//********************************************************************************************************************** GetCurrentCommand::GetCurrentCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; //check to make sure all parameters are valid for command for (map<string,string>::iterator it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } clearTypes = validParameter.validFile(parameters, "clear", false); if (clearTypes == "not found") { clearTypes = ""; } else { m->splitAtDash(clearTypes, types); } } } catch(exception& e) { m->errorOut(e, "GetCurrentCommand", "GetCurrentCommand"); exit(1); } }
SetLogFileCommand::SetLogFileCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; //check to make sure all parameters are valid for command for (map<string,string>::iterator it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } name = validParameter.validFile(parameters, "name", false); if (name == "not found") { m->mothurOut("name is a required parameter for the set.logfile command."); abort = true; } string temp = validParameter.validFile(parameters, "append", false); if (temp == "not found") { temp = "F"; } append = m->isTrue(temp); } } catch(exception& e) { m->errorOut(e, "SetLogFileCommand", "SetLogFileCommand"); exit(1); } }
MakeFileCommand::MakeFileCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; map<string, string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["file"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; m->mothurOut("[ERROR]: The inputdir parameter is required, aborting."); m->mothurOutEndLine(); abort = true; } else { if (m->dirCheck(inputDir)) {} // all set else { abort = true; } } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = inputDir; } //if the user changes the input directory command factory will send this info to us in the output parameter typeFile = validParameter.validFile(parameters, "type", false); if (typeFile == "not found"){ typeFile = "fastq"; } if ((typeFile != "fastq") && (typeFile != "gz")) { m->mothurOut(typeFile + " is not a valid type. Options are fastq or gz. I will use fastq."); m->mothurOutEndLine(); typeFile = "fastq"; } string temp = validParameter.validFile(parameters, "numcols", false); if(temp == "not found"){ temp = "3"; } if ((temp != "2") && (temp != "3")) { m->mothurOut(temp + " is not a valid numcols. Options are 2 or 3. I will use 3."); m->mothurOutEndLine(); temp = "3"; } m->mothurConvert(temp, numCols); } } catch(exception& e) { m->errorOut(e, "MakeFileCommand", "MakeFileCommand"); exit(1); } }
//********************************************************************************************************************** LoadLogfileCommand::LoadLogfileCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { //valid paramters for this command vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string,string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("logfile"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["logfile"] = inputDir + it->second; } } } //get shared file, it is required logfile = validParameter.validFile(parameters, "logfile", true); if (logfile == "not open") { logfile = ""; abort = true; } else if (logfile == "not found") { m->mothurOut("The logfile parameter is required."); m->mothurOutEndLine();abort = true; } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = m->hasPath(logfile); //if user entered a file with a path then preserve it } } } catch(exception& e) { m->errorOut(e, "NewCommand", "NewCommand"); exit(1); } }
SetDirectoryCommand::SetDirectoryCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; //check to make sure all parameters are valid for command for (map<string,string>::iterator it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } output = validParameter.validFile(parameters, "output", false); if (output == "not found") { output = ""; } input = validParameter.validFile(parameters, "input", false); if (input == "not found") { input = ""; } tempdefault = validParameter.validFile(parameters, "tempdefault", false); if (tempdefault == "not found") { tempdefault = ""; } if ((input == "") && (output == "") && (tempdefault == "")) { m->mothurOut("You must provide either an input, output or tempdefault for the set.outdir command."); m->mothurOutEndLine(); abort = true; } } } catch(exception& e) { m->errorOut(e, "SetDirectoryCommand", "SetDirectoryCommand"); exit(1); } }
//********************************************************************************************************************** //This function checks to make sure the cluster command has no errors and then clusters based on the method chosen. ClusterCommand::ClusterCommand(string option) { try{ abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); map<string,string>::iterator it; ValidParameters validParameter; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["list"] = tempOutNames; outputTypes["rabund"] = tempOutNames; outputTypes["sabund"] = tempOutNames; //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("phylip"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["phylip"] = inputDir + it->second; } } it = parameters.find("column"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["column"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } } //check for required parameters phylipfile = validParameter.validFile(parameters, "phylip", true); if (phylipfile == "not open") { phylipfile = ""; abort = true; } else if (phylipfile == "not found") { phylipfile = ""; } else { distfile = phylipfile; format = "phylip"; m->setPhylipFile(phylipfile); } columnfile = validParameter.validFile(parameters, "column", true); if (columnfile == "not open") { columnfile = ""; abort = true; } else if (columnfile == "not found") { columnfile = ""; } else { distfile = columnfile; format = "column"; m->setColumnFile(columnfile); } namefile = validParameter.validFile(parameters, "name", true); if (namefile == "not open") { abort = true; } else if (namefile == "not found") { namefile = ""; } else { m->setNameFile(namefile); } if ((phylipfile == "") && (columnfile == "")) { //is there are current file available for either of these? //give priority to column, then phylip columnfile = m->getColumnFile(); if (columnfile != "") { distfile = columnfile; format = "column"; m->mothurOut("Using " + columnfile + " as input file for the column parameter."); m->mothurOutEndLine(); } else { phylipfile = m->getPhylipFile(); if (phylipfile != "") { distfile = phylipfile; format = "phylip"; m->mothurOut("Using " + phylipfile + " as input file for the phylip parameter."); m->mothurOutEndLine(); } else { m->mothurOut("No valid current files. You must provide a phylip or column file before you can use the cluster command."); m->mothurOutEndLine(); abort = true; } } } else if ((phylipfile != "") && (columnfile != "")) { m->mothurOut("When executing a cluster command you must enter ONLY ONE of the following: phylip or column."); m->mothurOutEndLine(); abort = true; } if (columnfile != "") { if (namefile == "") { namefile = m->getNameFile(); if (namefile != "") { m->mothurOut("Using " + namefile + " as input file for the name parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You need to provide a namefile if you are going to use the column format."); m->mothurOutEndLine(); abort = true; } } } //check for optional parameter and set defaults // ...at some point should added some additional type checking... //get user cutoff and precision or use defaults string temp; temp = validParameter.validFile(parameters, "precision", false); if (temp == "not found") { temp = "100"; } //saves precision legnth for formatting below length = temp.length(); m->mothurConvert(temp, precision); temp = validParameter.validFile(parameters, "hard", false); if (temp == "not found") { temp = "T"; } hard = m->isTrue(temp); temp = validParameter.validFile(parameters, "sim", false); if (temp == "not found") { temp = "F"; } sim = m->isTrue(temp); temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found") { temp = "10"; } m->mothurConvert(temp, cutoff); cutoff += (5 / (precision * 10.0)); method = validParameter.validFile(parameters, "method", false); if (method == "not found") { method = "average"; } if ((method == "furthest") || (method == "nearest") || (method == "average") || (method == "weighted")) { } else { m->mothurOut("Not a valid clustering method. Valid clustering algorithms are furthest, nearest, average, and weighted."); m->mothurOutEndLine(); abort = true; } showabund = validParameter.validFile(parameters, "showabund", false); if (showabund == "not found") { showabund = "T"; } timing = validParameter.validFile(parameters, "timing", false); if (timing == "not found") { timing = "F"; } } } catch(exception& e) { m->errorOut(e, "ClusterCommand", "ClusterCommand"); exit(1); } }
MakeGroupCommand::MakeGroupCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; map<string, string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["group"] = tempOutNames; //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } fastaFileName = validParameter.validFile(parameters, "fasta", false); if (fastaFileName == "not found") { //if there is a current fasta file, use it string filename = m->getFastaFile(); if (filename != "") { fastaFileNames.push_back(filename); m->mothurOut("Using " + filename + " as input file for the fasta parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->splitAtDash(fastaFileName, fastaFileNames); //go through files and make sure they are good, if not, then disregard them for (int i = 0; i < fastaFileNames.size(); i++) { bool ignore = false; if (fastaFileNames[i] == "current") { fastaFileNames[i] = m->getFastaFile(); if (fastaFileNames[i] != "") { m->mothurOut("Using " + fastaFileNames[i] + " as input file for the fasta parameter where you had given current."); m->mothurOutEndLine(); filename += m->getRootName(m->getSimpleName(fastaFileNames[i])); } else { m->mothurOut("You have no current fastafile, ignoring current."); m->mothurOutEndLine(); ignore=true; //erase from file list fastaFileNames.erase(fastaFileNames.begin()+i); i--; } } if (!ignore) { if (inputDir != "") { string path = m->hasPath(fastaFileNames[i]); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { fastaFileNames[i] = inputDir + fastaFileNames[i]; } } ifstream in; bool ableToOpen = m->openInputFile(fastaFileNames[i], in, "noerror"); //if you can't open it, try default location if (!ableToOpen) { if (m->getDefaultPath() != "") { //default path is set string tryPath = m->getDefaultPath() + m->getSimpleName(fastaFileNames[i]); m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine(); ifstream in2; ableToOpen = m->openInputFile(tryPath, in2, "noerror"); in2.close(); fastaFileNames[i] = tryPath; } } //if you can't open it, try default location if (!ableToOpen) { if (m->getOutputDir() != "") { //default path is set string tryPath = m->getOutputDir() + m->getSimpleName(fastaFileNames[i]); m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine(); ifstream in2; ableToOpen = m->openInputFile(tryPath, in2, "noerror"); in2.close(); fastaFileNames[i] = tryPath; } } in.close(); if (!ableToOpen) { m->mothurOut("Unable to open " + fastaFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine(); //erase from file list fastaFileNames.erase(fastaFileNames.begin()+i); i--; }else{ filename += m->getRootName(m->getSimpleName(fastaFileNames[i])); m->setFastaFile(fastaFileNames[i]); } } } //prevent giantic file name map<string, string> variables; variables["[filename]"] = filename; if (fastaFileNames.size() > 3) { variables["[filename]"] = "merge"; } filename = getOutputFileName("group",variables); //make sure there is at least one valid file left if (fastaFileNames.size() == 0) { m->mothurOut("no valid files."); m->mothurOutEndLine(); abort = true; } } output = validParameter.validFile(parameters, "output", false); if (output == "not found") { output = ""; } else{ filename = output; } groups = validParameter.validFile(parameters, "groups", false); if (groups == "not found") { m->mothurOut("groups is a required parameter for the make.group command."); m->mothurOutEndLine(); abort = true; } else { m->splitAtDash(groups, groupsNames); } if (groupsNames.size() != fastaFileNames.size()) { m->mothurOut("You do not have the same number of valid fastfile files as groups. This could be because we could not open a fastafile."); m->mothurOutEndLine(); abort = true; } } } catch(exception& e) { m->errorOut(e, "MakeGroupCommand", "MakeGroupCommand"); exit(1); } }
//********************************************************************************************************************** GetSharedOTUCommand::GetSharedOTUCommand(string option) { try { abort = false; calledHelp = false; unique = true; allLines = 1; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string,string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["fasta"] = tempOutNames; outputTypes["accnos"] = tempOutNames; outputTypes["sharedseqs"] = tempOutNames; //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("fasta"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } it = parameters.find("list"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["list"] = inputDir + it->second; } } it = parameters.find("shared"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["shared"] = inputDir + it->second; } } it = parameters.find("group"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["group"] = inputDir + it->second; } } } //check for required parameters listfile = validParameter.validFile(parameters, "list", true); if (listfile == "not open") { abort = true; } else if (listfile == "not found") { listfile = ""; } else { format = "list"; m->setListFile(listfile); } groupfile = validParameter.validFile(parameters, "group", true); if (groupfile == "not open") { abort = true; } else if (groupfile == "not found") { groupfile = ""; } else { m->setGroupFile(groupfile); } sharedfile = validParameter.validFile(parameters, "shared", true); if (sharedfile == "not open") { abort = true; } else if (sharedfile == "not found") { sharedfile = ""; } else { m->setSharedFile(sharedfile); } fastafile = validParameter.validFile(parameters, "fasta", true); if (fastafile == "not open") { abort = true; } else if (fastafile == "not found") { fastafile = ""; } else { m->setFastaFile(fastafile); } if ((sharedfile == "") && (listfile == "")) { //look for currents //is there are current file available for either of these? //give priority to shared, then list sharedfile = m->getSharedFile(); if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); } else { listfile = m->getListFile(); if (listfile != "") { m->mothurOut("Using " + listfile + " as input file for the list parameter."); m->mothurOutEndLine(); } else { m->mothurOut("No valid current files. You must provide a shared or list file."); m->mothurOutEndLine(); abort = true; } } }else if ((sharedfile != "") && (listfile != "")) { m->mothurOut("You may enter ONLY ONE of the following: shared or list."); m->mothurOutEndLine(); abort = true; } if (listfile != "") { if (groupfile == ""){ groupfile = m->getGroupFile(); if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You need to provide a group file if you are going to use the list format."); m->mothurOutEndLine(); abort = true; } } } if ((sharedfile != "") && (fastafile != "")) { m->mothurOut("You cannot use the fasta file with the shared file."); m->mothurOutEndLine(); abort = true; } //check for optional parameter and set defaults // ...at some point should added some additional type checking... label = validParameter.validFile(parameters, "label", false); if (label == "not found") { label = ""; } else { if(label != "all") { m->splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } output = validParameter.validFile(parameters, "output", false); if (output == "not found") { output = ""; } else if (output == "default") { output = ""; } groups = validParameter.validFile(parameters, "uniquegroups", false); if (groups == "not found") { groups = ""; } else { userGroups = "unique." + groups; m->splitAtDash(groups, Groups); } groups = validParameter.validFile(parameters, "sharedgroups", false); if (groups == "not found") { groups = ""; } else { userGroups = groups; m->splitAtDash(groups, Groups); unique = false; } } } catch(exception& e) { m->errorOut(e, "GetSharedOTUCommand", "GetSharedOTUCommand"); exit(1); } }
//********************************************************************************************************************** SetCurrentCommand::SetCurrentCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { //valid paramters for this command vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string,string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("phylip"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["phylip"] = inputDir + it->second; } } it = parameters.find("column"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["column"] = inputDir + it->second; } } it = parameters.find("fasta"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } it = parameters.find("list"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["list"] = inputDir + it->second; } } it = parameters.find("rabund"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["rabund"] = inputDir + it->second; } } it = parameters.find("sabund"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["sabund"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } it = parameters.find("group"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["group"] = inputDir + it->second; } } it = parameters.find("design"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["design"] = inputDir + it->second; } } it = parameters.find("order"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["order"] = inputDir + it->second; } } it = parameters.find("tree"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["tree"] = inputDir + it->second; } } it = parameters.find("shared"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["shared"] = inputDir + it->second; } } it = parameters.find("ordergroup"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["ordergroup"] = inputDir + it->second; } } it = parameters.find("count"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["count"] = inputDir + it->second; } } it = parameters.find("relabund"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["relabund"] = inputDir + it->second; } } it = parameters.find("fasta"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } it = parameters.find("qfile"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["qfile"] = inputDir + it->second; } } it = parameters.find("sff"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["sff"] = inputDir + it->second; } } it = parameters.find("oligos"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["oligos"] = inputDir + it->second; } } it = parameters.find("accnos"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["accnos"] = inputDir + it->second; } } it = parameters.find("taxonomy"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["taxonomy"] = inputDir + it->second; } } it = parameters.find("flow"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["flow"] = inputDir + it->second; } } it = parameters.find("biom"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["biom"] = inputDir + it->second; } } it = parameters.find("summary"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["summary"] = inputDir + it->second; } } } //check for parameters phylipfile = validParameter.validFile(parameters, "phylip", true); if (phylipfile == "not open") { m->mothurOut("Ignoring: " + parameters["phylip"]); m->mothurOutEndLine(); phylipfile = ""; } else if (phylipfile == "not found") { phylipfile = ""; } if (phylipfile != "") { m->setPhylipFile(phylipfile); } columnfile = validParameter.validFile(parameters, "column", true); if (columnfile == "not open") { m->mothurOut("Ignoring: " + parameters["column"]); m->mothurOutEndLine(); columnfile = ""; } else if (columnfile == "not found") { columnfile = ""; } if (columnfile != "") { m->setColumnFile(columnfile); } listfile = validParameter.validFile(parameters, "list", true); if (listfile == "not open") { m->mothurOut("Ignoring: " + parameters["list"]); m->mothurOutEndLine(); listfile = ""; } else if (listfile == "not found") { listfile = ""; } if (listfile != "") { m->setListFile(listfile); } rabundfile = validParameter.validFile(parameters, "rabund", true); if (rabundfile == "not open") { m->mothurOut("Ignoring: " + parameters["rabund"]); m->mothurOutEndLine(); rabundfile = ""; } else if (rabundfile == "not found") { rabundfile = ""; } if (rabundfile != "") { m->setRabundFile(rabundfile); } sabundfile = validParameter.validFile(parameters, "sabund", true); if (sabundfile == "not open") { m->mothurOut("Ignoring: " + parameters["sabund"]); m->mothurOutEndLine(); sabundfile = ""; } else if (sabundfile == "not found") { sabundfile = ""; } if (sabundfile != "") { m->setSabundFile(sabundfile); } namefile = validParameter.validFile(parameters, "name", true); if (namefile == "not open") { m->mothurOut("Ignoring: " + parameters["name"]); m->mothurOutEndLine(); namefile = ""; } else if (namefile == "not found") { namefile = ""; } if (namefile != "") { m->setNameFile(namefile); } groupfile = validParameter.validFile(parameters, "group", true); if (groupfile == "not open") { m->mothurOut("Ignoring: " + parameters["group"]); m->mothurOutEndLine(); groupfile = ""; } else if (groupfile == "not found") { groupfile = ""; } if (groupfile != "") { m->setGroupFile(groupfile); } countfile = validParameter.validFile(parameters, "count", true); if (countfile == "not open") { m->mothurOut("Ignoring: " + parameters["count"]); m->mothurOutEndLine(); countfile = ""; } else if (countfile == "not found") { countfile = ""; } if (countfile != "") { m->setCountTableFile(countfile); } designfile = validParameter.validFile(parameters, "design", true); if (designfile == "not open") { m->mothurOut("Ignoring: " + parameters["design"]); m->mothurOutEndLine(); designfile = ""; } else if (designfile == "not found") { designfile = ""; } if (designfile != "") { m->setDesignFile(designfile); } orderfile = validParameter.validFile(parameters, "order", true); if (orderfile == "not open") { m->mothurOut("Ignoring: " + parameters["order"]); m->mothurOutEndLine(); orderfile = ""; } else if (orderfile == "not found") { orderfile = ""; } if (orderfile != "") { m->setOrderFile(orderfile); } treefile = validParameter.validFile(parameters, "tree", true); if (treefile == "not open") { m->mothurOut("Ignoring: " + parameters["tree"]); m->mothurOutEndLine(); treefile = ""; } else if (treefile == "not found") { treefile = ""; } if (treefile != "") { m->setTreeFile(treefile); } sharedfile = validParameter.validFile(parameters, "shared", true); if (sharedfile == "not open") { m->mothurOut("Ignoring: " + parameters["shared"]); m->mothurOutEndLine(); sharedfile = ""; } else if (sharedfile == "not found") { sharedfile = ""; } if (sharedfile != "") { m->setSharedFile(sharedfile); } ordergroupfile = validParameter.validFile(parameters, "ordergroup", true); if (ordergroupfile == "not open") { m->mothurOut("Ignoring: " + parameters["ordergroup"]); m->mothurOutEndLine(); ordergroupfile = ""; } else if (ordergroupfile == "not found") { ordergroupfile = ""; } if (ordergroupfile != "") { m->setOrderGroupFile(ordergroupfile); } relabundfile = validParameter.validFile(parameters, "relabund", true); if (relabundfile == "not open") { m->mothurOut("Ignoring: " + parameters["relabund"]); m->mothurOutEndLine(); relabundfile = ""; } else if (relabundfile == "not found") { relabundfile = ""; } if (relabundfile != "") { m->setRelAbundFile(relabundfile); } fastafile = validParameter.validFile(parameters, "fasta", true); if (fastafile == "not open") { m->mothurOut("Ignoring: " + parameters["fasta"]); m->mothurOutEndLine(); fastafile = ""; } else if (fastafile == "not found") { fastafile = ""; } if (fastafile != "") { m->setFastaFile(fastafile); } qualfile = validParameter.validFile(parameters, "qfile", true); if (qualfile == "not open") { m->mothurOut("Ignoring: " + parameters["qfile"]); m->mothurOutEndLine(); qualfile = ""; } else if (qualfile == "not found") { qualfile = ""; } if (qualfile != "") { m->setQualFile(qualfile); } sfffile = validParameter.validFile(parameters, "sff", true); if (sfffile == "not open") { m->mothurOut("Ignoring: " + parameters["sff"]); m->mothurOutEndLine(); sfffile = ""; } else if (sfffile == "not found") { sfffile = ""; } if (sfffile != "") { m->setSFFFile(sfffile); } oligosfile = validParameter.validFile(parameters, "oligos", true); if (oligosfile == "not open") { m->mothurOut("Ignoring: " + parameters["oligos"]); m->mothurOutEndLine(); oligosfile = ""; } else if (oligosfile == "not found") { oligosfile = ""; } if (oligosfile != "") { m->setOligosFile(oligosfile); } accnosfile = validParameter.validFile(parameters, "accnos", true); if (accnosfile == "not open") { m->mothurOut("Ignoring: " + parameters["accnos"]); m->mothurOutEndLine(); accnosfile = ""; } else if (accnosfile == "not found") { accnosfile = ""; } if (accnosfile != "") { m->setAccnosFile(accnosfile); } taxonomyfile = validParameter.validFile(parameters, "taxonomy", true); if (taxonomyfile == "not open") { m->mothurOut("Ignoring: " + parameters["taxonomy"]); m->mothurOutEndLine(); taxonomyfile = ""; } else if (taxonomyfile == "not found") { taxonomyfile = ""; } if (taxonomyfile != "") { m->setTaxonomyFile(taxonomyfile); } flowfile = validParameter.validFile(parameters, "flow", true); if (flowfile == "not open") { m->mothurOut("Ignoring: " + parameters["flow"]); m->mothurOutEndLine(); flowfile = ""; } else if (flowfile == "not found") { flowfile = ""; } if (flowfile != "") { m->setFlowFile(flowfile); } biomfile = validParameter.validFile(parameters, "biom", true); if (biomfile == "not open") { m->mothurOut("Ignoring: " + parameters["biom"]); m->mothurOutEndLine(); biomfile = ""; } else if (biomfile == "not found") { biomfile = ""; } if (biomfile != "") { m->setBiomFile(biomfile); } summaryfile = validParameter.validFile(parameters, "summary", true); if (summaryfile == "not open") { m->mothurOut("Ignoring: " + parameters["summary"]); m->mothurOutEndLine(); summaryfile = ""; } else if (summaryfile == "not found") { summaryfile = ""; } if (summaryfile != "") { m->setSummaryFile(summaryfile); } string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } m->setProcessors(temp); clearTypes = validParameter.validFile(parameters, "clear", false); if (clearTypes == "not found") { clearTypes = ""; } else { m->splitAtDash(clearTypes, types); } } } catch(exception& e) { m->errorOut(e, "SetCurrentCommand", "SetCurrentCommand"); exit(1); } }
DeconvoluteCommand::DeconvoluteCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string, string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (!validParameter.isValidParameter(it->first, myArray, it->second)) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["fasta"] = tempOutNames; outputTypes["name"] = tempOutNames; outputTypes["count"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.valid(parameters, "inputdir"); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("fasta"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } it = parameters.find("count"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["count"] = inputDir + it->second; } } } //check for required parameters fastafile = validParameter.validFile(parameters, "fasta"); if (fastafile == "not open") { abort = true; } else if (fastafile == "not found") { fastafile = current->getFastaFile(); if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; } }else { current->setFastaFile(fastafile); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){ outputDir = ""; outputDir += util.hasPath(fastafile); //if user entered a file with a path then preserve it } namefile = validParameter.validFile(parameters, "name"); if (namefile == "not open") { namefile = ""; abort = true; } else if (namefile == "not found"){ namefile = ""; } else { current->setNameFile(namefile); } countfile = validParameter.validFile(parameters, "count"); if (countfile == "not open") { abort = true; countfile = ""; } else if (countfile == "not found") { countfile = ""; } else { current->setCountFile(countfile); } if ((countfile != "") && (namefile != "")) { m->mothurOut("When executing a unique.seqs command you must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; } format = validParameter.valid(parameters, "format"); if(format == "not found"){ if (countfile != "") { format = "count"; } else { format = "name"; } } if ((format != "name") && (format != "count")) { m->mothurOut(format + " is not a valid format option. Options are count or name."); if (countfile == "") { m->mothurOut("I will use name.\n"); format = "name"; } else { m->mothurOut("I will use count.\n"); format = "count"; } } if (countfile == "") { if (namefile == "") { vector<string> files; files.push_back(fastafile); if (!current->getMothurCalling()) { parser.getNameFile(files); } } } } } catch(exception& e) { m->errorOut(e, "DeconvoluteCommand", "DeconvoluteCommand"); exit(1); } }
AnosimCommand::AnosimCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; //check to make sure all parameters are valid for command map<string,string>::iterator it; for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["anosim"] = tempOutNames; //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("design"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["design"] = inputDir + it->second; } } it = parameters.find("phylip"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["phylip"] = inputDir + it->second; } } } phylipFileName = validParameter.validFile(parameters, "phylip", true); if (phylipFileName == "not open") { phylipFileName = ""; abort = true; } else if (phylipFileName == "not found") { //if there is a current phylip file, use it phylipFileName = m->getPhylipFile(); if (phylipFileName != "") { m->mothurOut("Using " + phylipFileName + " as input file for the phylip parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current phylip file and the phylip parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->setPhylipFile(phylipFileName); } //check for required parameters designFileName = validParameter.validFile(parameters, "design", true); if (designFileName == "not open") { designFileName = ""; abort = true; } else if (designFileName == "not found") { //if there is a current design file, use it designFileName = m->getDesignFile(); if (designFileName != "") { m->mothurOut("Using " + designFileName + " as input file for the design parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current design file and the design parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->setDesignFile(designFileName); } string temp = validParameter.validFile(parameters, "iters", false); if (temp == "not found") { temp = "1000"; } m->mothurConvert(temp, iters); temp = validParameter.validFile(parameters, "alpha", false); if (temp == "not found") { temp = "0.05"; } m->mothurConvert(temp, experimentwiseAlpha); } } catch(exception& e) { m->errorOut(e, "AnosimCommand", "AnosimCommand"); exit(1); } }
//********************************************************************************************************************** RareFactCommand::RareFactCommand(string option) { try { abort = false; calledHelp = false; allLines = 1; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); map<string,string>::iterator it; ValidParameters validParameter; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["rarefaction"] = tempOutNames; outputTypes["r_chao"] = tempOutNames; outputTypes["r_ace"] = tempOutNames; outputTypes["r_jack"] = tempOutNames; outputTypes["r_shannon"] = tempOutNames; outputTypes["r_shannoneven"] = tempOutNames; outputTypes["r_shannonrange"] = tempOutNames; outputTypes["r_heip"] = tempOutNames; outputTypes["r_smithwilson"] = tempOutNames; outputTypes["r_npshannon"] = tempOutNames; outputTypes["r_simpson"] = tempOutNames; outputTypes["r_simpsoneven"] = tempOutNames; outputTypes["r_invsimpson"] = tempOutNames; outputTypes["r_bootstrap"] = tempOutNames; outputTypes["r_coverage"] = tempOutNames; outputTypes["r_nseqs"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("shared"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["shared"] = inputDir + it->second; } } it = parameters.find("rabund"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["rabund"] = inputDir + it->second; } } it = parameters.find("sabund"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["sabund"] = inputDir + it->second; } } it = parameters.find("list"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["list"] = inputDir + it->second; } } } //check for required parameters listfile = validParameter.validFile(parameters, "list", true); if (listfile == "not open") { listfile = ""; abort = true; } else if (listfile == "not found") { listfile = ""; } else { format = "list"; inputfile = listfile; m->setListFile(listfile); } sabundfile = validParameter.validFile(parameters, "sabund", true); if (sabundfile == "not open") { sabundfile = ""; abort = true; } else if (sabundfile == "not found") { sabundfile = ""; } else { format = "sabund"; inputfile = sabundfile; m->setSabundFile(sabundfile); } rabundfile = validParameter.validFile(parameters, "rabund", true); if (rabundfile == "not open") { rabundfile = ""; abort = true; } else if (rabundfile == "not found") { rabundfile = ""; } else { format = "rabund"; inputfile = rabundfile; m->setRabundFile(rabundfile); } sharedfile = validParameter.validFile(parameters, "shared", true); if (sharedfile == "not open") { sharedfile = ""; abort = true; } else if (sharedfile == "not found") { sharedfile = ""; } else { format = "sharedfile"; inputfile = sharedfile; m->setSharedFile(sharedfile); } if ((sharedfile == "") && (listfile == "") && (rabundfile == "") && (sabundfile == "")) { //is there are current file available for any of these? //give priority to shared, then list, then rabund, then sabund //if there is a current shared file, use it sharedfile = m->getSharedFile(); if (sharedfile != "") { inputfile = sharedfile; format = "sharedfile"; m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); } else { listfile = m->getListFile(); if (listfile != "") { inputfile = listfile; format = "list"; m->mothurOut("Using " + listfile + " as input file for the list parameter."); m->mothurOutEndLine(); } else { rabundfile = m->getRabundFile(); if (rabundfile != "") { inputfile = rabundfile; format = "rabund"; m->mothurOut("Using " + rabundfile + " as input file for the rabund parameter."); m->mothurOutEndLine(); } else { sabundfile = m->getSabundFile(); if (sabundfile != "") { inputfile = sabundfile; format = "sabund"; m->mothurOut("Using " + sabundfile + " as input file for the sabund parameter."); m->mothurOutEndLine(); } else { m->mothurOut("No valid current files. You must provide a list, sabund, rabund or shared file before you can use the collect.single command."); m->mothurOutEndLine(); abort = true; } } } } } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = m->hasPath(inputfile); } //check for optional parameter and set defaults // ...at some point should added some additional type checking... label = validParameter.validFile(parameters, "label", false); if (label == "not found") { label = ""; } else { if(label != "all") { m->splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } calc = validParameter.validFile(parameters, "calc", false); if (calc == "not found") { calc = "sobs"; } else { if (calc == "default") { calc = "sobs"; } } m->splitAtDash(calc, Estimators); if (m->inUsersGroups("citation", Estimators)) { ValidCalculators validCalc; validCalc.printCitations(Estimators); //remove citation from list of calcs for (int i = 0; i < Estimators.size(); i++) { if (Estimators[i] == "citation") { Estimators.erase(Estimators.begin()+i); break; } } } string temp; temp = validParameter.validFile(parameters, "freq", false); if (temp == "not found") { temp = "100"; } m->mothurConvert(temp, freq); temp = validParameter.validFile(parameters, "abund", false); if (temp == "not found") { temp = "10"; } m->mothurConvert(temp, abund); temp = validParameter.validFile(parameters, "iters", false); if (temp == "not found") { temp = "1000"; } m->mothurConvert(temp, nIters); temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } m->setProcessors(temp); m->mothurConvert(temp, processors); temp = validParameter.validFile(parameters, "alpha", false); if (temp == "not found") { temp = "1"; } m->mothurConvert(temp, alpha); if ((alpha != 0) && (alpha != 1) && (alpha != 2)) { m->mothurOut("[ERROR]: Not a valid alpha value. Valid values are 0, 1 and 2."); m->mothurOutEndLine(); abort=true; } temp = validParameter.validFile(parameters, "groupmode", false); if (temp == "not found") { temp = "T"; } groupMode = m->isTrue(temp); } } catch(exception& e) { m->errorOut(e, "RareFactCommand", "RareFactCommand"); exit(1); } }
//********************************************************************************************************************** ClassifyOtuCommand::ClassifyOtuCommand(string option) { try{ abort = false; calledHelp = false; allLines = 1; labels.clear(); //allow user to run help if (option == "help") { help(); abort = true; calledHelp = true; }else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; map<string, string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["constaxonomy"] = tempOutNames; outputTypes["taxsummary"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("list"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["list"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } it = parameters.find("taxonomy"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["taxonomy"] = inputDir + it->second; } } it = parameters.find("reftaxonomy"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["reftaxonomy"] = inputDir + it->second; } } it = parameters.find("group"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["group"] = inputDir + it->second; } } it = parameters.find("count"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["count"] = inputDir + it->second; } } } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } //check for required parameters listfile = validParameter.validFile(parameters, "list", true); if (listfile == "not found") { //if there is a current list file, use it listfile = m->getListFile(); if (listfile != "") { m->mothurOut("Using " + listfile + " as input file for the list parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current listfile and the list parameter is required."); m->mothurOutEndLine(); abort = true; } } else if (listfile == "not open") { abort = true; } else { m->setListFile(listfile); } taxfile = validParameter.validFile(parameters, "taxonomy", true); if (taxfile == "not found") { //if there is a current list file, use it taxfile = m->getTaxonomyFile(); if (taxfile != "") { m->mothurOut("Using " + taxfile + " as input file for the taxonomy parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current taxonomy file and the taxonomy parameter is required."); m->mothurOutEndLine(); abort = true; } } else if (taxfile == "not open") { abort = true; } else { m->setTaxonomyFile(taxfile); } refTaxonomy = validParameter.validFile(parameters, "reftaxonomy", true); if (refTaxonomy == "not found") { refTaxonomy = ""; m->mothurOut("reftaxonomy is not required, but if given will keep the rankIDs in the summary file static."); m->mothurOutEndLine(); } else if (refTaxonomy == "not open") { abort = true; } namefile = validParameter.validFile(parameters, "name", true); if (namefile == "not open") { namefile = ""; abort = true; } else if (namefile == "not found") { namefile = ""; } else { m->setNameFile(namefile); } groupfile = validParameter.validFile(parameters, "group", true); if (groupfile == "not open") { abort = true; } else if (groupfile == "not found") { groupfile = ""; } else { m->setGroupFile(groupfile); } countfile = validParameter.validFile(parameters, "count", true); if (countfile == "not open") { countfile = ""; abort = true; } else if (countfile == "not found") { countfile = ""; } else { m->setCountTableFile(countfile); } if ((namefile != "") && (countfile != "")) { m->mothurOut("[ERROR]: you may only use one of the following: name or count."); m->mothurOutEndLine(); abort = true; } if ((groupfile != "") && (countfile != "")) { m->mothurOut("[ERROR]: you may only use one of the following: group or count."); m->mothurOutEndLine(); abort=true; } //check for optional parameter and set defaults // ...at some point should added some additional type checking... label = validParameter.validFile(parameters, "label", false); if (label == "not found") { label = ""; allLines = 1; } else { if(label != "all") { m->splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } basis = validParameter.validFile(parameters, "basis", false); if (basis == "not found") { basis = "otu"; } if ((basis != "otu") && (basis != "sequence")) { m->mothurOut("Invalid option for basis. basis options are otu and sequence, using otu."); m->mothurOutEndLine(); } string temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found") { temp = "51"; } m->mothurConvert(temp, cutoff); temp = validParameter.validFile(parameters, "probs", false); if (temp == "not found"){ temp = "true"; } probs = m->isTrue(temp); temp = validParameter.validFile(parameters, "persample", false); if (temp == "not found"){ temp = "f"; } persample = m->isTrue(temp); if ((groupfile == "") && (countfile == "")) { if (persample) { m->mothurOut("persample is only valid with a group file, or count file with group information. Setting persample=f.\n"); persample = false; } } if (countfile != "") { CountTable cts; if (!cts.testGroups(countfile)) { if (persample) { m->mothurOut("persample is only valid with a group file, or count file with group information. Setting persample=f.\n"); persample = false; } } } if ((cutoff < 51) || (cutoff > 100)) { m->mothurOut("cutoff must be above 50, and no greater than 100."); m->mothurOutEndLine(); abort = true; } if (countfile == "") { if (namefile == ""){ vector<string> files; files.push_back(taxfile); parser.getNameFile(files); } } } } catch(exception& e) { m->errorOut(e, "ClassifyOtuCommand", "ClassifyOtuCommand"); exit(1); } }
MergeGroupsCommand::MergeGroupsCommand(string option) { try { abort = false; calledHelp = false; allLines = 1; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; //check to make sure all parameters are valid for command map<string,string>::iterator it; for (it = parameters.begin(); it != parameters.end(); it++) { if (!validParameter.isValidParameter(it->first, myArray, it->second)) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["shared"] = tempOutNames; outputTypes["group"] = tempOutNames; outputTypes["count"] = tempOutNames; //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){ outputDir = ""; } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.valid(parameters, "inputdir"); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("design"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["design"] = inputDir + it->second; } } it = parameters.find("shared"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["shared"] = inputDir + it->second; } } it = parameters.find("group"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["group"] = inputDir + it->second; } } it = parameters.find("count"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["count"] = inputDir + it->second; } } it = parameters.find("fasta"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } } //check for required parameters designfile = validParameter.validFile(parameters, "design"); if (designfile == "not open") { abort = true; } else if (designfile == "not found") { //if there is a current shared file, use it designfile = current->getDesignFile(); if (designfile != "") { m->mothurOut("Using " + designfile + " as input file for the design parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current designfile and the design parameter is required."); m->mothurOutEndLine(); abort = true; } }else { current->setDesignFile(designfile); } sharedfile = validParameter.validFile(parameters, "shared"); if (sharedfile == "not open") { abort = true; sharedfile = ""; } else if (sharedfile == "not found") { sharedfile = ""; } else { current->setSharedFile(sharedfile); } groupfile = validParameter.validFile(parameters, "group"); if (groupfile == "not open") { abort = true; groupfile = ""; } else if (groupfile == "not found") { groupfile = ""; } else { current->setGroupFile(groupfile); } countfile = validParameter.validFile(parameters, "count"); if (countfile == "not open") { abort = true; countfile = ""; } else if (countfile == "not found") { countfile = ""; } else { current->setCountFile(countfile); } fastafile = validParameter.validFile(parameters, "fasta"); if (fastafile == "not open") { abort = true; countfile = ""; } else if (fastafile == "not found") { fastafile = ""; } else { current->setFastaFile(fastafile); } //check for optional parameter and set defaults // ...at some point should added some additional type checking... label = validParameter.valid(parameters, "label"); if (label == "not found") { label = ""; } else { if(label != "all") { util.splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } groups = validParameter.valid(parameters, "groups"); if (groups == "not found") { groups = "all"; } util.splitAtDash(groups, Groups); if (Groups.size() != 0) { if (Groups[0]== "all") { Groups.clear(); } } method = validParameter.valid(parameters, "method"); if(method == "not found"){ method = "sum"; } if ((method != "sum") && (method != "average") && (method != "median")) { m->mothurOut(method + " is not a valid method. Options are sum, average and median. I will use sum."); m->mothurOutEndLine(); method = "sum"; } if ((groupfile != "") && (countfile != "")) { m->mothurOut("[ERROR]: you may only use one of the following: group or count."); m->mothurOutEndLine(); abort=true; } if ((sharedfile == "") && (groupfile == "") && (countfile == "")) { //give priority to group, then shared groupfile = current->getGroupFile(); if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); } else { sharedfile = current->getSharedFile(); if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); } else { countfile = current->getCountFile(); if (countfile != "") { m->mothurOut("Using " + countfile + " as input file for the count parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current groupfile, countfile or sharedfile and one is required."); m->mothurOutEndLine(); abort = true; } } } } if ((countfile == "") && (fastafile != "")) { m->mothurOut("[ERROR]: You may only use the fasta file with the count file, quitting."); m->mothurOutEndLine(); abort=true; } else if ((countfile != "") && (method == "average")) { m->mothurOut("You may not use the average method with the count file. I will use the sum method."); m->mothurOutEndLine(); method = "sum"; } else if ((countfile != "") && (method == "median") && (fastafile == "")) { fastafile = current->getFastaFile(); if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter."); m->mothurOutEndLine(); } else { m->mothurOut("[ERROR]: Fasta file is required with the median method and a count file so that sequences removed from your count table can also be removed from your fasta file to avoid downstream file mismatches, quitting.\n"); abort=true; } } } } catch(exception& e) { m->errorOut(e, "MergeGroupsCommand", "MergeGroupsCommand"); exit(1); } }
//********************************************************************************************************************** SplitGroupCommand::SplitGroupCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; map<string, string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["fasta"] = tempOutNames; outputTypes["name"] = tempOutNames; outputTypes["count"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("group"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["group"] = inputDir + it->second; } } it = parameters.find("fasta"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } it = parameters.find("count"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["count"] = inputDir + it->second; } } } namefile = validParameter.validFile(parameters, "name", true); if (namefile == "not open") { namefile = ""; abort = true; } else if (namefile == "not found") { namefile = ""; } else { m->setNameFile(namefile); } fastafile = validParameter.validFile(parameters, "fasta", true); if (fastafile == "not open") { abort = true; } else if (fastafile == "not found") { fastafile = m->getFastaFile(); if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->setFastaFile(fastafile); } groupfile = validParameter.validFile(parameters, "group", true); if (groupfile == "not open") { groupfile = ""; abort = true; } else if (groupfile == "not found") { groupfile = ""; }else { m->setGroupFile(groupfile); } countfile = validParameter.validFile(parameters, "count", true); if (countfile == "not open") { countfile = ""; abort = true; } else if (countfile == "not found") { countfile = ""; } else { m->setCountTableFile(countfile); } if ((countfile != "") && (namefile != "")) { m->mothurOut("You must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; } if ((countfile != "") && (groupfile != "")) { m->mothurOut("You must enter ONLY ONE of the following: count or group."); m->mothurOutEndLine(); abort = true; } if ((countfile == "") && (groupfile == "")) { if (namefile == "") { //check for count then group countfile = m->getCountTableFile(); if (countfile != "") { m->mothurOut("Using " + countfile + " as input file for the count parameter."); m->mothurOutEndLine(); } else { groupfile = m->getGroupFile(); if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You need to provide a count or group file."); m->mothurOutEndLine(); abort = true; } } }else { //check for group groupfile = m->getGroupFile(); if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You need to provide a count or group file."); m->mothurOutEndLine(); abort = true; } } } groups = validParameter.validFile(parameters, "groups", false); if (groups == "not found") { groups = ""; } else { m->splitAtDash(groups, Groups); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ if (groupfile != "") { outputDir = m->hasPath(groupfile); } else { outputDir = m->hasPath(countfile); } } if (countfile == "") { if (namefile == "") { vector<string> files; files.push_back(fastafile); parser.getNameFile(files); } } } } catch(exception& e) { m->errorOut(e, "SplitGroupCommand", "SplitAbundCommand"); exit(1); } }
PreClusterCommand::PreClusterCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; map<string, string>::iterator it; //check to make sure all parameters are valid for command for (map<string, string>::iterator it2 = parameters.begin(); it2 != parameters.end(); it2++) { if (validParameter.isValidParameter(it2->first, myArray, it2->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["fasta"] = tempOutNames; outputTypes["name"] = tempOutNames; outputTypes["map"] = tempOutNames; outputTypes["count"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("fasta"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } it = parameters.find("group"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["group"] = inputDir + it->second; } } it = parameters.find("count"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["count"] = inputDir + it->second; } } } //check for required parameters fastafile = validParameter.validFile(parameters, "fasta", true); if (fastafile == "not found") { fastafile = m->getFastaFile(); if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; } } else if (fastafile == "not open") { abort = true; } else { m->setFastaFile(fastafile); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; outputDir += m->hasPath(fastafile); //if user entered a file with a path then preserve it } //check for optional parameter and set defaults // ...at some point should added some additional type checking... namefile = validParameter.validFile(parameters, "name", true); if (namefile == "not found") { namefile = ""; } else if (namefile == "not open") { namefile = ""; abort = true; } else { m->setNameFile(namefile); } groupfile = validParameter.validFile(parameters, "group", true); if (groupfile == "not found") { groupfile = ""; bygroup = false; } else if (groupfile == "not open") { abort = true; groupfile = ""; } else { m->setGroupFile(groupfile); bygroup = true; } countfile = validParameter.validFile(parameters, "count", true); if (countfile == "not found") { countfile = ""; } else if (countfile == "not open") { abort = true; countfile = ""; } else { m->setCountTableFile(countfile); ct.readTable(countfile, true, false); if (ct.hasGroupInfo()) { bygroup = true; } else { bygroup = false; } } if ((namefile != "") && (countfile != "")) { m->mothurOut("[ERROR]: you may only use one of the following: name or count."); m->mothurOutEndLine(); abort = true; } if ((groupfile != "") && (countfile != "")) { m->mothurOut("[ERROR]: you may only use one of the following: group or count."); m->mothurOutEndLine(); abort=true; } string temp = validParameter.validFile(parameters, "diffs", false); if(temp == "not found"){ temp = "1"; } m->mothurConvert(temp, diffs); temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } m->setProcessors(temp); m->mothurConvert(temp, processors); temp = validParameter.validFile(parameters, "topdown", false); if(temp == "not found"){ temp = "T"; } topdown = m->isTrue(temp); temp = validParameter.validFile(parameters, "match", false); if (temp == "not found"){ temp = "1.0"; } m->mothurConvert(temp, match); temp = validParameter.validFile(parameters, "mismatch", false); if (temp == "not found"){ temp = "-1.0"; } m->mothurConvert(temp, misMatch); if (misMatch > 0) { m->mothurOut("[ERROR]: mismatch must be negative.\n"); abort=true; } temp = validParameter.validFile(parameters, "gapopen", false); if (temp == "not found"){ temp = "-2.0"; } m->mothurConvert(temp, gapOpen); if (gapOpen > 0) { m->mothurOut("[ERROR]: gapopen must be negative.\n"); abort=true; } temp = validParameter.validFile(parameters, "gapextend", false); if (temp == "not found"){ temp = "-1.0"; } m->mothurConvert(temp, gapExtend); if (gapExtend > 0) { m->mothurOut("[ERROR]: gapextend must be negative.\n"); abort=true; } align = validParameter.validFile(parameters, "align", false); if (align == "not found"){ align = "needleman"; } method = "unaligned"; if (countfile == "") { if (namefile == "") { vector<string> files; files.push_back(fastafile); parser.getNameFile(files); } } } } catch(exception& e) { m->errorOut(e, "PreClusterCommand", "PreClusterCommand"); exit(1); } }
//********************************************************************************************************************** NewCommand::NewCommand(string option) { try { //////////////////////////////////////////////////////// /////////////////// start leave alone block //////////// //////////////////////////////////////////////////////// abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { //valid paramters for this command vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string,string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (!validParameter.isValidParameter(it->first, myArray, it->second)) { abort = true; } } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.valid(parameters, "inputdir"); if (inputDir == "not found"){ inputDir = ""; } else { /////////////////////////////////////////////////////////////// //////////////// stop leave alone block /////////////////////// /////////////////////////////////////////////////////////////// //edit file types below to include only the types you added as parameters string path; it = parameters.find("phylip"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["phylip"] = inputDir + it->second; } } it = parameters.find("column"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["column"] = inputDir + it->second; } } it = parameters.find("fasta"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } it = parameters.find("shared"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["shared"] = inputDir + it->second; } } } /////////////////////////////////////////////////////////////////////////////// /////////// example of getting filenames and checking dependancies //////////// // the validParameter class will make sure file exists, fill with correct // // and name is current is given /////////////////////////////////////////////// /////////////////////////////////////////////////////////////////////////////// ///variables for examples below that you will most likely want to put in the header for //use by the other class functions. string phylipfile, columnfile, namefile, fastafile, sharedfile, method, countfile; int processors; bool useTiming, allLines; vector<string> Estimators, Groups; set<string> labels; //if allLines is used it should be initialized to 1 above. //check for parameters phylipfile = validParameter.validFile(parameters, "phylip"); if (phylipfile == "not open") { phylipfile = ""; abort = true; } else if (phylipfile == "not found") { phylipfile = ""; } else { current->setPhylipFile(phylipfile); } columnfile = validParameter.validFile(parameters, "column"); if (columnfile == "not open") { columnfile = ""; abort = true; } else if (columnfile == "not found") { columnfile = ""; } else { current->setColumnFile(columnfile); } namefile = validParameter.validFile(parameters, "name"); if (namefile == "not open") { abort = true; } else if (namefile == "not found") { namefile = ""; } else { current->setNameFile(namefile); } //get fastafile - it is not required fastafile = validParameter.validFile(parameters, "fasta"); if (fastafile == "not open") { fastafile = ""; abort=true; } else if (fastafile == "not found") { fastafile = ""; } if (fastafile != "") { current->setFastaFile(fastafile); } if ((phylipfile == "") && (columnfile == "")) { //is there are current file available for either of these? //give priority to column, then phylip columnfile = current->getColumnFile(); if (columnfile != "") { m->mothurOut("Using " + columnfile + " as input file for the column parameter."); m->mothurOutEndLine(); } else { phylipfile = current->getPhylipFile(); if (phylipfile != "") { m->mothurOut("Using " + phylipfile + " as input file for the phylip parameter."); m->mothurOutEndLine(); } else { m->mothurOut("No valid current files. You must provide a phylip or column file before you can use the cluster command."); m->mothurOutEndLine(); abort = true; } } } else if ((phylipfile != "") && (columnfile != "")) { m->mothurOut("When executing a cluster command you must enter ONLY ONE of the following: phylip or column."); m->mothurOutEndLine(); abort = true; } if (columnfile != "") { if (namefile == "") { namefile = current->getNameFile(); if (namefile != "") { m->mothurOut("Using " + namefile + " as input file for the name parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You need to provide a namefile if you are going to use the column format."); m->mothurOutEndLine(); abort = true; } } } //get shared file, it is required sharedfile = validParameter.validFile(parameters, "shared"); if (sharedfile == "not open") { sharedfile = ""; abort = true; } else if (sharedfile == "not found") { //if there is a current shared file, use it sharedfile = current->getSharedFile(); if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current sharedfile and the shared parameter is required."); m->mothurOutEndLine(); abort = true; } }else { current->setSharedFile(sharedfile); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){ outputDir = util.hasPath(sharedfile); //if user entered a file with a path then preserve it } ////////////////////////////////////////////////////////////////////// ////////// example of getting other types of parameters ////////////// ////////////////////////////////////////////////////////////////////// //use only one Mutliple type method = validParameter.valid(parameters, "method"); if (method == "not found") { method = "average"; } if ((method == "furthest") || (method == "nearest") || (method == "average") || (method == "weighted")) { } else { m->mothurOut("Not a valid clustering method. Valid clustering algorithms are furthest, nearest, average, and weighted."); m->mothurOutEndLine(); abort = true; } //use more than one multiple type. do not check to make sure the entry is valid. string calc = validParameter.valid(parameters, "calc"); if (calc == "not found") { calc = "sobs-chao-ace-jack-shannon-npshannon-simpson"; } else { if (calc == "default") { calc = "sobs-chao-ace-jack-shannon-npshannon-simpson"; } } util.splitAtDash(calc, Estimators); //Boolean type - m->isTrue looks for t, true, f or false and is case insensitive string timing = validParameter.valid(parameters, "timing"); if (timing == "not found") { timing = "F"; } useTiming = util.isTrue(timing); //Number type - mothurConvert makes sure the convert can happen to avoid a crash. string temp = validParameter.valid(parameters, "processors"); if (temp == "not found"){ temp = current->getProcessors(); } processors = current->setProcessors(temp); //Groups must be checked later to make sure they are valid. SharedUtilities has functions of check the validity, just make to so m->setGroups() after the checks. If you are using these with a shared file no need to check the SharedRAbundVector class will call SharedUtilites for you, kinda nice, huh? string groups = validParameter.valid(parameters, "groups"); if (groups == "not found") { groups = ""; } else { util.splitAtDash(groups, Groups); if (Groups.size() != 0) { if (Groups[0]== "all") { Groups.clear(); } } } //Commonly used to process list, rabund, sabund, shared and relabund files. Look at "smart distancing" examples below in the execute function. string label = validParameter.valid(parameters, "label"); if (label == "not found") { label = ""; } else { if(label != "all") { util.splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } //if your command has a namefile as an option, you may want ot check to see if there is a current namefile //saved by mothur that is associated with the other files you are using as inputs. //You can do so by adding the files associated with the namefile to the files vector and then asking parser to check. //This saves our users headaches over file mismatches because they forgot to include the namefile, :) if (countfile == "") { if (namefile == "") { vector<string> files; files.push_back(fastafile); if (!current->getMothurCalling()) { parser.getNameFile(files); } } } } } catch(exception& e) { m->errorOut(e, "NewCommand", "NewCommand"); exit(1); } }
SensSpecCommand::SensSpecCommand(string option) { try { abort = false; calledHelp = false; allLines = 1; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { string temp; vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string,string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["sensspec"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("list"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["list"] = inputDir + it->second; } } it = parameters.find("phylip"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["phylip"] = inputDir + it->second; } } it = parameters.find("column"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["column"] = inputDir + it->second; } } } //check for required parameters listFile = validParameter.validFile(parameters, "list", true); if (listFile == "not found") { listFile = m->getListFile(); if (listFile != "") { m->mothurOut("Using " + listFile + " as input file for the list parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current list file and the list parameter is required."); m->mothurOutEndLine(); abort = true; } } else if (listFile == "not open") { abort = true; } else { m->setListFile(listFile); } phylipfile = validParameter.validFile(parameters, "phylip", true); if (phylipfile == "not found") { phylipfile = ""; } else if (phylipfile == "not open") { abort = true; } else { distFile = phylipfile; format = "phylip"; m->setPhylipFile(phylipfile); } columnfile = validParameter.validFile(parameters, "column", true); if (columnfile == "not found") { columnfile = ""; } else if (columnfile == "not open") { abort = true; } else { distFile = columnfile; format = "column"; m->setColumnFile(columnfile); } if ((phylipfile == "") && (columnfile == "")) { //is there are current file available for either of these? //give priority to column, then phylip columnfile = m->getColumnFile(); if (columnfile != "") { distFile = columnfile; format = "column"; m->mothurOut("Using " + columnfile + " as input file for the column parameter."); m->mothurOutEndLine(); } else { phylipfile = m->getPhylipFile(); if (phylipfile != "") { distFile = phylipfile; format = "phylip"; m->mothurOut("Using " + phylipfile + " as input file for the phylip parameter."); m->mothurOutEndLine(); } else { m->mothurOut("No valid current files. You must provide a phylip or column file."); m->mothurOutEndLine(); abort = true; } } }else if ((phylipfile != "") && (columnfile != "")) { m->mothurOut("When executing a sens.spec command you must enter ONLY ONE of the following: phylip or column."); m->mothurOutEndLine(); abort = true; } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; outputDir += m->hasPath(listFile); //if user entered a file with a path then preserve it } //check for optional parameter and set defaults // ...at some point should added some additional type checking... temp = validParameter.validFile(parameters, "hard", false); if (temp == "not found"){ hard = 0; } else if(!m->isTrue(temp)) { hard = 0; } else if(m->isTrue(temp)) { hard = 1; } temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found") { temp = "-1.00"; } m->mothurConvert(temp, cutoff); // cout << cutoff << endl; temp = validParameter.validFile(parameters, "precision", false); if (temp == "not found") { temp = "100"; } m->mothurConvert(temp, precision); // cout << precision << endl; string label = validParameter.validFile(parameters, "label", false); if (label == "not found") { label = ""; } else { if(label != "all") { m->splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } map<string, string> variables; variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(listFile)); sensSpecFileName = getOutputFileName("sensspec",variables); } } catch(exception& e) { m->errorOut(e, "SensSpecCommand", "SensSpecCommand"); exit(1); } }
MatrixOutputCommand::MatrixOutputCommand(string option) { try { abort = false; calledHelp = false; allLines = 1; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); map<string,string>::iterator it; ValidParameters validParameter; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["phylip"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("shared"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["shared"] = inputDir + it->second; } } } sharedfile = validParameter.validFile(parameters, "shared", true); if (sharedfile == "not found") { //if there is a current shared file, use it sharedfile = m->getSharedFile(); if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current sharedfile and the shared parameter is required."); m->mothurOutEndLine(); abort = true; } }else if (sharedfile == "not open") { sharedfile = ""; abort = true; } else { m->setSharedFile(sharedfile); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; outputDir += m->hasPath(sharedfile); //if user entered a file with a path then preserve it } //check for optional parameter and set defaults // ...at some point should added some additional type checking... label = validParameter.validFile(parameters, "label", false); if (label == "not found") { label = ""; } else { if(label != "all") { m->splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } output = validParameter.validFile(parameters, "output", false); if(output == "not found"){ output = "lt"; } if ((output != "lt") && (output != "square") && (output != "column")) { m->mothurOut(output + " is not a valid output form. Options are lt, column and square. I will use lt."); m->mothurOutEndLine(); output = "lt"; } mode = validParameter.validFile(parameters, "mode", false); if(mode == "not found"){ mode = "average"; } if ((mode != "average") && (mode != "median")) { m->mothurOut(mode + " is not a valid mode. Options are average and medina. I will use average."); m->mothurOutEndLine(); output = "average"; } groups = validParameter.validFile(parameters, "groups", false); if (groups == "not found") { groups = ""; } else { m->splitAtDash(groups, Groups); m->setGroups(Groups); } string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } m->setProcessors(temp); m->mothurConvert(temp, processors); calc = validParameter.validFile(parameters, "calc", false); if (calc == "not found") { calc = "jclass-thetayc"; } else { if (calc == "default") { calc = "jclass-thetayc"; } } m->splitAtDash(calc, Estimators); if (m->inUsersGroups("citation", Estimators)) { ValidCalculators validCalc; validCalc.printCitations(Estimators); //remove citation from list of calcs for (int i = 0; i < Estimators.size(); i++) { if (Estimators[i] == "citation") { Estimators.erase(Estimators.begin()+i); break; } } } temp = validParameter.validFile(parameters, "iters", false); if (temp == "not found") { temp = "1000"; } m->mothurConvert(temp, iters); temp = validParameter.validFile(parameters, "subsample", false); if (temp == "not found") { temp = "F"; } if (m->isNumeric1(temp)) { m->mothurConvert(temp, subsampleSize); subsample = true; } else { if (m->isTrue(temp)) { subsample = true; subsampleSize = -1; } //we will set it to smallest group later else { subsample = false; } } if (subsample == false) { iters = 0; } if (abort == false) { ValidCalculators validCalculator; int i; for (i=0; i<Estimators.size(); i++) { if (validCalculator.isValidCalculator("matrix", Estimators[i]) == true) { if (Estimators[i] == "sharedsobs") { matrixCalculators.push_back(new SharedSobsCS()); }else if (Estimators[i] == "sharedchao") { matrixCalculators.push_back(new SharedChao1()); }else if (Estimators[i] == "sharedace") { matrixCalculators.push_back(new SharedAce()); }else if (Estimators[i] == "jabund") { matrixCalculators.push_back(new JAbund()); }else if (Estimators[i] == "sorabund") { matrixCalculators.push_back(new SorAbund()); }else if (Estimators[i] == "jclass") { matrixCalculators.push_back(new Jclass()); }else if (Estimators[i] == "sorclass") { matrixCalculators.push_back(new SorClass()); }else if (Estimators[i] == "jest") { matrixCalculators.push_back(new Jest()); }else if (Estimators[i] == "sorest") { matrixCalculators.push_back(new SorEst()); }else if (Estimators[i] == "thetayc") { matrixCalculators.push_back(new ThetaYC()); }else if (Estimators[i] == "thetan") { matrixCalculators.push_back(new ThetaN()); }else if (Estimators[i] == "kstest") { matrixCalculators.push_back(new KSTest()); }else if (Estimators[i] == "sharednseqs") { matrixCalculators.push_back(new SharedNSeqs()); }else if (Estimators[i] == "ochiai") { matrixCalculators.push_back(new Ochiai()); }else if (Estimators[i] == "anderberg") { matrixCalculators.push_back(new Anderberg()); }else if (Estimators[i] == "kulczynski") { matrixCalculators.push_back(new Kulczynski()); }else if (Estimators[i] == "kulczynskicody") { matrixCalculators.push_back(new KulczynskiCody()); }else if (Estimators[i] == "lennon") { matrixCalculators.push_back(new Lennon()); }else if (Estimators[i] == "morisitahorn") { matrixCalculators.push_back(new MorHorn()); }else if (Estimators[i] == "braycurtis") { matrixCalculators.push_back(new BrayCurtis()); }else if (Estimators[i] == "whittaker") { matrixCalculators.push_back(new Whittaker()); }else if (Estimators[i] == "odum") { matrixCalculators.push_back(new Odum()); }else if (Estimators[i] == "canberra") { matrixCalculators.push_back(new Canberra()); }else if (Estimators[i] == "structeuclidean") { matrixCalculators.push_back(new StructEuclidean()); }else if (Estimators[i] == "structchord") { matrixCalculators.push_back(new StructChord()); }else if (Estimators[i] == "hellinger") { matrixCalculators.push_back(new Hellinger()); }else if (Estimators[i] == "manhattan") { matrixCalculators.push_back(new Manhattan()); }else if (Estimators[i] == "structpearson") { matrixCalculators.push_back(new StructPearson()); }else if (Estimators[i] == "soergel") { matrixCalculators.push_back(new Soergel()); }else if (Estimators[i] == "spearman") { matrixCalculators.push_back(new Spearman()); }else if (Estimators[i] == "structkulczynski") { matrixCalculators.push_back(new StructKulczynski()); }else if (Estimators[i] == "speciesprofile") { matrixCalculators.push_back(new SpeciesProfile()); }else if (Estimators[i] == "hamming") { matrixCalculators.push_back(new Hamming()); }else if (Estimators[i] == "structchi2") { matrixCalculators.push_back(new StructChi2()); }else if (Estimators[i] == "gower") { matrixCalculators.push_back(new Gower()); }else if (Estimators[i] == "memchi2") { matrixCalculators.push_back(new MemChi2()); }else if (Estimators[i] == "memchord") { matrixCalculators.push_back(new MemChord()); }else if (Estimators[i] == "memeuclidean") { matrixCalculators.push_back(new MemEuclidean()); }else if (Estimators[i] == "mempearson") { matrixCalculators.push_back(new MemPearson()); }else if (Estimators[i] == "jsd") { matrixCalculators.push_back(new JSD()); }else if (Estimators[i] == "rjsd") { matrixCalculators.push_back(new RJSD()); } } } } } } catch(exception& e) { m->errorOut(e, "MatrixOutputCommand", "MatrixOutputCommand"); exit(1); } }
//********************************************************************************************************************** PipelineCommand::PipelineCommand(string option) { try { cFactory = CommandFactory::getInstance(); abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; map<string, string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("sff"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["sff"] = inputDir + it->second; } } it = parameters.find("oligos"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["oligos"] = inputDir + it->second; } } it = parameters.find("align"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["align"] = inputDir + it->second; } } it = parameters.find("chimera"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["chimera"] = inputDir + it->second; } } it = parameters.find("classify"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["classify"] = inputDir + it->second; } } it = parameters.find("taxonomy"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["taxonomy"] = inputDir + it->second; } } it = parameters.find("pipeline"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["pipeline"] = inputDir + it->second; } } } outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } pipeFilename = validParameter.validFile(parameters, "pipeline", true); if (pipeFilename == "not found") { pipeFilename = ""; } else if (pipeFilename == "not open") { pipeFilename = ""; abort = true; } string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } m->setProcessors(temp); m->mothurConvert(temp, processors); if (pipeFilename != "") { abort = readUsersPipeline(); }else{ sffFile = validParameter.validFile(parameters, "sff", true); if (sffFile == "not found") { m->mothurOut("sff is a required parameter for the pipeline command."); m->mothurOutEndLine(); abort = true; } else if (sffFile == "not open") { sffFile = ""; abort = true; } else { m->setSFFFile(sffFile); } oligosFile = validParameter.validFile(parameters, "oligos", true); if (oligosFile == "not found") { m->mothurOut("oligos is a required parameter for the pipeline command."); m->mothurOutEndLine(); abort = true; } else if (oligosFile == "not open") { oligosFile = ""; abort = true; } alignFile = validParameter.validFile(parameters, "align", true); if (alignFile == "not found") { m->mothurOut("align is a required parameter for the pipeline command. Please provide the template to align with."); m->mothurOutEndLine(); abort = true; } else if (alignFile == "not open") { alignFile = ""; abort = true; } chimeraFile = validParameter.validFile(parameters, "chimera", true); if (chimeraFile == "not found") { m->mothurOut("chimera is a required parameter for the pipeline command. Please provide the template to check for chimeras with."); m->mothurOutEndLine(); abort = true; } else if (chimeraFile == "not open") { chimeraFile = ""; abort = true; } classifyFile = validParameter.validFile(parameters, "classify", true); if (classifyFile == "not found") { m->mothurOut("classify is a required parameter for the pipeline command. Please provide the template to use with the classifier."); m->mothurOutEndLine(); abort = true; } else if (classifyFile == "not open") { classifyFile = ""; abort = true; } taxonomyFile = validParameter.validFile(parameters, "taxonomy", true); if (taxonomyFile == "not found") { m->mothurOut("taxonomy is a required parameter for the pipeline command."); m->mothurOutEndLine(); abort = true; } else if (taxonomyFile == "not open") { taxonomyFile = ""; abort = true; } } } } catch(exception& e) { m->errorOut(e, "PipelineCommand", "PipelineCommand"); exit(1); } }
//********************************************************************************************************************** OtuHierarchyCommand::OtuHierarchyCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string,string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["otuheirarchy"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("list"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["list"] = inputDir + it->second; } } } listFile = validParameter.validFile(parameters, "list", true); if (listFile == "not found") { listFile = m->getListFile(); if (listFile != "") { m->mothurOut("Using " + listFile + " as input file for the list parameter."); m->mothurOutEndLine(); } else { m->mothurOut("No valid current list file. You must provide a list file."); m->mothurOutEndLine(); abort = true; } }else if (listFile == "not open") { abort = true; } else { m->setListFile(listFile); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; outputDir += m->hasPath(listFile); //if user entered a file with a path then preserve it } //check for optional parameter and set defaults // ...at some point should added some additional type checking... label = validParameter.validFile(parameters, "label", false); if (label == "not found") { m->mothurOut("label is a required parameter for the otu.hierarchy command."); m->mothurOutEndLine(); abort = true; } else { m->splitAtDash(label, labels); if (labels.size() != 2) { m->mothurOut("You must provide 2 labels."); m->mothurOutEndLine(); abort = true; } } output = validParameter.validFile(parameters, "output", false); if (output == "not found") { output = "name"; } if ((output != "name") && (output != "number")) { m->mothurOut("output options are name and number. I will use name."); m->mothurOutEndLine(); output = "name"; } } } catch(exception& e) { m->errorOut(e, "OtuHierarchyCommand", "OtuHierarchyCommand"); exit(1); } }
SffMultipleCommand::SffMultipleCommand(string option) { try { abort = false; calledHelp = false; append=false; makeGroup=false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { //valid paramters for this command vector<string> myArray = setParameters(); OptionParser parser(option); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; map<string,string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["fasta"] = tempOutNames; outputTypes["name"] = tempOutNames; outputTypes["group"] = tempOutNames; //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } //if the user changes the input directory command factory will send this info to us in the output parameter inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("file"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["file"] = inputDir + it->second; } } it = parameters.find("lookup"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["lookup"] = inputDir + it->second; } } } filename = validParameter.validFile(parameters, "file", true); if (filename == "not open") { filename = ""; abort = true; } else if (filename == "not found") { filename = ""; } string temp; temp = validParameter.validFile(parameters, "trim", false); if (temp == "not found"){ temp = "T"; } trim = m->isTrue(temp); temp = validParameter.validFile(parameters, "minflows", false); if (temp == "not found") { temp = "450"; } m->mothurConvert(temp, minFlows); temp = validParameter.validFile(parameters, "maxflows", false); if (temp == "not found") { temp = "450"; } m->mothurConvert(temp, maxFlows); temp = validParameter.validFile(parameters, "maxhomop", false); if (temp == "not found"){ temp = "9"; } m->mothurConvert(temp, maxHomoP); temp = validParameter.validFile(parameters, "signal", false); if (temp == "not found"){ temp = "0.50"; } m->mothurConvert(temp, signal); temp = validParameter.validFile(parameters, "noise", false); if (temp == "not found"){ temp = "0.70"; } m->mothurConvert(temp, noise); temp = validParameter.validFile(parameters, "bdiffs", false); if (temp == "not found"){ temp = "0"; } m->mothurConvert(temp, bdiffs); temp = validParameter.validFile(parameters, "pdiffs", false); if (temp == "not found"){ temp = "0"; } m->mothurConvert(temp, pdiffs); temp = validParameter.validFile(parameters, "ldiffs", false); if (temp == "not found") { temp = "0"; } m->mothurConvert(temp, ldiffs); temp = validParameter.validFile(parameters, "sdiffs", false); if (temp == "not found") { temp = "0"; } m->mothurConvert(temp, sdiffs); temp = validParameter.validFile(parameters, "tdiffs", false); if (temp == "not found") { int tempTotal = pdiffs + bdiffs + ldiffs + sdiffs; temp = toString(tempTotal); } m->mothurConvert(temp, tdiffs); if(tdiffs == 0){ tdiffs = bdiffs + pdiffs + ldiffs + sdiffs; } temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } m->setProcessors(temp); m->mothurConvert(temp, processors); temp = validParameter.validFile(parameters, "order", false); if (temp == "not found"){ temp = "A"; } if (temp.length() > 1) { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true; } else { if (toupper(temp[0]) == 'A') { flowOrder = "A"; } else if(toupper(temp[0]) == 'B'){ flowOrder = "B"; } else if(toupper(temp[0]) == 'I'){ flowOrder = "I"; } else { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true; } } temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found"){ temp = "0.01"; } m->mothurConvert(temp, cutoff); temp = validParameter.validFile(parameters, "mindelta", false); if (temp == "not found"){ temp = "0.000001"; } minDelta = temp; temp = validParameter.validFile(parameters, "maxiter", false); if (temp == "not found"){ temp = "1000"; } m->mothurConvert(temp, maxIters); temp = validParameter.validFile(parameters, "large", false); if (temp == "not found"){ temp = "0"; } m->mothurConvert(temp, largeSize); if (largeSize != 0) { large = true; } else { large = false; } if (largeSize < 0) { m->mothurOut("The value of the large cannot be negative.\n"); } temp = validParameter.validFile(parameters, "sigma", false);if (temp == "not found") { temp = "60"; } m->mothurConvert(temp, sigma); temp = validParameter.validFile(parameters, "flip", false); if (temp == "not found") { flip = 0; } else { flip = m->isTrue(temp); } temp = validParameter.validFile(parameters, "maxambig", false); if (temp == "not found") { temp = "-1"; } m->mothurConvert(temp, maxAmbig); temp = validParameter.validFile(parameters, "minlength", false); if (temp == "not found") { temp = "0"; } m->mothurConvert(temp, minLength); temp = validParameter.validFile(parameters, "maxlength", false); if (temp == "not found") { temp = "0"; } m->mothurConvert(temp, maxLength); temp = validParameter.validFile(parameters, "keepfirst", false); if (temp == "not found") { temp = "0"; } convert(temp, keepFirst); temp = validParameter.validFile(parameters, "removelast", false); if (temp == "not found") { temp = "0"; } convert(temp, removeLast); temp = validParameter.validFile(parameters, "allfiles", false); if (temp == "not found") { temp = "F"; } allFiles = m->isTrue(temp); temp = validParameter.validFile(parameters, "keepforward", false); if (temp == "not found") { temp = "F"; } keepforward = m->isTrue(temp); temp = validParameter.validFile(parameters, "lookup", true); if (temp == "not found") { string path = m->argv; string tempPath = path; for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); } path = path.substr(0, (tempPath.find_last_of('m'))); #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix) path += "lookupFiles/"; #else path += "lookupFiles\\"; #endif lookupFileName = m->getFullPathName(path) + "LookUp_Titanium.pat"; bool ableToOpen = m->checkLocations(lookupFileName, inputDir); if (!ableToOpen) { abort=true; } }else if(temp == "not open") { lookupFileName = validParameter.validFile(parameters, "lookup", false); //if you can't open it its not inputDir, try mothur excutable location string exepath = m->argv; string tempPath = exepath; for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); } exepath = exepath.substr(0, (tempPath.find_last_of('m'))); string tryPath = m->getFullPathName(exepath) + m->getSimpleName(lookupFileName); m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine(); ifstream in2; int ableToOpen = m->openInputFile(tryPath, in2, "noerror"); in2.close(); lookupFileName = tryPath; if (ableToOpen == 1) { m->mothurOut("Unable to open " + lookupFileName + "."); m->mothurOutEndLine(); abort=true; } }else { lookupFileName = temp; } } } catch(exception& e) { m->errorOut(e, "SffMultipleCommand", "SffMultipleCommand"); exit(1); } }
//********************************************************************************************************************** GetSAbundCommand::GetSAbundCommand(string option) { try { abort = false; calledHelp = false; allLines = 1; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); map<string,string>::iterator it; ValidParameters validParameter; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["sabund"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("list"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["list"] = inputDir + it->second; } } it = parameters.find("rabund"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["rabund"] = inputDir + it->second; } } } //check for required parameters listfile = validParameter.validFile(parameters, "list", true); if (listfile == "not open") { listfile = ""; abort = true; } else if (listfile == "not found") { listfile = ""; } else { format = "list"; inputfile = listfile; m->setListFile(listfile); } rabundfile = validParameter.validFile(parameters, "rabund", true); if (rabundfile == "not open") { rabundfile = ""; abort = true; } else if (rabundfile == "not found") { rabundfile = ""; } else { format = "rabund"; inputfile = rabundfile; m->setRabundFile(rabundfile); } //check for optional parameter and set defaults // ...at some point should added some additional type checking... label = validParameter.validFile(parameters, "label", false); if (label == "not found") { label = ""; } else { if(label != "all") { m->splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } if ((listfile == "") && (rabundfile == "")) { //is there are current file available for any of these? //give priority to shared, then list, then rabund, then sabund //if there is a current shared file, use it listfile = m->getListFile(); if (listfile != "") { inputfile = listfile; format = "list"; m->mothurOut("Using " + listfile + " as input file for the list parameter."); m->mothurOutEndLine(); } else { rabundfile = m->getRabundFile(); if (rabundfile != "") { inputfile = rabundfile; format = "rabund"; m->mothurOut("Using " + rabundfile + " as input file for the rabund parameter."); m->mothurOutEndLine(); } else { m->mothurOut("No valid current files. You must provide a list or rabund file."); m->mothurOutEndLine(); abort = true; } } } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = m->hasPath(inputfile); } } } catch(exception& e) { m->errorOut(e, "GetSAbundCommand", "GetSAbundCommand"); exit(1); } }
//*************************************************************************************************************** DegapSeqsCommand::DegapSeqsCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string,string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (!validParameter.isValidParameter(it->first, myArray, it->second)) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["fasta"] = tempOutNames; string inputDir = validParameter.valid(parameters, "inputdir"); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("fasta"); if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } } fastafile = validParameter.validFile(parameters, "fasta"); if (fastafile == "not found") { fastafile = current->getFastaFile(); if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter.\n"); } else { m->mothurOut("[ERROR]: You have no current fasta file and the fasta parameter is required.\n"); abort = true; } } else if (fastafile == "not open") { abort = true; } else { current->setFastaFile(fastafile); } string temp = validParameter.valid(parameters, "processors"); if (temp == "not found"){ temp = current->getProcessors(); } processors = current->setProcessors(temp); //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){ outputDir = ""; outputDir += util.hasPath(fastafile); //if user entered a file with a path then preserve it } } } catch(exception& e) { m->errorOut(e, "DegapSeqsCommand", "DegapSeqsCommand"); exit(1); } }
bool PipelineCommand::checkForValidAndRequiredParameters(string name, string options, map<string, vector<string> >& mothurMadeFiles){ try { if (name == "system") { return false; } //get shell of the command so we can check to make sure its valid without running it Command* command = cFactory->getCommand(name); //check to make sure all parameters are valid for command vector<string> validParameters = command->setParameters(); OptionParser parser(options); map<string, string> parameters = parser.getParameters(); ValidParameters validParameter; map<string, string>::iterator it; map<string, vector<string> >::iterator itMade; for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, validParameters, it->second) != true) { return true; } // not valid if (it->second == "current") { itMade = mothurMadeFiles.find(it->first); if (itMade == mothurMadeFiles.end()) { m->mothurOut("You have the " + it->first + " listed as a current file for the " + name + " command, but it seems mothur will not make that file in your current pipeline, please correct."); m->mothurOutEndLine(); return true; } } } //is the command missing any required vector<CommandParameter> commandParameters = command->getParameters(); vector<string> requiredParameters; for (int i = 0; i < commandParameters.size(); i++) { if (commandParameters[i].required) { requiredParameters.push_back(commandParameters[i].name); } } for (int i = 0; i < requiredParameters.size(); i++) { it = parameters.find(requiredParameters[i]); if (it == parameters.end()) { string paraToLookFor = requiredParameters[i]; //does mothur have a current file for this? itMade = mothurMadeFiles.find(requiredParameters[i]); if (itMade == mothurMadeFiles.end()) { m->mothurOut(name + " requires the " + requiredParameters[i] + " parameter, please correct."); m->mothurOutEndLine(); } } } //update MothurMade map<string, vector<string> > thisCommandsFile = command->getOutputFiles(); for (itMade = thisCommandsFile.begin(); itMade != thisCommandsFile.end(); itMade++) { mothurMadeFiles[itMade->first] = itMade->second; //adds any new types } return false; } catch(exception& e) { m->errorOut(e, "PipelineCommand", "checkForValidAndRequiredParameters"); exit(1); } }
RenameSeqsCommand::RenameSeqsCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string, string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } vector<string> tempOutNames; outputTypes["fasta"] = tempOutNames; outputTypes["name"] = tempOutNames; outputTypes["group"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("fasta"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["fasta"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } it = parameters.find("group"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["group"] = inputDir + it->second; } } } //check for required parameters fastaFile = validParameter.validFile(parameters, "fasta", true); if (fastaFile == "not open") { abort = true; } else if (fastaFile == "not found") { fastaFile = m->getFastaFile(); if (fastaFile != "") { m->mothurOut("Using " + fastaFile + " as input file for the fasta parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->setFastaFile(fastaFile); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; outputDir += m->hasPath(fastaFile); //if user entered a file with a path then preserve it } groupfile = validParameter.validFile(parameters, "group", true); if (groupfile == "not open") { abort = true; } else if (groupfile == "not found") { groupfile = m->getGroupFile(); if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current groupfile and the group parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->setGroupFile(groupfile); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } nameFile = validParameter.validFile(parameters, "name", true); if (nameFile == "not open") { abort = true; } else if (nameFile == "not found"){ nameFile =""; } else { m->setNameFile(nameFile); } if (nameFile == "") { vector<string> files; files.push_back(fastaFile); parser.getNameFile(files); } } } catch(exception& e) { m->errorOut(e, "RenameSeqsCommand", "RenameSeqsCommand"); exit(1); } }
MetaStatsCommand::MetaStatsCommand(string option) { try { abort = false; calledHelp = false; allLines = 1; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; //check to make sure all parameters are valid for command map<string,string>::iterator it; for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["metastats"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("design"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["design"] = inputDir + it->second; } } it = parameters.find("shared"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["shared"] = inputDir + it->second; } } } //check for required parameters sharedfile = validParameter.validFile(parameters, "shared", true); if (sharedfile == "not open") { abort = true; } else if (sharedfile == "not found") { //if there is a current shared file, use it sharedfile = m->getSharedFile(); if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current sharedfile and the shared parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->setSharedFile(sharedfile); } //check for required parameters designfile = validParameter.validFile(parameters, "design", true); if (designfile == "not open") { abort = true; } else if (designfile == "not found") { //if there is a current design file, use it designfile = m->getDesignFile(); if (designfile != "") { m->mothurOut("Using " + designfile + " as input file for the design parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current designfile and the design parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->setDesignFile(designfile); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; outputDir += m->hasPath(sharedfile); //if user entered a file with a path then preserve it } //check for optional parameter and set defaults // ...at some point should added some additional type checking... label = validParameter.validFile(parameters, "label", false); if (label == "not found") { label = ""; } else { if(label != "all") { m->splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } groups = validParameter.validFile(parameters, "groups", false); if (groups == "not found") { groups = ""; pickedGroups = false; } else { pickedGroups = true; m->splitAtDash(groups, Groups); m->setGroups(Groups); } sets = validParameter.validFile(parameters, "sets", false); if (sets == "not found") { sets = ""; } else { m->splitAtDash(sets, Sets); } string temp = validParameter.validFile(parameters, "iters", false); if (temp == "not found") { temp = "1000"; } m->mothurConvert(temp, iters); temp = validParameter.validFile(parameters, "threshold", false); if (temp == "not found") { temp = "0.05"; } m->mothurConvert(temp, threshold); temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } m->setProcessors(temp); m->mothurConvert(temp, processors); } } catch(exception& e) { m->errorOut(e, "MetaStatsCommand", "MetaStatsCommand"); exit(1); } }
//********************************************************************************************************************** CollectSharedCommand::CollectSharedCommand(string option) { try { abort = false; calledHelp = false; allLines = 1; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters=parser.getParameters(); map<string,string>::iterator it; ValidParameters validParameter; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //initialize outputTypes vector<string> tempOutNames; outputTypes["sharedchao"] = tempOutNames; outputTypes["sharedsobs"] = tempOutNames; outputTypes["sharedace"] = tempOutNames; outputTypes["jabund"] = tempOutNames; outputTypes["sorabund"] = tempOutNames; outputTypes["jclass"] = tempOutNames; outputTypes["sorclass"] = tempOutNames; outputTypes["jest"] = tempOutNames; outputTypes["sorest"] = tempOutNames; outputTypes["thetayc"] = tempOutNames; outputTypes["thetan"] = tempOutNames; outputTypes["kstest"] = tempOutNames; outputTypes["whittaker"] = tempOutNames; outputTypes["sharednseqs"] = tempOutNames; outputTypes["ochiai"] = tempOutNames; outputTypes["anderberg"] = tempOutNames; outputTypes["kulczynski"] = tempOutNames; outputTypes["kulczynskicody"] = tempOutNames; outputTypes["lennon"] = tempOutNames; outputTypes["morisitahorn"] = tempOutNames; outputTypes["braycurtis"] = tempOutNames; outputTypes["odum"] = tempOutNames; outputTypes["canberra"] = tempOutNames; outputTypes["structeuclidean"] = tempOutNames; outputTypes["structchord"] = tempOutNames; outputTypes["hellinger"] = tempOutNames; outputTypes["manhattan"] = tempOutNames; outputTypes["structpearson"] = tempOutNames; outputTypes["soergel"] = tempOutNames; outputTypes["spearman"] = tempOutNames; outputTypes["structkulczynski"] = tempOutNames; outputTypes["speciesprofile"] = tempOutNames; outputTypes["structchi2"] = tempOutNames; outputTypes["hamming"] = tempOutNames; outputTypes["gower"] = tempOutNames; outputTypes["memchi2"] = tempOutNames; outputTypes["memchord"] = tempOutNames; outputTypes["memeuclidean"] = tempOutNames; outputTypes["mempearson"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("shared"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["shared"] = inputDir + it->second; } } } //get shared file sharedfile = validParameter.validFile(parameters, "shared", true); if (sharedfile == "not open") { sharedfile = ""; abort = true; } else if (sharedfile == "not found") { //if there is a current shared file, use it sharedfile = m->getSharedFile(); if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current sharedfile and the shared parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->setSharedFile(sharedfile); } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = m->hasPath(sharedfile); } //check for optional parameter and set defaults // ...at some point should added some additional type checking.. label = validParameter.validFile(parameters, "label", false); if (label == "not found") { label = ""; } else { if(label != "all") { m->splitAtDash(label, labels); allLines = 0; } else { allLines = 1; } } calc = validParameter.validFile(parameters, "calc", false); if (calc == "not found") { calc = "sharedsobs-sharedchao-sharedace-jabund-sorabund-jclass-sorclass-jest-sorest-thetayc-thetan"; } else { if (calc == "default") { calc = "sharedsobs-sharedchao-sharedace-jabund-sorabund-jclass-sorclass-jest-sorest-thetayc-thetan"; } } m->splitAtDash(calc, Estimators); if (m->inUsersGroups("citation", Estimators)) { ValidCalculators validCalc; validCalc.printCitations(Estimators); //remove citation from list of calcs for (int i = 0; i < Estimators.size(); i++) { if (Estimators[i] == "citation") { Estimators.erase(Estimators.begin()+i); break; } } } groups = validParameter.validFile(parameters, "groups", false); if (groups == "not found") { groups = ""; } else { m->splitAtDash(groups, Groups); } m->setGroups(Groups); string temp; temp = validParameter.validFile(parameters, "freq", false); if (temp == "not found") { temp = "100"; } m->mothurConvert(temp, freq); temp = validParameter.validFile(parameters, "all", false); if (temp == "not found") { temp = "false"; } all = m->isTrue(temp); if (abort == false) { string fileNameRoot = outputDir + m->getRootName(m->getSimpleName(sharedfile)); ValidCalculators validCalculator; for (int i=0; i<Estimators.size(); i++) { if (validCalculator.isValidCalculator("shared", Estimators[i]) == true) { if (Estimators[i] == "sharedchao") { cDisplays.push_back(new CollectDisplay(new SharedChao1(), new SharedOneColumnFile(fileNameRoot+"shared.chao"))); outputNames.push_back(fileNameRoot+"shared.chao"); outputTypes["sharedchao"].push_back(fileNameRoot+"shared.chao"); }else if (Estimators[i] == "sharedsobs") { cDisplays.push_back(new CollectDisplay(new SharedSobsCS(), new SharedOneColumnFile(fileNameRoot+"shared.sobs"))); outputNames.push_back(fileNameRoot+"shared.sobs"); outputTypes["sharedsobs"].push_back(fileNameRoot+"shared.sobs"); }else if (Estimators[i] == "sharedace") { cDisplays.push_back(new CollectDisplay(new SharedAce(), new SharedOneColumnFile(fileNameRoot+"shared.ace"))); outputNames.push_back(fileNameRoot+"shared.ace"); outputTypes["sharedace"].push_back(fileNameRoot+"shared.ace"); }else if (Estimators[i] == "jabund") { cDisplays.push_back(new CollectDisplay(new JAbund(), new SharedOneColumnFile(fileNameRoot+"jabund"))); outputNames.push_back(fileNameRoot+"jabund"); outputTypes["jabund"].push_back(fileNameRoot+"jabund"); }else if (Estimators[i] == "sorabund") { cDisplays.push_back(new CollectDisplay(new SorAbund(), new SharedOneColumnFile(fileNameRoot+"sorabund"))); outputNames.push_back(fileNameRoot+"sorabund"); outputTypes["sorabund"].push_back(fileNameRoot+"sorabund"); }else if (Estimators[i] == "jclass") { cDisplays.push_back(new CollectDisplay(new Jclass(), new SharedOneColumnFile(fileNameRoot+"jclass"))); outputNames.push_back(fileNameRoot+"jclass"); outputTypes["jclass"].push_back(fileNameRoot+"jclass"); }else if (Estimators[i] == "sorclass") { cDisplays.push_back(new CollectDisplay(new SorClass(), new SharedOneColumnFile(fileNameRoot+"sorclass"))); outputNames.push_back(fileNameRoot+"sorclass"); outputTypes["sorclass"].push_back(fileNameRoot+"sorclass"); }else if (Estimators[i] == "jest") { cDisplays.push_back(new CollectDisplay(new Jest(), new SharedOneColumnFile(fileNameRoot+"jest"))); outputNames.push_back(fileNameRoot+"jest"); outputTypes["jest"].push_back(fileNameRoot+"jest"); }else if (Estimators[i] == "sorest") { cDisplays.push_back(new CollectDisplay(new SorEst(), new SharedOneColumnFile(fileNameRoot+"sorest"))); outputNames.push_back(fileNameRoot+"sorest"); outputTypes["sorest"].push_back(fileNameRoot+"sorest"); }else if (Estimators[i] == "thetayc") { cDisplays.push_back(new CollectDisplay(new ThetaYC(), new SharedOneColumnFile(fileNameRoot+"thetayc"))); outputNames.push_back(fileNameRoot+"thetayc"); outputTypes["thetayc"].push_back(fileNameRoot+"thetayc"); }else if (Estimators[i] == "thetan") { cDisplays.push_back(new CollectDisplay(new ThetaN(), new SharedOneColumnFile(fileNameRoot+"thetan"))); outputNames.push_back(fileNameRoot+"thetan"); outputTypes["thetan"].push_back(fileNameRoot+"thetan"); }else if (Estimators[i] == "kstest") { cDisplays.push_back(new CollectDisplay(new KSTest(), new SharedOneColumnFile(fileNameRoot+"kstest"))); outputNames.push_back(fileNameRoot+"kstest"); outputTypes["kstest"].push_back(fileNameRoot+"kstest"); }else if (Estimators[i] == "whittaker") { cDisplays.push_back(new CollectDisplay(new Whittaker(), new SharedOneColumnFile(fileNameRoot+"whittaker"))); outputNames.push_back(fileNameRoot+"whittaker"); outputTypes["whittaker"].push_back(fileNameRoot+"whittaker"); }else if (Estimators[i] == "sharednseqs") { cDisplays.push_back(new CollectDisplay(new SharedNSeqs(), new SharedOneColumnFile(fileNameRoot+"shared.nseqs"))); outputNames.push_back(fileNameRoot+"shared.nseqs"); outputTypes["shared.nseqs"].push_back(fileNameRoot+"shared.nseqs"); }else if (Estimators[i] == "ochiai") { cDisplays.push_back(new CollectDisplay(new Ochiai(), new SharedOneColumnFile(fileNameRoot+"ochiai"))); outputNames.push_back(fileNameRoot+"ochiai"); outputTypes["ochiai"].push_back(fileNameRoot+"ochiai"); }else if (Estimators[i] == "anderberg") { cDisplays.push_back(new CollectDisplay(new Anderberg(), new SharedOneColumnFile(fileNameRoot+"anderberg"))); outputNames.push_back(fileNameRoot+"anderberg"); outputTypes["anderberg"].push_back(fileNameRoot+"anderberg"); }else if (Estimators[i] == "kulczynski") { cDisplays.push_back(new CollectDisplay(new Kulczynski(), new SharedOneColumnFile(fileNameRoot+"kulczynski"))); outputNames.push_back(fileNameRoot+"kulczynski"); outputTypes["kulczynski"].push_back(fileNameRoot+"kulczynski"); }else if (Estimators[i] == "kulczynskicody") { cDisplays.push_back(new CollectDisplay(new KulczynskiCody(), new SharedOneColumnFile(fileNameRoot+"kulczynskicody"))); outputNames.push_back(fileNameRoot+"kulczynskicody"); outputTypes["kulczynskicody"].push_back(fileNameRoot+"kulczynskicody"); }else if (Estimators[i] == "lennon") { cDisplays.push_back(new CollectDisplay(new Lennon(), new SharedOneColumnFile(fileNameRoot+"lennon"))); outputNames.push_back(fileNameRoot+"lennon"); outputTypes["lennon"].push_back(fileNameRoot+"lennon"); }else if (Estimators[i] == "morisitahorn") { cDisplays.push_back(new CollectDisplay(new MorHorn(), new SharedOneColumnFile(fileNameRoot+"morisitahorn"))); outputNames.push_back(fileNameRoot+"morisitahorn"); outputTypes["morisitahorn"].push_back(fileNameRoot+"morisitahorn"); }else if (Estimators[i] == "braycurtis") { cDisplays.push_back(new CollectDisplay(new BrayCurtis(), new SharedOneColumnFile(fileNameRoot+"braycurtis"))); outputNames.push_back(fileNameRoot+"braycurtis"); outputTypes["braycurtis"].push_back(fileNameRoot+"braycurtis"); }else if (Estimators[i] == "odum") { cDisplays.push_back(new CollectDisplay(new Odum(), new SharedOneColumnFile(fileNameRoot+"odum"))); outputNames.push_back(fileNameRoot+"odum"); outputTypes["odum"].push_back(fileNameRoot+"odum"); }else if (Estimators[i] == "canberra") { cDisplays.push_back(new CollectDisplay(new Canberra(), new SharedOneColumnFile(fileNameRoot+"canberra"))); outputNames.push_back(fileNameRoot+"canberra"); outputTypes["canberra"].push_back(fileNameRoot+"canberra"); }else if (Estimators[i] == "structeuclidean") { cDisplays.push_back(new CollectDisplay(new StructEuclidean(), new SharedOneColumnFile(fileNameRoot+"structeuclidean"))); outputNames.push_back(fileNameRoot+"structeuclidean"); outputTypes["structeuclidean"].push_back(fileNameRoot+"structeuclidean"); }else if (Estimators[i] == "structchord") { cDisplays.push_back(new CollectDisplay(new StructChord(), new SharedOneColumnFile(fileNameRoot+"structchord"))); outputNames.push_back(fileNameRoot+"structchord"); outputTypes["structchord"].push_back(fileNameRoot+"structchord"); }else if (Estimators[i] == "hellinger") { cDisplays.push_back(new CollectDisplay(new Hellinger(), new SharedOneColumnFile(fileNameRoot+"hellinger"))); outputNames.push_back(fileNameRoot+"hellinger"); outputTypes["hellinger"].push_back(fileNameRoot+"hellinger"); }else if (Estimators[i] == "manhattan") { cDisplays.push_back(new CollectDisplay(new Manhattan(), new SharedOneColumnFile(fileNameRoot+"manhattan"))); outputNames.push_back(fileNameRoot+"manhattan"); outputTypes["manhattan"].push_back(fileNameRoot+"manhattan"); }else if (Estimators[i] == "structpearson") { cDisplays.push_back(new CollectDisplay(new StructPearson(), new SharedOneColumnFile(fileNameRoot+"structpearson"))); outputNames.push_back(fileNameRoot+"structpearson"); outputTypes["structpearson"].push_back(fileNameRoot+"structpearson"); }else if (Estimators[i] == "soergel") { cDisplays.push_back(new CollectDisplay(new Soergel(), new SharedOneColumnFile(fileNameRoot+"soergel"))); outputNames.push_back(fileNameRoot+"soergel"); outputTypes["soergel"].push_back(fileNameRoot+"soergel"); }else if (Estimators[i] == "spearman") { cDisplays.push_back(new CollectDisplay(new Spearman(), new SharedOneColumnFile(fileNameRoot+"spearman"))); outputNames.push_back(fileNameRoot+"spearman"); outputTypes["spearman"].push_back(fileNameRoot+"spearman"); }else if (Estimators[i] == "structkulczynski") { cDisplays.push_back(new CollectDisplay(new StructKulczynski(), new SharedOneColumnFile(fileNameRoot+"structkulczynski"))); outputNames.push_back(fileNameRoot+"structkulczynski"); outputTypes["structkulczynski"].push_back(fileNameRoot+"structkulczynski"); }else if (Estimators[i] == "speciesprofile") { cDisplays.push_back(new CollectDisplay(new SpeciesProfile(), new SharedOneColumnFile(fileNameRoot+"speciesprofile"))); outputNames.push_back(fileNameRoot+"speciesprofile"); outputTypes["speciesprofile"].push_back(fileNameRoot+"speciesprofile"); }else if (Estimators[i] == "hamming") { cDisplays.push_back(new CollectDisplay(new Hamming(), new SharedOneColumnFile(fileNameRoot+"hamming"))); outputNames.push_back(fileNameRoot+"hamming"); outputTypes["hamming"].push_back(fileNameRoot+"hamming"); }else if (Estimators[i] == "structchi2") { cDisplays.push_back(new CollectDisplay(new StructChi2(), new SharedOneColumnFile(fileNameRoot+"structchi2"))); outputNames.push_back(fileNameRoot+"structchi2"); outputTypes["structchi2"].push_back(fileNameRoot+"structchi2"); }else if (Estimators[i] == "gower") { cDisplays.push_back(new CollectDisplay(new Gower(), new SharedOneColumnFile(fileNameRoot+"gower"))); outputNames.push_back(fileNameRoot+"gower"); outputTypes["gower"].push_back(fileNameRoot+"gower"); }else if (Estimators[i] == "memchi2") { cDisplays.push_back(new CollectDisplay(new MemChi2(), new SharedOneColumnFile(fileNameRoot+"memchi2"))); outputNames.push_back(fileNameRoot+"memchi2"); outputTypes["memchi2"].push_back(fileNameRoot+"memchi2"); }else if (Estimators[i] == "memchord") { cDisplays.push_back(new CollectDisplay(new MemChord(), new SharedOneColumnFile(fileNameRoot+"memchord"))); outputNames.push_back(fileNameRoot+"memchord"); outputTypes["memchord"].push_back(fileNameRoot+"memchord"); }else if (Estimators[i] == "memeuclidean") { cDisplays.push_back(new CollectDisplay(new MemEuclidean(), new SharedOneColumnFile(fileNameRoot+"memeuclidean"))); outputNames.push_back(fileNameRoot+"memeuclidean"); outputTypes["memeuclidean"].push_back(fileNameRoot+"memeuclidean"); }else if (Estimators[i] == "mempearson") { cDisplays.push_back(new CollectDisplay(new MemPearson(), new SharedOneColumnFile(fileNameRoot+"mempearson"))); outputNames.push_back(fileNameRoot+"mempearson"); outputTypes["mempearson"].push_back(fileNameRoot+"mempearson"); } } } } } } catch(exception& e) { m->errorOut(e, "CollectSharedCommand", "CollectSharedCommand"); exit(1); } }
SummaryQualCommand::SummaryQualCommand(string option) { try { abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; map<string,string>::iterator it; //check to make sure all parameters are valid for command for (it = parameters.begin(); it != parameters.end(); it++) { if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; } } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("qfile"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["qfile"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } it = parameters.find("count"); //user has given a template file if(it != parameters.end()){ path = m->hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["count"] = inputDir + it->second; } } } //initialize outputTypes vector<string> tempOutNames; outputTypes["summary"] = tempOutNames; //check for required parameters qualfile = validParameter.validFile(parameters, "qfile", true); if (qualfile == "not open") { qualfile = ""; abort = true; } else if (qualfile == "not found") { qualfile = m->getQualFile(); if (qualfile != "") { m->mothurOut("Using " + qualfile + " as input file for the qfile parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You have no current quality file and the qfile parameter is required."); m->mothurOutEndLine(); abort = true; } }else { m->setQualFile(qualfile); } namefile = validParameter.validFile(parameters, "name", true); if (namefile == "not open") { namefile = ""; abort = true; } else if (namefile == "not found") { namefile = ""; } else { m->setNameFile(namefile); } countfile = validParameter.validFile(parameters, "count", true); if (countfile == "not open") { abort = true; countfile = ""; } else if (countfile == "not found") { countfile = ""; } else { m->setCountTableFile(countfile); } if ((countfile != "") && (namefile != "")) { m->mothurOut("You must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; outputDir += m->hasPath(qualfile); //if user entered a file with a path then preserve it } string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } m->setProcessors(temp); m->mothurConvert(temp, processors); if (countfile == "") { if (namefile == "") { vector<string> files; files.push_back(qualfile); parser.getNameFile(files); } } } } catch(exception& e) { m->errorOut(e, "SummaryQualCommand", "SummaryQualCommand"); exit(1); } }
//********************************************************************************************************************** //This function checks to make sure the cluster command has no errors and then clusters based on the method chosen. ClusterDoturCommand::ClusterDoturCommand(string option) { try{ abort = false; calledHelp = false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } else if(option == "citation") { citation(); abort = true; calledHelp = true;} else { vector<string> myArray = setParameters(); OptionParser parser(option); map<string,string> parameters = parser.getParameters(); ValidParameters validParameter; //check to make sure all parameters are valid for command map<string,string>::iterator it; for (it = parameters.begin(); it != parameters.end(); it++) { if (!validParameter.isValidParameter(it->first, myArray, it->second)) { abort = true; } } //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.valid(parameters, "inputdir"); if (inputDir == "not found"){ inputDir = ""; } else { string path; it = parameters.find("phylip"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["phylip"] = inputDir + it->second; } } it = parameters.find("name"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["name"] = inputDir + it->second; } } it = parameters.find("count"); //user has given a template file if(it != parameters.end()){ path = util.hasPath(it->second); //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["count"] = inputDir + it->second; } } } //initialize outputTypes vector<string> tempOutNames; outputTypes["list"] = tempOutNames; outputTypes["rabund"] = tempOutNames; outputTypes["sabund"] = tempOutNames; //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){ outputDir = ""; } //check for required parameters phylipfile = validParameter.validFile(parameters, "phylip"); if (phylipfile == "not open") { abort = true; } else if (phylipfile == "not found") { phylipfile = current->getPhylipFile(); if (phylipfile != "") { m->mothurOut("Using " + phylipfile + " as input file for the phylip parameter."); m->mothurOutEndLine(); } else { m->mothurOut("You need to provide a phylip file with the cluster.classic command."); m->mothurOutEndLine(); abort = true; } }else { current->setPhylipFile(phylipfile); } //check for optional parameter and set defaults namefile = validParameter.validFile(parameters, "name"); if (namefile == "not open") { abort = true; namefile = ""; } else if (namefile == "not found") { namefile = ""; } else { current->setNameFile(namefile); } countfile = validParameter.validFile(parameters, "count"); if (countfile == "not open") { abort = true; countfile = ""; } else if (countfile == "not found") { countfile = ""; } else { current->setCountFile(countfile); } if ((countfile != "") && (namefile != "")) { m->mothurOut("When executing a cluster.classic command you must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; } string temp; temp = validParameter.valid(parameters, "precision"); if (temp == "not found") { temp = "100"; } //saves precision legnth for formatting below length = temp.length(); util.mothurConvert(temp, precision); temp = validParameter.valid(parameters, "cutoff"); if (temp == "not found") { temp = "10"; } util.mothurConvert(temp, cutoff); temp = validParameter.valid(parameters, "sim"); if (temp == "not found") { temp = "F"; } sim = util.isTrue(temp); method = validParameter.valid(parameters, "method"); if (method == "not found") { method = "average"; } if ((method == "furthest") || (method == "nearest") || (method == "average") || (method == "weighted")) { if (method == "furthest") { tag = "fn"; } else if (method == "nearest") { tag = "nn"; } else if (method == "average") { tag = "an"; } else if (method == "weighted") { tag = "wn"; } }else { m->mothurOut("Not a valid clustering method. Valid clustering algorithms are furthest, nearest, average, weighted."); m->mothurOutEndLine(); abort = true; } } } catch(exception& e) { m->errorOut(e, "ClusterDoturCommand", "ClusterCommand"); exit(1); } }