void test_score_sequence(void) {
char *seqa = "ATCGATCGATCGATCGATCGATCG";
char *seqb = "AACGATCGATCGATCGATCGATCG";
int cmp1[] = {1, -1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1};
int *cmp1_t = score_sequence(seqa, seqb, strlen(seqa));
TEST_INIT;
TEST_ARRAY(cmp1, cmp1_t, 24, "score_sequence");
TEST(sum(score_sequence(seqa, seqb, strlen(seqa)), strlen(seqa)) == 22, "sum of score_sequence");
TEST_CLOSE;
}
int main()
{
//fast access
using program_language = l_language::l_vm;
using compiler_flags = l_language::l_vm::compiler_flags;
//source file
std::string i_source = "scripts/function.ll";
int f_compier_flags = compiler_flags::EXECUTE;
//compiler object
program_language it_compiler;
//add libs
it_compiler.add_lib(l_language::l_base_lib);
it_compiler.add_lib("io", l_language::l_io_lib);
it_compiler.add_lib("os", l_language::l_os_lib);
//read code // "source.it"
std::ifstream source_file(i_source);
std::string source((std::istreambuf_iterator<char>(source_file)),
(std::istreambuf_iterator<char>()));
//compile
program_language::compiler_ouput compiler_ouput;
compiler_ouput = it_compiler.compile(source,f_compier_flags);
//ouput:
if(compiler_ouput.m_type & program_language::ERRORS)
{
std::cout << compiler_ouput.m_errors;
return -1;
}
//tests
TEST("pow2", // test name
pow2, // function
36.0f, // return
6.0f // args
);
TEST("diff", // test name
diff, // function
1.0f, // return
2.0f, 1.0f // args
);
TEST("fib", // test name
fib, // function
89.0f, // return
10.0f // args
);
TEST("super", // test name
super_test, // function
5.0f, // return
0.0f // args
);
TEST("for of", // test name
for_of_test, // function
15.0f, // return
0.0f // args
);
TEST("for in", // test name
for_in_test, // function
10.0f, // return
0.0f // args
);
TEST_TYPE_OF("is int", // test name
int_test, // function
INT, // return type
0 // args
);
TEST_TYPE_OF("is float", // test name
float_test, // function
FLOAT, // return type
0 // args
);
TEST_TYPE_OF("is string", // test name
string_test, // function
STRING, // return type
0 // args
);
std::vector<l_language::l_variable> array_test_values =
{
1.2f,
3,
l_language::l_string::const_new(it_compiler.get_gc(), "hello"),
l_language::l_string::const_new(it_compiler.get_gc(), "l"),
l_language::l_string::const_new(it_compiler.get_gc(), "language")
};
TEST_ARRAY("generic test array", // test name
array_test, // function
array_test_values, // return
0 // args
);
//1-100
int range_values = rand() % 100 + 1;
TEST("for range(len) rand", // test name
for_range_1_rand, // function
gauss(range_values-1), // return
range_values // args
);
TEST("for like c rand", // test name
for_c_like, // function
90, // return
0 // args
);
//0-(range_values-1)
int start_values = rand() % range_values - 1 ;
TEST("for range(start,len) rand", // test name
for_range_2_rand, // function
gauss(range_values-1)-gauss(start_values), // return
start_values,range_values // args
);
std::vector<l_language::l_variable> array_range_values =
{
1,
3
};
TEST_ARRAY("range(start,len,step)", // test name
range_3, // function
array_range_values, // return
1,5,2 // args
);
//lambda calc test
int rand_l_c_1 = rand() % 100 - 1 ;
TEST("lambda calc 1", // test name
lambda_calc_1, // function
rand_l_c_1, // return
rand_l_c_1 // args
);
int rand_l_2_n = rand() % 100 - 1 ;
int rand_l_2_c = rand() % 100 - 1 ;
int rand_l_2_d = rand() % 100 - 1 ;
int rand_l_2_ret = rand_l_2_n*(rand_l_2_c+rand_l_2_d);
TEST("lambda calc 2", // test name
lambda_calc_2, // function
rand_l_2_ret, // return
rand_l_2_n, rand_l_2_c, rand_l_2_d // args
);
TEST("lambda calc fib", // test name
lambda_calc_fib, // function
89.0f, // return
10.0f // args
);
//print success
std::cout << s_count_success << " of " << s_count_test << " successes" << std::endl;
//print fails
if(s_tests_fails.size())
for(const std::string& test_name : s_tests_fails)
std::cout << "- failed \"" << test_name << "\" test" << std::endl;
}