int load_seqs(const char *path, char ***seqs_ptr, int *cap_ptr) { int cap = 1024; char **seqs = my_malloc(sizeof(char*) * cap,__FILE__,__LINE__); read_t read; seq_read_alloc(&read); seq_file_t *file = seq_open(path); if(file == NULL) die("Cannot open file: %s.", path); int num = 0; while(seq_read(file, &read)) { if(num == cap) { cap *= 2; seqs = realloc(seqs, sizeof(char*) * cap); } seqs[num++] = strdup(read.seq.b); } seq_read_dealloc(&read); seq_close(file); *seqs_ptr = seqs; *cap_ptr = cap; return num; }
void filelist_dealloc(FileList *flist) { size_t i; for(i = 0; i < flist->num_files; i++) seq_close(flist->files[i]); seq_read_dealloc(&flist->read); free(flist->files); free(flist->fqoffsets); free(flist->errors); }
// Load reads from a file, apply sequence error, dump // Return total number of bases size_t mutate_reads(seq_file_t *sfile, gzFile gzout, FileList *flist, float err) { printf(" reading: %s\n", sfile->path); read_t r; seq_read_alloc(&r); size_t num_bases = 0; while(seq_read(sfile, &r) > 0) { if(err > 0) add_seq_error_rate(r.seq.b, r.seq.end, err); else add_seq_error_profile(r.seq.b, r.seq.end, flist); gzprintf(gzout, "@%s\n%s\n+\n%s\n", r.name.b, r.seq.b, r.qual.b); num_bases += r.seq.end; } seq_read_dealloc(&r); return num_bases; }
// Load all reads from files into a read buffer and close the seq_files // Returns the number of reads loaded size_t seq_load_all_reads(seq_file_t **seq_files, size_t num_files, ReadBuffer *rbuf) { status("Loading sequences..."); size_t i, nreads = rbuf->len; read_t r; seq_read_alloc(&r); for(i = 0; i < num_files; i++) { status(" file: %s", seq_files[i]->path); while(seq_read_primary(seq_files[i], &r) > 0) { read_buf_push(rbuf, &r, 1); // copy read seq_read_alloc(&r); // allocate new read } seq_close(seq_files[i]); } seq_read_dealloc(&r); return rbuf->len - nreads; }
int ctx_calls2vcf(int argc, char **argv) { const char *in_path = NULL, *out_path = NULL, *out_type = NULL; // Filtering parameters int32_t min_mapq = -1, max_align_len = -1, max_allele_len = -1; // Alignment parameters int nwmatch = 1, nwmismatch = -2, nwgapopen = -4, nwgapextend = -1; // ref paths char const*const* ref_paths = NULL; size_t nref_paths = 0; // flank file const char *sam_path = NULL; // // Things we figure out by looking at the input // bool isbubble = false; // samples in VCF, (0 for bubble, does not include ref in breakpoint calls) size_t i, kmer_size, num_samples; // // Reference genome // // Hash map of chromosome name -> sequence ChromHash *genome; ReadBuffer chroms; // Arg parsing char cmd[100]; char shortopts[300]; cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts)); int c; // silence error messages from getopt_long // opterr = 0; while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) { cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd)); switch(c) { case 0: /* flag set */ break; case 'h': cmd_print_usage(NULL); break; case 'o': cmd_check(!out_path, cmd); out_path = optarg; break; case 'O': cmd_check(!out_type, cmd); out_type = optarg; break; case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break; case 'F': cmd_check(!sam_path,cmd); sam_path = optarg; break; case 'Q': cmd_check(min_mapq < 0,cmd); min_mapq = cmd_uint32(cmd, optarg); break; case 'A': cmd_check(max_align_len < 0,cmd); max_align_len = cmd_uint32(cmd, optarg); break; case 'L': cmd_check(max_allele_len < 0,cmd); max_allele_len = cmd_uint32(cmd, optarg); break; case 'm': nwmatch = cmd_int32(cmd, optarg); break; case 'M': nwmismatch = cmd_int32(cmd, optarg); break; case 'g': nwgapopen = cmd_int32(cmd, optarg); break; case 'G': nwgapextend = cmd_int32(cmd, optarg); break; case ':': /* BADARG */ case '?': /* BADCH getopt_long has already printed error */ die("`"CMD" "SUBCMD" -h` for help. Bad option: %s", argv[optind-1]); default: ctx_assert2(0, "shouldn't reach here: %c", c); } } // Defaults for unset values if(out_path == NULL) out_path = "-"; if(max_align_len < 0) max_align_len = DEFAULT_MAX_ALIGN; if(max_allele_len < 0) max_allele_len = DEFAULT_MAX_ALLELE; if(optind+2 > argc) cmd_print_usage("Require <in.txt.gz> and at least one reference"); in_path = argv[optind++]; ref_paths = (char const*const*)argv + optind; nref_paths = argc - optind; // These functions call die() on error gzFile gzin = futil_gzopen(in_path, "r"); // Read call file header cJSON *json = json_hdr_load(gzin, in_path); // Check we can handle the kmer size kmer_size = json_hdr_get_kmer_size(json, in_path); db_graph_check_kmer_size(kmer_size, in_path); // Get format (bubble or breakpoint file) cJSON *json_fmt = json_hdr_get(json, "file_format", cJSON_String, in_path); if(strcmp(json_fmt->valuestring,"CtxBreakpoints") == 0) isbubble = false; else if(strcmp(json_fmt->valuestring,"CtxBubbles") == 0) isbubble = true; else die("Unknown format: '%s'", json_fmt->valuestring); status("Reading %s in %s format", futil_inpath_str(in_path), isbubble ? "bubble" : "breakpoint"); if(isbubble) { // bubble specific if(sam_path == NULL) cmd_print_usage("Require -F <flanks.sam> with bubble file"); if(min_mapq < 0) min_mapq = DEFAULT_MIN_MAPQ; } else { // breakpoint specific if(min_mapq >= 0) cmd_print_usage("-Q,--min-mapq <Q> only valid with bubble calls"); } // Open flank file if it exists htsFile *samfh = NULL; bam_hdr_t *bam_hdr = NULL; bam1_t *mflank = NULL; if(sam_path) { if((samfh = hts_open(sam_path, "r")) == NULL) die("Cannot open SAM/BAM %s", sam_path); // Load BAM header bam_hdr = sam_hdr_read(samfh); if(bam_hdr == NULL) die("Cannot load BAM header: %s", sam_path); mflank = bam_init1(); } // Output VCF has 0 samples if bubbles file, otherwise has N where N is // number of samples/colours in the breakpoint graph size_t num_graph_samples = json_hdr_get_ncols(json, in_path); size_t num_graph_nonref = json_hdr_get_nonref_ncols(json, in_path); num_samples = 0; if(!isbubble) { // If last colour has "is_ref", drop number of samples by one num_samples = num_graph_nonref < num_graph_samples ? num_graph_samples-1 : num_graph_samples; } // // Open output file // if(!out_path) out_path = "-"; int mode = vcf_misc_get_outtype(out_type, out_path); futil_create_output(out_path); htsFile *vcffh = hts_open(out_path, modes_htslib[mode]); status("[calls2vcf] Reading %s call file with %zu samples", isbubble ? "Bubble" : "Breakpoint", num_graph_samples); status("[calls2vcf] %zu sample output to: %s format: %s", num_samples, futil_outpath_str(out_path), hsmodes_htslib[mode]); if(isbubble) status("[calls2vcf] min. MAPQ: %i", min_mapq); status("[calls2vcf] max alignment length: %i", max_align_len); status("[calls2vcf] max VCF allele length: %i", max_allele_len); status("[calls2vcf] alignment match:%i mismatch:%i gap open:%i extend:%i", nwmatch, nwmismatch, nwgapopen, nwgapextend); // Load reference genome read_buf_alloc(&chroms, 1024); genome = chrom_hash_init(); chrom_hash_load(ref_paths, nref_paths, &chroms, genome); // convert to upper case char *s; for(i = 0; i < chroms.len; i++) for(s = chroms.b[i].seq.b; *s; s++) *s = toupper(*s); if(!isbubble) brkpnt_check_refs_match(json, genome, in_path); bcf_hdr_t *vcfhdr = make_vcf_hdr(json, in_path, !isbubble, kmer_size, ref_paths, nref_paths, chroms.b, chroms.len); if(bcf_hdr_write(vcffh, vcfhdr) != 0) die("Cannot write VCF header"); AlignedCall *call = acall_init(); CallDecomp *aligner = call_decomp_init(vcffh, vcfhdr); scoring_t *scoring = call_decomp_get_scoring(aligner); scoring_init(scoring, nwmatch, nwmismatch, nwgapopen, nwgapextend, false, false, 0, 0, 0, 0); CallFileEntry centry; call_file_entry_alloc(¢ry); char kmer_str[50]; sprintf(kmer_str, ";K%zu", kmer_size); if(isbubble) { // Bubble calls DecompBubble *bubbles = decomp_bubble_init(); // Set scoring for aligning 3' flank scoring = decomp_bubble_get_scoring(bubbles); scoring_init(scoring, nwmatch, nwmismatch, nwgapopen, nwgapextend, true, true, 0, 0, 0, 0); while(call_file_read(gzin, in_path, ¢ry)) { do { if(sam_read1(samfh, bam_hdr, mflank) < 0) die("We've run out of SAM entries!"); } while(mflank->core.flag & (BAM_FSECONDARY | BAM_FSUPPLEMENTARY)); // Align call strbuf_reset(&call->info); decomp_bubble_call(bubbles, genome, kmer_size, min_mapq, ¢ry, mflank, bam_hdr, call); strbuf_append_str(&call->info, kmer_str); acall_decompose(aligner, call, max_align_len, max_allele_len); } // print bubble stats DecompBubbleStats *bub_stats = ctx_calloc(1, sizeof(*bub_stats)); decomp_bubble_cpy_stats(bub_stats, bubbles); print_bubble_stats(bub_stats); ctx_free(bub_stats); decomp_bubble_destroy(bubbles); } else { // Breakpoint calls DecompBreakpoint *breakpoints = decomp_brkpt_init(); while(call_file_read(gzin, in_path, ¢ry)) { strbuf_reset(&call->info); decomp_brkpt_call(breakpoints, genome, num_samples, ¢ry, call); strbuf_append_str(&call->info, kmer_str); acall_decompose(aligner, call, max_align_len, max_allele_len); } // print bubble stats DecompBreakpointStats *brk_stats = ctx_calloc(1, sizeof(*brk_stats)); decomp_brkpt_cpy_stats(brk_stats, breakpoints); print_breakpoint_stats(brk_stats); ctx_free(brk_stats); decomp_brkpt_destroy(breakpoints); } // Print stats DecomposeStats *astats = ctx_calloc(1, sizeof(*astats)); call_decomp_cpy_stats(astats, aligner); print_acall_stats(astats); ctx_free(astats); call_file_entry_dealloc(¢ry); call_decomp_destroy(aligner); acall_destroy(call); // Finished - clean up cJSON_Delete(json); gzclose(gzin); bcf_hdr_destroy(vcfhdr); hts_close(vcffh); for(i = 0; i < chroms.len; i++) seq_read_dealloc(&chroms.b[i]); read_buf_dealloc(&chroms); chrom_hash_destroy(genome); if(sam_path) { hts_close(samfh); bam_hdr_destroy(bam_hdr); bam_destroy1(mflank); } return EXIT_SUCCESS; }
int ctx_rmsubstr(int argc, char **argv) { struct MemArgs memargs = MEM_ARGS_INIT; size_t kmer_size = 0, nthreads = 0; const char *output_file = NULL; seq_format fmt = SEQ_FMT_FASTA; bool invert = false; // Arg parsing char cmd[100], shortopts[100]; cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts)); int c; while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) { cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd)); switch(c) { case 0: /* flag set */ break; case 'h': cmd_print_usage(NULL); break; case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break; case 'o': cmd_check(!output_file, cmd); output_file = optarg; break; case 't': cmd_check(!nthreads, cmd); nthreads = cmd_uint32_nonzero(cmd, optarg); break; case 'm': cmd_mem_args_set_memory(&memargs, optarg); break; case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break; case 'k': cmd_check(!kmer_size,cmd); kmer_size = cmd_uint32(cmd, optarg); break; case 'F': cmd_check(fmt==SEQ_FMT_FASTA, cmd); fmt = cmd_parse_format(cmd, optarg); break; case 'v': cmd_check(!invert,cmd); invert = true; break; case ':': /* BADARG */ case '?': /* BADCH getopt_long has already printed error */ // cmd_print_usage(NULL); cmd_print_usage("`"CMD" rmsubstr -h` for help. Bad option: %s", argv[optind-1]); default: abort(); } } // Defaults if(!nthreads) nthreads = DEFAULT_NTHREADS; if(!kmer_size) kmer_size = DEFAULT_KMER; if(!(kmer_size&1)) cmd_print_usage("Kmer size must be odd"); if(kmer_size < MIN_KMER_SIZE) cmd_print_usage("Kmer size too small (recompile)"); if(kmer_size > MAX_KMER_SIZE) cmd_print_usage("Kmer size too large (recompile?)"); if(optind >= argc) cmd_print_usage("Please specify at least one input sequence file (.fq, .fq etc.)"); size_t i, num_seq_files = argc - optind; char **seq_paths = argv + optind; seq_file_t **seq_files = ctx_calloc(num_seq_files, sizeof(seq_file_t*)); for(i = 0; i < num_seq_files; i++) if((seq_files[i] = seq_open(seq_paths[i])) == NULL) die("Cannot read sequence file %s", seq_paths[i]); // Estimate number of bases // set to -1 if we cannot calc int64_t est_num_bases = seq_est_seq_bases(seq_files, num_seq_files); if(est_num_bases < 0) { warn("Cannot get file sizes, using pipes"); est_num_bases = memargs.num_kmers * IDEAL_OCCUPANCY; } status("[memory] Estimated number of bases: %li", (long)est_num_bases); // Use file sizes to decide on memory // // Decide on memory // size_t bits_per_kmer, kmers_in_hash, graph_mem; bits_per_kmer = sizeof(BinaryKmer)*8 + sizeof(KONodeList) + sizeof(KOccur) + // see kmer_occur.h 8; // 1 byte per kmer for each base to load sequence files kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use, memargs.mem_to_use_set, memargs.num_kmers, memargs.num_kmers_set, bits_per_kmer, est_num_bases, est_num_bases, false, &graph_mem); cmd_check_mem_limit(memargs.mem_to_use, graph_mem); // // Open output file // if(output_file == NULL) output_file = "-"; FILE *fout = futil_fopen_create(output_file, "w"); // // Set up memory // dBGraph db_graph; db_graph_alloc(&db_graph, kmer_size, 1, 0, kmers_in_hash, DBG_ALLOC_BKTLOCKS); // // Load reference sequence into a read buffer // ReadBuffer rbuf; read_buf_alloc(&rbuf, 1024); seq_load_all_reads(seq_files, num_seq_files, &rbuf); // Check for reads too short for(i = 0; i < rbuf.len && rbuf.b[i].seq.end >= kmer_size; i++) {} if(i < rbuf.len) warn("Reads shorter than kmer size (%zu) will not be filtered", kmer_size); KOGraph kograph = kograph_create(rbuf.b, rbuf.len, true, 0, nthreads, &db_graph); size_t num_reads = rbuf.len, num_reads_printed = 0, num_bad_reads = 0; // Loop over reads printing those that are not substrings int ret; for(i = 0; i < rbuf.len; i++) { ret = _is_substr(&rbuf, i, &kograph, &db_graph); if(ret == -1) num_bad_reads++; else if((ret && invert) || (!ret && !invert)) { seqout_print_read(&rbuf.b[i], fmt, fout); num_reads_printed++; } } char num_reads_str[100], num_reads_printed_str[100], num_bad_reads_str[100]; ulong_to_str(num_reads, num_reads_str); ulong_to_str(num_reads_printed, num_reads_printed_str); ulong_to_str(num_bad_reads, num_bad_reads_str); status("Printed %s / %s (%.1f%%) to %s", num_reads_printed_str, num_reads_str, !num_reads ? 0.0 : (100.0 * num_reads_printed) / num_reads, futil_outpath_str(output_file)); if(num_bad_reads > 0) { status("Bad reads: %s / %s (%.1f%%) - no kmer {ACGT} of length %zu", num_bad_reads_str, num_reads_str, (100.0 * num_bad_reads) / num_reads, kmer_size); } fclose(fout); kograph_dealloc(&kograph); // Free sequence memory for(i = 0; i < rbuf.len; i++) seq_read_dealloc(&rbuf.b[i]); read_buf_dealloc(&rbuf); ctx_free(seq_files); db_graph_dealloc(&db_graph); return EXIT_SUCCESS; }
int ctx_calls2vcf(int argc, char **argv) { parse_cmdline_args(argc, argv); size_t i; // These functions call die() on error gzFile gzin = futil_gzopen(input_path, "r"); nw_aligner_setup(); // Read file header cJSON *json = read_input_header(gzin); // Get format (bubble or breakpoint file) cJSON *json_fmt = json_hdr_get(json, "file_format", cJSON_String, input_path); if(strcmp(json_fmt->valuestring,"CtxBreakpoints") == 0) input_bubble_format = false; else if(strcmp(json_fmt->valuestring,"CtxBubbles") == 0) input_bubble_format = true; else die("Unknown format: '%s'", json_fmt->valuestring); status("Reading %s in %s format", futil_inpath_str(input_path), input_bubble_format ? "bubble" : "breakpoint"); if(input_bubble_format && sam_path == NULL) cmd_print_usage("Require -F <flanks.sam> with bubble file"); // Open flank file if it exists if(sam_path) flanks_sam_open(); // Open output file FILE *fout = futil_fopen_create(out_path, "w"); // Load reference genome read_buf_alloc(&chroms, 1024); genome = kh_init(ChromHash); seq_reader_load_ref_genome(ref_paths, num_ref_paths, &chroms, genome); // convert to upper case char *s; for(i = 0; i < chroms.len; i++) for(s = chroms.b[i].seq.b; *s; s++) *s = toupper(*s); if(!input_bubble_format) brkpnt_check_refs_match(json, input_path); // Output VCF has 0 samples if bubbles file, otherwise has N where N is // number of samples/colours in the breakpoint graph size_t num_graph_samples = json_hdr_get_ncols(json, input_path); size_t num_graph_nonref = json_hdr_get_nonref_ncols(json, input_path); num_samples = 0; if(!input_bubble_format) { // If last colour has "is_ref", drop number of samples by one num_samples = num_graph_nonref < num_graph_samples ? num_graph_samples-1 : num_graph_samples; } print_vcf_header(json, !input_bubble_format, fout); status("Reading %s call file with %zu samples", input_bubble_format ? "Bubble" : "Breakpoint", num_graph_samples); status("Writing a VCF with %zu samples", num_samples); parse_entries(gzin, fout); // Print stats char num_entries_read_str[50]; char num_vars_printed_str[50]; ulong_to_str(num_entries_read, num_entries_read_str); ulong_to_str(num_vars_printed, num_vars_printed_str); status("Read %s entries, printed %s vcf entries to: %s", num_entries_read_str, num_vars_printed_str, futil_outpath_str(out_path)); if(input_bubble_format) { char msg[200]; // Bubble caller specific print_stat(num_flank5p_unmapped, num_entries_read, "flank 5p unmapped"); sprintf(msg, "flank 5p low mapq (<%zu)", min_mapq); print_stat(num_flank5p_lowqual, num_entries_read, msg); print_stat(num_flank3p_not_found, num_entries_read, "flank 3p not found"); print_stat(num_flank3p_multihits, num_entries_read, "flank 3p multiple hits"); print_stat(num_flank3p_approx_match,num_entries_read, "flank 3p approx match used"); print_stat(num_flank3p_exact_match, num_entries_read, "flank 3p exact match"); } else { // Breakpoint caller specific print_stat(num_flanks_not_uniquely_mapped, num_entries_read, "flank pairs contain one flank not mapped uniquely"); print_stat(num_flanks_diff_chroms, num_entries_read, "flank pairs map to diff chroms"); print_stat(num_flanks_diff_strands, num_entries_read, "flank pairs map to diff strands"); } print_stat(num_flanks_too_far_apart, num_entries_read, "flank pairs too far apart"); print_stat(num_flanks_overlap_too_large, num_entries_read, "flank pairs overlap too much"); print_stat(num_entries_well_mapped, num_entries_read, "flank pairs map well"); status("Aligned %zu allele pairs and %zu flanks", num_nw_allele, num_nw_flank); // Finished - clean up cJSON_Delete(json); gzclose(gzin); fclose(fout); for(i = 0; i < chroms.len; i++) seq_read_dealloc(&chroms.b[i]); read_buf_dealloc(&chroms); kh_destroy_ChromHash(genome); nw_aligner_destroy(); if(sam_path) flanks_sam_close(); // hide unused method warnings (void)kh_del_ChromHash; (void)kh_put_ChromHash; (void)kh_get_ChromHash; (void)kh_clear_ChromHash; (void)kh_destroy_ChromHash; (void)kh_init_ChromHash; return EXIT_SUCCESS; }
int main(int argc, char **argv) { // compiler complains about unused function without these linese (void)kh_clear_ghash; (void)kh_del_ghash; if(argc < 2) print_usage(usage, NULL); char swap_alleles = 0; int c; while((c = getopt(argc, argv, "s")) >= 0) { switch (c) { case 's': swap_alleles = 1; break; default: die("Unknown option: %c", c); } } if(optind == argc) print_usage(usage, "Not enough arguments"); char *inputpath = argv[optind]; char **refpaths = argv + optind + 1; size_t num_refs = argc - optind - 1; gzFile gzin = gzopen(inputpath, "r"); if(gzin == NULL) die("Cannot read file: %s", inputpath); size_t i, nchroms = 0, capacity = 1024; khash_t(ghash) *genome = kh_init(ghash); read_t *reads = malloc(capacity * sizeof(read_t)), *r; int hret; khiter_t k; for(i = 0; i < num_refs; i++) { fprintf(stderr, "Loading %s\n", refpaths[i]); load_reads(refpaths[i], &reads, &capacity, &nchroms); } if(num_refs == 0) { fprintf(stderr, "Loading from stdin\n"); load_reads("-", &reads, &capacity, &nchroms); } if(nchroms == 0) die("No chromosomes loaded"); for(i = 0; i < nchroms; i++) { r = reads + i; fprintf(stderr, "Loaded: '%s'\n", r->name.b); k = kh_put(ghash, genome, r->name.b, &hret); if(hret == 0) warn("Duplicate read name (taking first): %s", r->name.b); else kh_value(genome, k) = r; } // Now read VCF StrBuf line; strbuf_alloc(&line, 1024); char *fields[9]; char *chr; int pos, reflen, altlen; while(strbuf_reset_gzreadline(&line, gzin) > 0) { if(line.b[0] == '#') fputs(line.b, stdout); else { strbuf_chomp(&line); vcf_columns(line.b, fields); fields[1][-1] = fields[2][-1] = '\0'; chr = line.b; pos = atoi(fields[1])-1; k = kh_get(ghash, genome, chr); r = kh_value(genome, k); fields[1][-1] = fields[2][-1] = '\t'; reflen = fields[4] - fields[3] - 1; altlen = fields[5] - fields[4] - 1; if(k == kh_end(genome)) warn("Cannot find chrom: %s", chr); else if(pos < 0) warn("Bad line: %s\n", line.b); else if((reflen == 1 && altlen == 1) || fields[3][0] == fields[4][0]) { if((unsigned)pos + reflen <= r->seq.end && strncasecmp(r->seq.b+pos,fields[3],reflen) == 0) { fputs(line.b, stdout); fputc('\n', stdout); } else if(swap_alleles && (unsigned)pos + altlen <= r->seq.end && strncasecmp(r->seq.b+pos,fields[4],altlen) == 0) { // swap alleles char tmp[altlen], *ref = fields[3], *alt = fields[4]; memcpy(tmp, alt, altlen); memmove(ref+altlen+1, ref, reflen); memcpy(ref, tmp, altlen); ref[altlen] = '\t'; fputs(line.b, stdout); fputc('\n', stdout); } // else printf("FAIL0\n"); } // else printf("FAIL1\n"); } } kh_destroy(ghash, genome); strbuf_dealloc(&line); gzclose(gzin); for(i = 0; i < nchroms; i++) seq_read_dealloc(reads+i); free(reads); fprintf(stderr, " Done.\n"); return 0; }
static void test_kmer_occur_filter() { // Construct 1 colour graph with kmer-size=11 dBGraph graph; const size_t kmer_size = 11, ncols = 3; size_t i; // Create graph db_graph_alloc(&graph, kmer_size, ncols, 1, 2000, DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL | DBG_ALLOC_BKTLOCKS); // xyz------->>> y > < X // TTCGACCCGACAGGGCAACGTAGTCCGACAGGGCACAGCCCTGTCGGGGGGTGCA #define NUM_NODES 3 #define NUM_READS 3 const char *tmp[NUM_READS] = { "AACA", "TTCGACCCGACAGGGCAACGTAGTCCGACAGGGCACAGCCCTGTCGGGGGGTGCA", "TCTAGCATGTGTGTT"}; read_t reads[NUM_READS]; for(i = 0; i < NUM_READS; i++) { seq_read_alloc(&reads[i]); seq_read_set(&reads[i], tmp[i]); } KOGraph kograph = kograph_create(reads, NUM_READS, true, 0, 1, &graph); TASSERT(kograph.nchroms == NUM_READS); TASSERT(kograph.koccurs != NULL); KOccurRunBuffer koruns, koruns_tmp, koruns_ended; korun_buf_alloc(&koruns, 16); korun_buf_alloc(&koruns_tmp, 16); korun_buf_alloc(&koruns_ended, 16); // Check CCCGACAGGGCAA starts at CCCGACAGGGC // x=CCCGACAGGGC, y=CCGACAGGGCA, z=CGACAGGGCAA // X=GCCCTGTCGGG, Y=TGCCCTGTCGG, Z=TTGCCCTGTCG dBNode nodes[NUM_NODES]; for(i = 0; i < NUM_NODES; i++) nodes[i] = db_graph_find_str(&graph, &"CCCGACAGGGCAA"[i]); korun_buf_reset(&koruns); korun_buf_reset(&koruns_ended); kograph_filter_extend(&kograph, nodes, NUM_NODES, true, 0, 0, &koruns, &koruns_tmp, &koruns_ended); // Checks TASSERT2(koruns.len == 1, "koruns.len: %zu", koruns.len); TASSERT(koruns.b[0].strand == STRAND_PLUS); // left-to-right with ref TASSERT2(koruns.b[0].chrom == 1, "chrom: %zu", (size_t)koruns.b[0].chrom); TASSERT2(koruns.b[0].first == 5, "offset: %zu", (size_t)koruns.b[0].first); TASSERT2(koruns.b[0].last == 7, "last: %zu", (size_t)koruns.b[0].last); // Test reverse db_nodes_reverse_complement(nodes, NUM_NODES); korun_buf_reset(&koruns); korun_buf_reset(&koruns_ended); kograph_filter_extend(&kograph, nodes, 1, true, 0, 0, &koruns, &koruns_tmp, &koruns_ended); kograph_filter_extend(&kograph, nodes+1, 1, true, 0, 1, &koruns, &koruns_tmp, &koruns_ended); kograph_filter_extend(&kograph, nodes+2, 1, true, 0, 2, &koruns, &koruns_tmp, &koruns_ended); // Print out for debugging // printf("koruns: "); // koruns_print(koruns.b, koruns.len, kmer_size, stdout); // printf("\nkoruns_ended: "); // koruns_print(koruns_ended.b, koruns_ended.len, kmer_size, stdout); // printf("\n"); // Check results match: // koruns: chromid:1:17-5:-, chromid:1:37-47:+ // koruns_ended: chromid:1:34-24:- TASSERT2(koruns.len == 2, "koruns.len: %zu", koruns.len); TASSERT2(koruns_ended.len == 1, "koruns_ended.len: %zu", koruns_ended.len); TASSERT(koruns.b[0].strand == STRAND_MINUS); // reverse complement of ref TASSERT2(koruns.b[0].chrom == 1, "chrom: %zu", (size_t)koruns.b[0].chrom); TASSERT2(koruns.b[0].first == 7, "offset: %zu", (size_t)koruns.b[0].first); TASSERT2(koruns.b[0].last == 5, "last: %zu", (size_t)koruns.b[0].last); korun_buf_dealloc(&koruns); korun_buf_dealloc(&koruns_tmp); korun_buf_dealloc(&koruns_ended); for(i = 0; i < NUM_READS; i++) seq_read_dealloc(&reads[i]); kograph_dealloc(&kograph); db_graph_dealloc(&graph); }
// If seq2 is NULL, read pair of entries from first file // Otherwise read an entry from each void align_from_file(const char *path1, const char *path2, void (align)(read_t *r1, read_t *r2), bool use_zlib) { seq_file_t *sf1, *sf2; if((sf1 = open_seq_file(path1, use_zlib)) == NULL) { fprintf(stderr, "Alignment Error: couldn't open file %s\n", path1); fflush(stderr); return; } if(path2 == NULL) { sf2 = sf1; } else if((sf2 = open_seq_file(path2, use_zlib)) == NULL) { fprintf(stderr, "Alignment Error: couldn't open file %s\n", path1); fflush(stderr); return; } // fprintf(stderr, "File buffer %zu zlib: %i\n", sf1->in.size, seq_use_gzip(sf1)); read_t read1, read2; seq_read_alloc(&read1); seq_read_alloc(&read2); // Loop while we can read a sequence from the first file unsigned long alignments; for(alignments = 0; seq_read(sf1, &read1) > 0; alignments++) { if(seq_read(sf2, &read2) <= 0) { fprintf(stderr, "Alignment Error: Odd number of sequences - " "I read in pairs!\n"); fflush(stderr); break; } (align)(&read1, &read2); } // warn if no bases read if(alignments == 0) { fprintf(stderr, "Alignment Warning: empty input\n"); fflush(stderr); } // Close files seq_close(sf1); if(path2 != NULL) seq_close(sf2); // Free memory seq_read_dealloc(&read1); seq_read_dealloc(&read2); }
// Returns num of bases printed size_t sim_reads(seq_file_t *reffile, gzFile out0, gzFile out1, FileList *flist, float err_rate, size_t insert, double insert_stddev, size_t rlen, double depth) { size_t i, chromcap = 16, nchroms, glen = 0, nreads, chr, pos0, pos1, tlen; read_t *chroms; tlen = rlen + (out1 == NULL ? 0 : insert + rlen); chroms = malloc(chromcap * sizeof(read_t)); nchroms = 0; // Load genome printf(" Loaded contigs:"); while(1) { if(nchroms == chromcap) chroms = realloc(chroms, (chromcap*=2)*sizeof(read_t)); seq_read_alloc(&chroms[nchroms]); if(seq_read(reffile, &chroms[nchroms]) <= 0) { seq_read_dealloc(&chroms[nchroms]); break; } if(chroms[nchroms].seq.end < tlen) { seq_read_dealloc(&chroms[nchroms]); } else { seq_read_truncate_name(&chroms[nchroms]); printf(" %s[%zu]", chroms[nchroms].name.b, chroms[nchroms].seq.end); glen += chroms[nchroms].seq.end; nchroms++; } } printf("\n Genome size: %zu\n", glen); if(nchroms == 0) { die("No sequences long enough in ref genome file [min len: %zu]: %s", tlen, reffile->path); } // Sample nreads = (glen * depth) / (out1 == NULL ? rlen : (2 * rlen)); char read0[rlen+1], read1[rlen+1]; read0[rlen] = read1[rlen] = '\0'; printf("Sampling %zu %sreads...\n", nreads, out1 == NULL ? "single " : "paired-end "); // Sample paired-end if out1 != NULL for(i = 0; i < nreads; i++) { chr = (nchroms == 1) ? 0 : rand_chrom(chroms, nchroms, glen); pos0 = random_uniform(chroms[chr].seq.end - (out1 == NULL ? rlen : tlen)); pos1 = pos0; memcpy(read0, chroms[chr].seq.b+pos0, rlen); if(out1 != NULL) { pos1 = pos0 + rlen + insert + ran_normal()*insert_stddev; if(pos1 + rlen > chroms[chr].seq.end) pos1 = chroms[chr].seq.end-rlen; memcpy(read1, chroms[chr].seq.b+pos1, rlen); } if(flist != NULL) { add_seq_error_profile(read0, rlen, flist); if(out1 != NULL) add_seq_error_profile(read1, rlen, flist); } else if(err_rate >= 0) { add_seq_error_rate(read0, rlen, err_rate); } gzprintf(out0, ">r%zu:%s:%zu:%zu%s\n%.*s\n", i, chroms[chr].name.b, pos0, pos1, (out1 != NULL ? "/1" : ""), (int)rlen, read0); if(out1 != NULL) { dna_revcmp(read1, rlen); gzprintf(out1, ">r%zu:%s:%zu:%zu/2\n%.*s\n", i, chroms[chr].name.b, pos0, pos1, (int)rlen, read1); } } for(i = 0; i < nchroms; i++) seq_read_dealloc(&chroms[i]); free(chroms); size_t num_bases = nreads * rlen; if(out1 != NULL) num_bases *= 2; return num_bases; }