen = 0; int64_t apos; char aseqbuf[61]; int cpl = 60; /* number of residues per afa seq line */ int acpl; /* actual number of character per line */ int status; afp->errmsg[0] = '\0'; /************************************************************************************************** * First pass, go through each line of the Pfam file and output all GS DE and AC annotation to tmpfiles **************************************************************************************************/ /* Check the magic Stockholm header line, allowing blank lines */ do { status = eslx_msafile_GetLine(afp, &p, &n); if (status == eslEOF) return; else if (status != eslOK) esl_fatal("small mem parse error. problem reading line %d of msafile", (int) afp->linenumber); } while (esl_memspn(afp->line, afp->n, " \t") == afp->n || /* skip blank lines */ (esl_memstrpfx(afp->line, afp->n, "#") /* and skip comment lines */ && ! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM"))); /* but stop on Stockholm header */ if (! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM 1.")) esl_fatal("small mem parse failed (line %d): missing \"# STOCKHOLM\" header", (int) afp->linenumber); while ((status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK) { while (n && ( *p == ' ' || *p == '\t')) { p++; n--; } /* skip leading whitespace */ if (esl_memstrpfx(p, n, "#=GS")) { /* only lines we need to check are AC and DE lines, we don't even check other lines for validity */ if (esl_memtok(&p, &n, " \t", &gs, &gslen) != eslOK) esl_fatal("small mem parse failed (line %d) in a way that can't happen", (int) afp->linenumber); if (esl_memtok(&p, &n, " \t", &seqname, &seqnamelen) != eslOK) esl_fatal("small mem parse failed (line %d): #=GS line missing <seqname>, <tag>, annotation", (int) afp->linenumber); if (esl_memtok(&p, &n, " \t", &tag, &taglen) != eslOK) esl_fatal("small mem parse failed (line %d): #=GS line missing <tag>, annotation", (int) afp->linenumber); if (! esl_memstrcmp(gs, gslen, "#=GS")) esl_fatal("small mem parse failed (line %d): faux #=GS line?", (int) afp->linenumber); if (esl_memstrcmp(tag, taglen, "AC")) { if (! ac_fp && esl_tmpfile(ac_tmpfile, &ac_fp) != eslOK) esl_fatal("small mem parse failed, unable to open accession tmpfile"); fprintf(ac_fp, "%.*s %.*s\n", (int) seqnamelen, seqname, (int) n, p); } if (esl_memstrcmp(tag, taglen, "DE")) { if (! de_fp && esl_tmpfile(de_tmpfile, &de_fp) != eslOK) esl_fatal("small mem parse failed, unable to open description tmpfile"); fprintf(de_fp, "%.*s %.*s\n", (int) seqnamelen, seqname, (int) n, p); } } else if (esl_memstrpfx(p, n, "//")) break; } if (status == eslEOF) esl_fatal("small mem parse failed (line %d): missing // terminator", (int) afp->linenumber); else if (status != eslOK) esl_fatal("small mem parse failed (line %d) with code %d", (int) afp->linenumber, status); /* The regurgitate_*() functions are limited, and only deal with single-record Pfam files. * If there appears to be more data in the file, drop the reached_eof flag. */ while ((status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK) { while (n && ( *p == ' ' || *p == '\t')) { p++; n--; } /* skip leading whitespace */ if (esl_memstrpfx(p, n, "# STOCKHOLM 1.")) break; if (n && ! esl_memstrpfx(p, n, "#")) esl_fatal("small mem parse failed (line %d): unexpected data", (int) afp->linenumber); } if (status == eslOK) reached_eof = FALSE; else if (status == eslEOF) reached_eof = TRUE; else esl_fatal("--small parse error. problem reading line %d of msafile", (int) afp->linenumber); /***************************************************************** * Pass 1 complete; rewind (close/reopen) all files *****************************************************************/ eslx_msafile_Close(afp); if ((status = eslx_msafile_Open(NULL, alifile, NULL, eslMSAFILE_PFAM, NULL, &afp)) != eslOK) esl_fatal("--small, second pass, unable to open file %s for reading", alifile); if (ac_fp) { /* open the tmpfile with the seq accessions */ rewind(ac_fp); if((status = esl_fgets(&(ac_buf), &(ac_buflen), ac_fp)) != eslOK) esl_fatal("--small accession tmpfile parse failed"); ac_s = ac_buf; if (esl_strtok_adv(&ac_s, " \t\n\r", &ac_seqname, NULL, NULL) != eslOK) esl_fatal("--small accession tmpfile parse failed"); if (esl_strtok_adv(&ac_s, "\n\r", &ac, NULL, NULL) != eslOK) esl_fatal("--small accession tmpfile parse failed"); } if (de_fp) { /* open the tmpfile with the seq descriptions */ rewind(de_fp); if((status = esl_fgets(&(de_buf), &(de_buflen), de_fp)) != eslOK) esl_fatal("--small description tmpfile parse failed"); de_s = de_buf; if (esl_strtok_adv(&de_s, " \t\n\r", &de_seqname, NULL, NULL) != eslOK) esl_fatal("--small description tmpfile parse failed"); if (esl_strtok_adv(&de_s, "\n\r", &de, NULL, NULL) != eslOK) esl_fatal("--small description tmpfile parse failed"); } /****************************************************************************************** * Pass 2, step through files, outputting appropriately ******************************************************************************************/ do { status = eslx_msafile_GetLine(afp, &p, &n); if (status == eslEOF) return; else if (status != eslOK) esl_fatal("small mem parse pass 2 error. problem reading line %d of msafile", (int) afp->linenumber); } while (esl_memspn(afp->line, afp->n, " \t") == afp->n || /* skip blank lines */ (esl_memstrpfx(afp->line, afp->n, "#") /* and skip comment lines */ && ! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM"))); /* but stop on Stockholm header */ if (! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM 1.")) esl_fatal("small mem parse pass 2 failed (line %d): missing \"# STOCKHOLM\" header", (int) afp->linenumber); while ((status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK) { while (n && ( *p == ' ' || *p == '\t')) { p++; n--; } /* skip leading whitespace */ if (!n || *p == '#') continue; /* skip blank lines, comments */ else if (esl_memstrpfx(p, n, "//")) break; /* end of alignment: end of record */ else { /* sequence line. parse line into temporary strings */ if (esl_memtok(&p, &n, " \t", &seqname, &seqnamelen) != eslOK) esl_fatal("small mem parse pass 2 failed (line %d): no seq name", (int) afp->linenumber); if (esl_memtok(&p, &n, " \t", &aseq, &aseqlen) != eslOK) esl_fatal("small mem parse pass 2 failed (line %d): no aseq", (int) afp->linenumber); /* make sure we haven't just read a second line of the first sequence in file (we must be in Pfam 1 line/seq file) */ if (nseq_read == 0) { if ((status = esl_memstrdup(seqname, seqnamelen, &(first_seqname))) != eslOK) esl_fatal("small mem parse failed: unable to copy seqname"); } else if (esl_memstrcmp(seqname, seqnamelen, first_seqname)) esl_fatal("--small parse pass 2 failed (line %d): two seqs named %s. Alignment appears to be in interleaved Stockholm (not Pfam) format.", (int) afp->linenumber, seqname); nseq_read++; /* determine if we have an accession and/or description for this sequence */ have_de = have_ac = FALSE; if (ac_seqname && (esl_memstrcmp(seqname, seqnamelen, ac_seqname))) have_ac = TRUE; if (de_seqname && (esl_memstrcmp(seqname, seqnamelen, de_seqname))) have_de = TRUE; if (rename) fprintf(ofp, ">%s.%d%s%s%s%s\n", rename, nseq_read, (have_ac ? " " : "") , (have_ac ? ac : ""), (have_de ? " " : "") , (have_de ? de : "")); else fprintf(ofp, ">%.*s%s%s%s%s\n", (int) seqnamelen, seqname, (have_ac ? " " : "") , (have_ac ? ac : ""), (have_de ? " " : "") , (have_de ? de : "")); /* load next ac, de */ if (have_ac) { status = esl_fgets(&(ac_buf), &(ac_buflen), ac_fp); if (status == eslEOF) ac_seqname = NULL; else if (status == eslOK) { ac_s = ac_buf; if (esl_strtok_adv(&ac_s, " \t\n\r", &ac_seqname, NULL, NULL) != eslOK) esl_fatal("--small accession tmpfile parse failed"); if (esl_strtok_adv(&ac_s, "\n\r", &ac, NULL, NULL) != eslOK) esl_fatal("--small accession tmpfile parse failed"); } } if (have_de) { status = esl_fgets(&(de_buf), &(de_buflen), de_fp); if(status == eslEOF) de_seqname = NULL; else if (status == eslOK) { de_s = de_buf; if (esl_strtok_adv(&de_s, " \t\n\r", &de_seqname, NULL, NULL) != eslOK) esl_fatal("--small description tmpfile parse failed"); if (esl_strtok_adv(&de_s, "\n\r", &de, NULL, NULL) != eslOK) esl_fatal("--small description tmpfile parse failed"); } } /* now print sequence, after converting symbols as nec */ /* remember, aseq itself is part of an ESL_BUFFER and you can't write to it, so symconverts have to be on the copy */ for (apos = 0; apos < aseqlen; apos += cpl) { acpl = (aseqlen - apos > cpl ? cpl : aseqlen - apos); strncpy(aseqbuf, aseq + apos, acpl); aseqbuf[acpl] = '\0'; if (rfrom) symconvert(aseqbuf, rfrom, rto); if (gapsym) symconvert(aseqbuf, "-_.", gapsym); if (force_lower) symconvert(aseqbuf, "ABCDEFGHIJKLMNOPQRSTUVWXYZ", "abcdefghijklmnopqrstuvwxyz"); if (force_upper) symconvert(aseqbuf, "abcdefghijklmnopqrstuvwxyz", "ABCDEFGHIJKLMNOPQRSTUVWXYZ"); if (force_rna) symconvert(aseqbuf, "Tt", "Uu"); if (force_dna) symconvert(aseqbuf, "Uu", "Tt"); if (iupac_to_n) symconvert(aseqbuf, "RYMKSWHBVDrymkswhbvd", "NNNNNNNNNNnnnnnnnnnn"); if (x_is_bad) symconvert(aseqbuf, "Xx", "Nn"); fprintf(ofp, "%s\n", aseqbuf); } } } /* If we saw a normal // end, we would've successfully read a line, * so when we get here, status (from the line read) should be eslOK. */ if (status != eslOK) esl_fatal("--small parse pass 2 failed (line %d): didn't find // at end of alignment", (int) afp->linenumber); if (ac_seqname) esl_fatal("--small parse pass 2 failed, sequence %s with #=GS AC line does not exist in alignment or is in different order.", ac_seqname); if (de_seqname) esl_fatal("--small parse pass 2 failed, sequence %s with #=GS DE line does not exist in alignment or is in different order.", de_seqname); if (ac_fp) fclose(ac_fp); if (de_fp) fclose(de_fp); eslx_msafile_Close(afp); if (first_seqname) free(first_seqname); if (ac_buf) free(ac_buf); if (de_buf) free(de_buf); *ret_reached_eof = reached_eof; return; }
/* regurgitate_pfam_as_pfam() * * Given an open Pfam formatted msafile, read the next alignment and * regurgitate it, after modifying it as necessary (change dna to rna, * wussify SS, etc) in Pfam format. * * Returns <eslOK> on success. * Returns <eslEOF> if there are no more alignments in <afp>. * Returns <eslEFORMAT> if parse fails because of a file format * problem, in which case afp->errmsg is set to contain a formatted * message that indicates the cause of the problem. */ static int regurgitate_pfam_as_pfam(ESLX_MSAFILE *afp, FILE *ofp, char *gapsym, int force_lower, int force_upper, int force_rna, int force_dna, int iupac_to_n, int x_is_bad, int wussify, int dewuss, int fullwuss, char *rfrom, char *rto) { char *p; esl_pos_t n; char *first_seqname = NULL; char *gx = NULL; char *seqname = NULL; char *tag = NULL; char *text = NULL; esl_pos_t gxlen, namelen, taglen, textlen; int nseq_read = 0; int parse_gc_and_gr; int flushpoint = 10000; int exp_alen = -1; char *buf = NULL; esl_pos_t pos, pos2; int status; parse_gc_and_gr = (wussify || dewuss || fullwuss) ? TRUE : FALSE; /* should we parse out GR/GC lines and check if they're SS lines? */ afp->errmsg[0] = '\0'; /* Check the magic Stockholm header line. * We have to skip blank lines here, else we perceive * trailing blank lines in a file as a format error when * reading in multi-record mode. */ /* Check the magic Stockholm header line, allowing blank lines */ do { status = eslx_msafile_GetLine(afp, &p, &n); if (status == eslEOF) return eslEOF; else if (status != eslOK) esl_fatal("small mem parse error. problem reading line %d of msafile", (int) afp->linenumber); fprintf(ofp, "%.*s\n", (int) afp->n, afp->line); } while (esl_memspn(afp->line, afp->n, " \t") == afp->n || /* skip blank lines */ (esl_memstrpfx(afp->line, afp->n, "#") /* and skip comment lines */ && ! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM"))); /* but stop on Stockholm header */ if (! esl_memstrpfx(afp->line, afp->n, "# STOCKHOLM 1.")) esl_fatal("small mem parse failed (line %d): missing \"# STOCKHOLM\" header", (int) afp->linenumber); /* Read the alignment file one line at a time. */ while ((status = eslx_msafile_GetLine(afp, &p, &n)) == eslOK) { if ((int) afp->linenumber % flushpoint == 0) fflush(ofp); while (n && ( *p == ' ' || *p == '\t')) { p++; n--; } /* skip leading whitespace */ if (!n) fprintf(ofp, "\n"); else if (esl_memstrpfx(p, n, "//")) { fprintf(ofp, "//\n"); break; } /* normal way out */ else if (*p == '#') { if (parse_gc_and_gr && esl_memstrpfx(p, n, "#=GC")) { /* parse line into temporary strings */ if (esl_memtok(&p, &n, " \t", &gx, &gxlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad #=GC line", (int) afp->linenumber); if (esl_memtok(&p, &n, " \t", &tag, &taglen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad #=GC line", (int) afp->linenumber); if (esl_memtok(&p, &n, " \t", &text, &textlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad #=GC line", (int) afp->linenumber); pos = text - afp->line; /* pos: position of first aligned char on line; total width of annotation tag w/spaces */ /* verify alignment length */ if (exp_alen == -1) exp_alen = textlen; else if (exp_alen != textlen) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad #=GC line, len %d, expected %d", (int) afp->linenumber, (int) textlen, (int) exp_alen); /* we need to make a writable string copy of the annotation, to edit it */ ESL_REALLOC(buf, sizeof(char) * (textlen+1)); esl_memstrcpy(text, textlen, buf); if (esl_memstrcmp(tag, taglen, "SS_cons")) { if (wussify) esl_kh2wuss(buf, buf); else if (dewuss) esl_wuss2kh(buf, buf); else if (fullwuss) { status = esl_wuss_full(buf, buf); if (status == eslESYNTAX) esl_fatal("Bad SS_cons line: not in WUSS format, alifile line: %d", (int) afp->linenumber); else if (status != eslOK) esl_fatal("Conversion of SS_cons line failed, code %d, alifile line: %d", status, (int) afp->linenumber); } } fprintf(ofp, "#=GC %.*s%*s%s\n", (int) taglen, tag, (int) (pos-taglen-5), "", buf); } else if (parse_gc_and_gr && esl_memstrpfx(p, n, "#=GR") == 0) { /* parse line into temporary strings */ if (esl_memtok(&p, &n, " \t", &gx, &gxlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad #=GR line", (int) afp->linenumber); if (esl_memtok(&p, &n, " \t", &seqname, &namelen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad #=GR line", (int) afp->linenumber); if (esl_memtok(&p, &n, " \t", &tag, &taglen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad #=GR line", (int) afp->linenumber); pos = tag - afp->line; if (esl_memtok(&p, &n, " \t", &text, &textlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad #=GR line", (int) afp->linenumber); pos2 = text - afp->line; /* we need to make a writable string copy of the annotation, to edit it */ ESL_REALLOC(buf, sizeof(char) * (textlen+1)); esl_memstrcpy(text, textlen, buf); /* verify alignment length */ if (exp_alen == -1) exp_alen = textlen; else if (exp_alen != textlen) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad seq line, len %d, expected %d", (int) afp->linenumber, (int) textlen, (int) exp_alen); if (esl_memstrcmp(tag, taglen, "SS") == 0) { if (wussify) esl_kh2wuss(buf, buf); else if (dewuss) esl_wuss2kh(buf, buf); else if (fullwuss) { status = esl_wuss_full(buf, buf); if (status == eslESYNTAX) esl_fatal("Bad SS line: not in WUSS format, alifile line: %d", (int) afp->linenumber); else if (status != eslOK) esl_fatal("Conversion of SS line failed, code %d, alifile line: %d", status, (int) afp->linenumber); } } fprintf(ofp, "#=GR %.*s%*s%.*s%*s%s\n", (int) namelen, seqname, (int) (pos-namelen-5), "", (int) taglen, tag, (int) (pos2-pos-taglen), "", buf); } else { /* '#' prefixed line that is not #=GR (or it is #=GR and wussify,dewuss,fullwuss are all FALSE) */ fprintf(ofp, "%.*s\n", (int) afp->n, afp->line); /* print the line */ } } /* end of 'if (*s == '#')' */ else { /* sequence line */ if (esl_memtok(&p, &n, " \t", &seqname, &namelen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad sequence line", (int) afp->linenumber); if (esl_memtok(&p, &n, " \t", &text, &textlen) != eslOK) ESL_XFAIL(eslEFORMAT, afp->errmsg, "--small parse failed (line %d): bad sequence line", (int) afp->linenumber); pos = text - afp->line; /* verify alignment length */ if (exp_alen == -1) exp_alen = textlen; else if(exp_alen != textlen) ESL_XFAIL(eslEFORMAT, afp->errmsg, "small mem parse failed (line %d): bad seq line, len %d, expected %d", (int) afp->linenumber, (int) textlen, (int) exp_alen); /* make sure we haven't just read a second line of the first sequence in file (we must be in Pfam 1 line/seq file) */ if (nseq_read == 0) { if ((status = esl_memstrdup(seqname, namelen, &(first_seqname))) != eslOK) goto ERROR; } else if (esl_memstrcmp(seqname, namelen, first_seqname)) { ESL_XFAIL(eslEFORMAT, afp->errmsg, "parse failed (line %d): two seqs named %s. Alignment appears to be in Stockholm format. Reformat to Pfam with esl-reformat.", (int) afp->linenumber, seqname); } nseq_read++; /* we need to make a writable string copy of the annotation, to edit it */ ESL_REALLOC(buf, sizeof(char) * (textlen+1)); esl_memstrcpy(text, textlen, buf); /* make adjustments as necessary */ if (rfrom) symconvert(buf, rfrom, rto); if (gapsym) symconvert(buf, "-_.", gapsym); if (force_lower) symconvert(buf, "ABCDEFGHIJKLMNOPQRSTUVWXYZ", "abcdefghijklmnopqrstuvwxyz"); if (force_upper) symconvert(buf, "abcdefghijklmnopqrstuvwxyz", "ABCDEFGHIJKLMNOPQRSTUVWXYZ"); if (force_rna) symconvert(buf, "Tt", "Uu"); if (force_dna) symconvert(buf, "Uu", "Tt"); if (iupac_to_n) symconvert(buf, "RYMKSWHBVDrymkswhbvd", "NNNNNNNNNNnnnnnnnnnn"); if (x_is_bad) symconvert(buf, "Xx", "Nn"); /* print it out */ fprintf(ofp, "%.*s%*s%s\n", (int) namelen, seqname, (int) (pos-namelen), "", buf); } } /* If we saw a normal // end, we would've successfully read a line, * so when we get here, status (from the line read) should be eslOK. */ if (status != eslOK) esl_fatal("--small parse failed (line %d): didn't find // at end of alignment", (int) afp->linenumber); if (first_seqname) free(first_seqname); if (buf) free(buf); return eslOK; ERROR: return status; }
/* Function: esl_msafile_psiblast_Read() * Synopsis: Read an alignment in PSI-BLAST's input format. * * Purpose: Read an MSA from an open <ESLX_MSAFILE> <afp>, parsing for * PSI-BLAST input format, starting from the current point. * Create a new multiple alignment, and return a ptr to * that alignment via <*ret_msa>. Caller is responsible for * free'ing this <ESL_MSA>. * * The <msa> has a reference line (<msa->rf[]>) that * corresponds to the uppercase/lowercase columns in the * alignment: consensus (uppercase) columns are marked 'x', * and insert (lowercase) columns are marked '.' in this RF * line. * * Args: afp - open <ESL_MSAFILE> * ret_msa - RETURN: newly parsed <ESL_MSA> * * Returns: <eslOK> on success. <*ret_msa> contains the newly * allocated MSA. <afp> is at EOF. * * <eslEOF> if no (more) alignment data are found in * <afp>, and <afp> is returned at EOF. * * <eslEFORMAT> on a parse error. <*ret_msa> is set to * <NULL>. <afp> contains information sufficient for * constructing useful diagnostic output: * | <afp->errmsg> | user-directed error message | * | <afp->linenumber> | line # where error was detected | * | <afp->line> | offending line (not NUL-term) | * | <afp->n> | length of offending line | * | <afp->bf->filename> | name of the file | * and <afp> is poised at the start of the following line, * so (in principle) the caller could try to resume * parsing. * * Throws: <eslEMEM> on allocation error. * <eslESYS> if a system call fails, such as fread(). * <eslEINCONCEIVABLE> - "impossible" corruption * On these, <*ret_msa> is returned <NULL>, and the state of * <afp> is undefined. */ int esl_msafile_psiblast_Read(ESLX_MSAFILE *afp, ESL_MSA **ret_msa) { ESL_MSA *msa = NULL; int idx = 0; /* counter over sequences in a block */ int nblocks = 0; /* counter over blocks */ int64_t alen = 0; int nseq = 0; int64_t cur_alen; esl_pos_t pos; /* position on a line */ esl_pos_t name_start, name_len; esl_pos_t seq_start, seq_len; esl_pos_t block_seq_start, block_seq_len; int status; ESL_DASSERT1( (afp->format == eslMSAFILE_PSIBLAST) ); afp->errmsg[0] = '\0'; /* allocate a growable MSA. We set msa->{nseq,alen} only when we're done. */ #ifdef eslAUGMENT_ALPHABET if (afp->abc && (msa = esl_msa_CreateDigital(afp->abc, 16, -1)) == NULL) { status = eslEMEM; goto ERROR; } #endif if (! afp->abc && (msa = esl_msa_Create( 16, -1)) == NULL) { status = eslEMEM; goto ERROR; } /* skip leading blank lines in file */ while ( (status = eslx_msafile_GetLine(afp, NULL, NULL)) == eslOK && esl_memspn(afp->line, afp->n, " \t") == afp->n) ; if (status != eslOK) goto ERROR; /* includes normal EOF */ /* Read the file a line at a time; if a parsing error occurs, detect immediately, with afp->linenumber set correctly */ do { /* while in the file... */ idx = 0; do { /* while in a block... */ for (pos = 0; pos < afp->n; pos++) if (! isspace(afp->line[pos])) break; name_start = pos; for (pos = pos+1; pos < afp->n; pos++) if ( isspace(afp->line[pos])) break; name_len = pos - name_start; for (pos = pos+1; pos < afp->n; pos++) if (! isspace(afp->line[pos])) break; seq_start = pos; if (pos >= afp->n) ESL_XFAIL(eslEFORMAT, afp->errmsg, "invalid alignment line"); for (pos = afp->n-1; pos > 0; pos--) if (! isspace(afp->line[pos])) break; seq_len = pos - seq_start + 1; if (idx == 0) { block_seq_start = seq_start; block_seq_len = seq_len; } else { if (seq_start != block_seq_start) ESL_XFAIL(eslEFORMAT, afp->errmsg, "sequence start is misaligned"); if (seq_len != block_seq_len) ESL_XFAIL(eslEFORMAT, afp->errmsg, "sequence end is misaligned"); } /* Process the consensus #=RF line. */ if (idx == 0) { ESL_REALLOC(msa->rf, sizeof(char) * (alen + seq_len + 1)); for (pos = 0; pos < seq_len; pos++) msa->rf[alen+pos] = '-'; /* anything neutral other than . or x will do. */ msa->rf[alen+pos] = '\0'; } for (pos = 0; pos < seq_len; pos++) { if (afp->line[seq_start+pos] == '-') continue; if (isupper(afp->line[seq_start+pos])) { if (msa->rf[alen+pos] == '.') ESL_XFAIL(eslEFORMAT, afp->errmsg, "unexpected upper case residue (#%d on line)", (int) pos+1); msa->rf[alen+pos] = 'x'; } if (islower(afp->line[seq_start+pos])) { if (msa->rf[alen+pos] == 'x') ESL_XFAIL(eslEFORMAT, afp->errmsg, "unexpected lower case residue (#%d on line)", (int) pos+1); msa->rf[alen+pos] = '.'; } } /* Store the sequence name. */ if (nblocks == 0) { /* make sure we have room for another sequence */ if (idx >= msa->sqalloc && (status = esl_msa_Expand(msa)) != eslOK) goto ERROR; if ( (status = esl_msa_SetSeqName(msa, idx, afp->line+name_start, name_len)) != eslOK) goto ERROR; } else { if (! esl_memstrcmp(afp->line+name_start, name_len, msa->sqname[idx])) ESL_XFAIL(eslEFORMAT, afp->errmsg, "expected sequence %s on this line, but saw %.*s", msa->sqname[idx], (int) name_len, afp->line+name_start); } /* Append the sequence. */ cur_alen = alen; #ifdef eslAUGMENT_ALPHABET if (msa->abc) { status = esl_abc_dsqcat(afp->inmap, &(msa->ax[idx]), &(cur_alen), afp->line+seq_start, seq_len); } #endif if (! msa->abc) { status = esl_strmapcat (afp->inmap, &(msa->aseq[idx]), &(cur_alen), afp->line+seq_start, seq_len); } if (status == eslEINVAL) ESL_XFAIL(eslEFORMAT, afp->errmsg, "one or more invalid sequence characters"); else if (status != eslOK) goto ERROR; if (cur_alen - alen != seq_len) ESL_XFAIL(eslEFORMAT, afp->errmsg, "unexpected number of seq characters"); /* get next line. if it's blank, or if we're EOF, we're done with the block */ idx++; status = eslx_msafile_GetLine(afp, NULL, NULL); } while (status == eslOK && esl_memspn(afp->line, afp->n, " \t") < afp->n); /* blank line ends a block. */ if (status != eslOK && status != eslEOF) goto ERROR; /* End of one block */ if (nblocks == 0) nseq = idx; else if (idx != nseq) ESL_XFAIL(eslEFORMAT, afp->errmsg, "last block didn't contain same # of seqs as earlier blocks"); alen += block_seq_len; nblocks++; /* skip blank lines to start of next block, if any */ while ( (status = eslx_msafile_GetLine(afp, NULL, NULL)) == eslOK && esl_memspn(afp->line, afp->n, " \t") == afp->n) ; } while (status == eslOK); if (status != eslEOF) goto ERROR; msa->nseq = nseq; msa->alen = alen; if (( status = esl_msa_SetDefaultWeights(msa)) != eslOK) goto ERROR; *ret_msa = msa; return eslOK; ERROR: if (msa) esl_msa_Destroy(msa); *ret_msa = NULL; return status; }