예제 #1
0
void _construct_graph_with_paths(dBGraph *graph,
                                 size_t kmer_size, size_t ncols,
                                 char **seqs, size_t nseqs,
                                 CorrectAlnParam path_params)
{
  size_t i;
  db_graph_alloc(graph, kmer_size, ncols, ncols, 1024);

  // Graph data
  graph->bktlocks = ctx_calloc(roundup_bits2bytes(graph->ht.num_of_buckets), 1);
  graph->col_edges = ctx_calloc(graph->ht.capacity * ncols, sizeof(Edges));
  graph->col_covgs = ctx_calloc(graph->ht.capacity * ncols, sizeof(Covg));
  graph->node_in_cols = ctx_calloc(roundup_bits2bytes(graph->ht.capacity) * ncols, 1);

  // Path data
  path_store_alloc(&graph->pstore, 1024, true, graph->ht.capacity, ncols);
  graph->pstore.kmer_locks = ctx_calloc(roundup_bits2bytes(graph->ht.capacity), 1);

  // Build graph
  for(i = 0; i < nseqs; i++)
    build_graph_from_str_mt(graph, 0, seqs[i], strlen(seqs[i]));

  graph->num_of_cols_used = MAX2(graph->num_of_cols_used, 1);

  GenPathWorker *gen_path_wrkr = gen_paths_workers_alloc(1, graph, NULL);

  for(i = 0; i < nseqs; i++)
    gen_paths_from_str_mt(gen_path_wrkr, seqs[i], path_params);

  gen_paths_workers_dealloc(gen_path_wrkr, 1);
}
예제 #2
0
static void _test_add_paths()
{
  test_status("Testing adding paths in generate_paths.c and gpath_fetch()");

  // Construct 1 colour graph with kmer-size=11
  dBGraph graph;
  size_t kmer_size = 11, ncols = 1;

  db_graph_alloc(&graph, kmer_size, ncols, ncols, 1024,
                 DBG_ALLOC_EDGES | DBG_ALLOC_COVGS |
                 DBG_ALLOC_BKTLOCKS | DBG_ALLOC_NODE_IN_COL);

  // Create a path store that tracks path counts
  gpath_store_alloc(&graph.gpstore,
                    graph.num_of_cols, graph.ht.capacity,
                    0, ONE_MEGABYTE, true, false);

  // Create path hash table for fast lookup
  gpath_hash_alloc(&graph.gphash, &graph.gpstore, ONE_MEGABYTE);

  build_graph_from_str_mt(&graph, 0, seq0, strlen(seq0));
  build_graph_from_str_mt(&graph, 0, seq1, strlen(seq1));
  build_graph_from_str_mt(&graph, 0, seq2, strlen(seq2));
  build_graph_from_str_mt(&graph, 0, seq3, strlen(seq3));

  // Set up alignment correction params
  CorrectAlnParam params = {.ctpcol = 0, .ctxcol = 0,
                            .frag_len_min = 0, .frag_len_max = 0,
                            .one_way_gap_traverse = true, .use_end_check = true,
                            .max_context = 10,
                            .gap_variance = 0.1, .gap_wiggle = 5};

  all_tests_add_paths(&graph, seq0, params, 5, 5); // path lens: 3+3+2+2+2
  all_tests_add_paths(&graph, seq1, params, 5, 2); // path lens: 3+3+2+2+2
  all_tests_add_paths(&graph, seq2, params, 3, 2); // path lens: 1+1+1
  all_tests_add_paths(&graph, seq3, params, 2, 1); // path lens: 1+1

  // Test path store
  gpath_checks_all_paths(&graph, 1); // use one thread

  // Test path content
  _check_node_paths(kmerA,  kmerApaths,  NPATHS_A,  0, &graph);
  _check_node_paths(kmerB,  kmerBpaths,  NPATHS_B,  0, &graph);
  _check_node_paths(kmerAB, kmerABpaths, NPATHS_AB, 0, &graph);
  _check_node_paths(kmerC,  kmerCpaths,  NPATHS_C,  0, &graph);
  _check_node_paths(kmerG,  kmerGpaths,  NPATHS_G,  0, &graph);
  _check_node_paths(kmerF,  kmerFpaths,  NPATHS_F,  0, &graph);
  _check_node_paths(kmerE,  kmerEpaths,  NPATHS_E,  0, &graph);
  _check_node_paths(kmerD,  kmerDpaths,  NPATHS_D,  0, &graph);
  _check_node_paths(kmerDEF,kmerDEFpaths,NPATHS_DEF,0, &graph);
  _check_node_paths(kmerDE, kmerDEpaths, NPATHS_DE, 0, &graph);

  db_graph_dealloc(&graph);
}

void test_paths()
{
  _test_add_paths();
}
예제 #3
0
파일: debug.c 프로젝트: ambarrio/mccortex
int main(int argc, char **argv)
{
  (void)argc; (void)argv;
  cortex_init();
  cmd_init(argc, argv);

  if(argc != 3) die("usage: ./debug <in.ctp> <in.ctx>");

  const char *out_path = argv[2];

  GPathReader pfile;
  memset(&pfile, 0, sizeof(GPathReader));
  gpath_reader_open(&pfile, argv[1], true);
  status("Got file with %zu colours", pfile.ncolours);

  size_t i, kmer_size = 7, ncols = 3;

  gpath_reader_check(&pfile, kmer_size, ncols);
  gzFile gzout = futil_gzopen_create(out_path, "w");

  dBGraph db_graph;
  db_graph_alloc(&db_graph, kmer_size, ncols, 1, 1024, DBG_ALLOC_EDGES);

  // Create a path store that tracks path counts
  gpath_store_alloc(&db_graph.gpstore,
                    db_graph.num_of_cols, db_graph.ht.capacity,
                    ONE_MEGABYTE, true, false);

  // Create path hash table for fast lookup
  gpath_hash_alloc(&db_graph.gphash, &db_graph.gpstore, ONE_MEGABYTE);

  // Set sample names
  for(i = 0; i < pfile.ncolours; i++) {
    const char *sample_name = gpath_reader_get_sample_name(&pfile, i);
    ctx_assert(sample_name != NULL);
    strbuf_set(&db_graph.ginfo[i].sample_name, sample_name);
  }

  // Load path files, add kmers that are missing
  gpath_reader_load(&pfile, GPATH_ADD_MISSING_KMERS, &db_graph);

  hash_table_print_stats(&db_graph.ht);

  // Write output file
  gpath_save(gzout, out_path, 1, true, NULL, NULL, &pfile.json, 1, &db_graph);
  gzclose(gzout);

  // Checks
  // gpath_checks_all_paths(&db_graph, 2); // use two threads
  gpath_checks_counts(&db_graph);

  // Clean up
  gpath_reader_close(&pfile);
  db_graph_dealloc(&db_graph);
  cortex_destroy();

  return EXIT_SUCCESS;
}
예제 #4
0
void test_supernode()
{
  test_status("testing supernode_find()...");

  // Construct 1 colour graph with kmer-size=11
  dBGraph graph;
  size_t kmer_size = 19, ncols = 1;

  db_graph_alloc(&graph, kmer_size, ncols, ncols, 1024,
                 DBG_ALLOC_EDGES | DBG_ALLOC_COVGS | DBG_ALLOC_BKTLOCKS);

  #define NSEQ 7

  const char *seq[NSEQ]
   = {"AGAGAGAGAGAGAGAGAGAGAGAG",
      "AAAAAAAAAAAAAAAAAAAAAAAAAA",
      "ATATATATATATATATATATATATATAT",
      "CGTTCGCGCATGGCCCACG",
      "GAACCAATCGGTCGACTGT",
      "CCCCGCAAAGTCCACTTAGTGTAAGGTACAAATTCTGCAGAGTTGCTGGATCAGCGATAC",
      "TCAATCCGATAGCAACCCGGTCCAA""TCAATCCGATAGCAACCCGGTCCAA"};

  const char *ans[NSEQ]
   = {"AGAGAGAGAGAGAGAGAGAG", // key AGAGAGAGAGAGAGAGAGA < CTCTCTCTCTCTCTCTCTC
      "AAAAAAAAAAAAAAAAAAA",
      "ATATATATATATATATATA",
      "CGTGGGCCATGCGCGAACG",
      "ACAGTCGACCGATTGGTTC",
      "CCCCGCAAAGTCCACTTAGTGTAAGGTACAAATTCTGCAGAGTTGCTGGATCAGCGATAC",
      "AACCCGGTCCAATCAATCCGATAGCAACCCGGTCCAATCAATC"};

  // Load all seq into colour 0
  size_t i;
  for(i = 0; i < NSEQ; i++)
    build_graph_from_str_mt(&graph, 0, seq[i], strlen(seq[i]), false);

  pull_out_supernodes(seq, ans, NSEQ, &graph);

  db_graph_dealloc(&graph);
}
예제 #5
0
int ctx_rmsubstr(int argc, char **argv)
{
  struct MemArgs memargs = MEM_ARGS_INIT;
  size_t kmer_size = 0, nthreads = 0;
  const char *output_file = NULL;
  seq_format fmt = SEQ_FMT_FASTA;
  bool invert = false;

  // Arg parsing
  char cmd[100], shortopts[100];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 'o': cmd_check(!output_file, cmd); output_file = optarg; break;
      case 't': cmd_check(!nthreads, cmd); nthreads = cmd_uint32_nonzero(cmd, optarg); break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'k': cmd_check(!kmer_size,cmd); kmer_size = cmd_uint32(cmd, optarg); break;
      case 'F': cmd_check(fmt==SEQ_FMT_FASTA, cmd); fmt = cmd_parse_format(cmd, optarg); break;
      case 'v': cmd_check(!invert,cmd); invert = true; break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        // cmd_print_usage(NULL);
        cmd_print_usage("`"CMD" rmsubstr -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  // Defaults
  if(!nthreads) nthreads = DEFAULT_NTHREADS;
  if(!kmer_size) kmer_size = DEFAULT_KMER;

  if(!(kmer_size&1)) cmd_print_usage("Kmer size must be odd");
  if(kmer_size < MIN_KMER_SIZE) cmd_print_usage("Kmer size too small (recompile)");
  if(kmer_size > MAX_KMER_SIZE) cmd_print_usage("Kmer size too large (recompile?)");

  if(optind >= argc)
    cmd_print_usage("Please specify at least one input sequence file (.fq, .fq etc.)");

  size_t i, num_seq_files = argc - optind;
  char **seq_paths = argv + optind;
  seq_file_t **seq_files = ctx_calloc(num_seq_files, sizeof(seq_file_t*));

  for(i = 0; i < num_seq_files; i++)
    if((seq_files[i] = seq_open(seq_paths[i])) == NULL)
      die("Cannot read sequence file %s", seq_paths[i]);

  // Estimate number of bases
  // set to -1 if we cannot calc
  int64_t est_num_bases = seq_est_seq_bases(seq_files, num_seq_files);
  if(est_num_bases < 0) {
    warn("Cannot get file sizes, using pipes");
    est_num_bases = memargs.num_kmers * IDEAL_OCCUPANCY;
  }

  status("[memory] Estimated number of bases: %li", (long)est_num_bases);

  // Use file sizes to decide on memory

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem;

  bits_per_kmer = sizeof(BinaryKmer)*8 +
                  sizeof(KONodeList) + sizeof(KOccur) + // see kmer_occur.h
                  8; // 1 byte per kmer for each base to load sequence files

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        est_num_bases, est_num_bases,
                                        false, &graph_mem);

  cmd_check_mem_limit(memargs.mem_to_use, graph_mem);

  //
  // Open output file
  //
  if(output_file == NULL) output_file = "-";
  FILE *fout = futil_fopen_create(output_file, "w");

  //
  // Set up memory
  //
  dBGraph db_graph;
  db_graph_alloc(&db_graph, kmer_size, 1, 0, kmers_in_hash, DBG_ALLOC_BKTLOCKS);

  //
  // Load reference sequence into a read buffer
  //
  ReadBuffer rbuf;
  read_buf_alloc(&rbuf, 1024);
  seq_load_all_reads(seq_files, num_seq_files, &rbuf);

  // Check for reads too short
  for(i = 0; i < rbuf.len && rbuf.b[i].seq.end >= kmer_size; i++) {}
  if(i < rbuf.len)
    warn("Reads shorter than kmer size (%zu) will not be filtered", kmer_size);

  KOGraph kograph = kograph_create(rbuf.b, rbuf.len, true, 0,
                                   nthreads, &db_graph);

  size_t num_reads = rbuf.len, num_reads_printed = 0, num_bad_reads = 0;

  // Loop over reads printing those that are not substrings
  int ret;
  for(i = 0; i < rbuf.len; i++) {
    ret = _is_substr(&rbuf, i, &kograph, &db_graph);
    if(ret == -1) num_bad_reads++;
    else if((ret && invert) || (!ret && !invert)) {
      seqout_print_read(&rbuf.b[i], fmt, fout);
      num_reads_printed++;
    }
  }

  char num_reads_str[100], num_reads_printed_str[100], num_bad_reads_str[100];
  ulong_to_str(num_reads, num_reads_str);
  ulong_to_str(num_reads_printed, num_reads_printed_str);
  ulong_to_str(num_bad_reads, num_bad_reads_str);

  status("Printed %s / %s (%.1f%%) to %s",
         num_reads_printed_str, num_reads_str,
         !num_reads ? 0.0 : (100.0 * num_reads_printed) / num_reads,
         futil_outpath_str(output_file));

  if(num_bad_reads > 0) {
    status("Bad reads: %s / %s (%.1f%%) - no kmer {ACGT} of length %zu",
           num_bad_reads_str, num_reads_str,
           (100.0 * num_bad_reads) / num_reads,
           kmer_size);
  }

  fclose(fout);
  kograph_dealloc(&kograph);

  // Free sequence memory
  for(i = 0; i < rbuf.len; i++) seq_read_dealloc(&rbuf.b[i]);
  read_buf_dealloc(&rbuf);
  ctx_free(seq_files);

  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #6
0
void test_graph_crawler()
{
  test_status("Testing graph crawler...");

  // Construct 1 colour graph with kmer-size=11
  dBGraph graph;
  const size_t kmer_size = 11, ncols = 3;

  db_graph_alloc(&graph, kmer_size, ncols, 1, 2048,
                 DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL | DBG_ALLOC_BKTLOCKS);

  char graphseq[3][77] =
//           <               X                 X              X...............
{"GTTCCAGAGCGGAGGTCTCCCAACAACATGGTATAAGTTGTCTAGCCCCGGTTCGCGCGGGTACTTCTTACAGCGC",
 "GTTCCAGAGCGGAGGTCTCCCAACAACTTGGTATAAGTTGTCTAGTCCCGGTTCGCGCGGCATTTCAGCATTGTTA",
 "GTTCCAGAGCGCGACAGAGTGCATATCACGCTAAGCACAGCCCTCTTCTATCTGCTTTTAAATGGATCAATAATCG"};

  build_graph_from_str_mt(&graph, 0, graphseq[0], strlen(graphseq[0]));
  build_graph_from_str_mt(&graph, 1, graphseq[1], strlen(graphseq[1]));
  build_graph_from_str_mt(&graph, 2, graphseq[2], strlen(graphseq[2]));

  // Crawl graph
  GraphCrawler crawler;
  graph_crawler_alloc(&crawler, &graph);

  dBNode node = db_graph_find_str(&graph, graphseq[0]);
  dBNode next_node = db_graph_find_str(&graph, graphseq[0]+1);
  TASSERT(node.key != HASH_NOT_FOUND);
  TASSERT(next_node.key != HASH_NOT_FOUND);

  BinaryKmer bkey = db_node_get_bkmer(&graph, node.key);
  Edges edges = db_node_get_edges(&graph, node.key, 0);

  dBNode next_nodes[4];
  Nucleotide next_nucs[4];
  size_t i, p, num_next, next_idx;

  num_next = db_graph_next_nodes(&graph, bkey, node.orient, edges,
                                 next_nodes, next_nucs);

  next_idx = 0;
  while(next_idx < num_next && !db_nodes_are_equal(next_nodes[next_idx],next_node))
    next_idx++;

  TASSERT(next_idx < num_next && db_nodes_are_equal(next_nodes[next_idx],next_node));

  // Crawl in all colours
  graph_crawler_fetch(&crawler, node, next_nodes, next_idx, num_next,
                      NULL, graph.num_of_cols, NULL, NULL, NULL);

  TASSERT2(crawler.num_paths == 2, "crawler.num_paths: %u", crawler.num_paths);

  // Fetch paths
  dBNodeBuffer nbuf;
  db_node_buf_alloc(&nbuf, 16);
  StrBuf sbuf;
  strbuf_alloc(&sbuf, 128);

  for(p = 0; p < crawler.num_paths; p++) {
    db_node_buf_reset(&nbuf);
    graph_crawler_get_path_nodes(&crawler, p, &nbuf);
    strbuf_ensure_capacity(&sbuf, nbuf.len+graph.kmer_size);
    sbuf.end = db_nodes_to_str(nbuf.b, nbuf.len, &graph, sbuf.b);
    for(i = 0; i < 3 && strcmp(graphseq[i]+1,sbuf.b) != 0; i++) {}
    TASSERT2(i < 3, "seq: %s", sbuf.b);
    TASSERT2(sbuf.end == 75, "sbuf.end: %zu", sbuf.end);
    TASSERT2(nbuf.len == 65, "nbuf.len: %zu", nbuf.len);
  }

  strbuf_dealloc(&sbuf);
  db_node_buf_dealloc(&nbuf);

  graph_crawler_dealloc(&crawler);

  db_graph_dealloc(&graph);
}
예제 #7
0
int ctx_correct(int argc, char **argv)
{
  size_t i;
  struct ReadThreadCmdArgs args;
  read_thread_args_alloc(&args);
  read_thread_args_parse(&args, argc, argv, longopts, true);

  GraphFileReader *gfile = &args.gfile;
  GPathFileBuffer *gpfiles = &args.gpfiles;
  CorrectAlnInputBuffer *inputs = &args.inputs;

  // Update colours in graph file - sample in 0, all others in 1
  size_t ncols = gpath_load_sample_pop(gfile, 1, gpfiles->b, gpfiles->len,
                                       args.colour);

  // Check for compatibility between graph files and link files
  graphs_gpaths_compatible(gfile, 1, gpfiles->b, gpfiles->len, 1);

  int64_t ctx_num_kmers = gfile->num_of_kmers;

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem, path_mem, total_mem;

  // 1 bit needed per kmer if we need to keep track of noreseed
  bits_per_kmer = sizeof(BinaryKmer)*8 + sizeof(Edges)*8 +
                  (gpfiles->len > 0 ? sizeof(GPath*)*8 : 0) +
                  ncols; // in colour

  kmers_in_hash = cmd_get_kmers_in_hash(args.memargs.mem_to_use,
                                        args.memargs.mem_to_use_set,
                                        args.memargs.num_kmers,
                                        args.memargs.num_kmers_set,
                                        bits_per_kmer,
                                        ctx_num_kmers, ctx_num_kmers,
                                        false, &graph_mem);

  // Paths memory
  size_t rem_mem = args.memargs.mem_to_use - MIN2(args.memargs.mem_to_use, graph_mem);
  path_mem = gpath_reader_mem_req(gpfiles->b, gpfiles->len, ncols, rem_mem, false,
                                  kmers_in_hash, false);

  cmd_print_mem(path_mem, "paths");

  // Shift path store memory from graphs->paths
  graph_mem -= sizeof(GPath*)*kmers_in_hash;
  path_mem  += sizeof(GPath*)*kmers_in_hash;

  // Total memory
  total_mem = graph_mem + path_mem;
  cmd_check_mem_limit(args.memargs.mem_to_use, total_mem);

  //
  // Check we can write all output files
  //
  // Open output files
  SeqOutput *outputs = ctx_calloc(inputs->len, sizeof(SeqOutput));
  bool err_occurred = false;

  for(i = 0; i < inputs->len && !err_occurred; i++)
  {
    CorrectAlnInput *input = &inputs->b[i];
    // We loaded target colour into colour zero
    input->crt_params.ctxcol = input->crt_params.ctpcol = 0;
    bool is_pe = asyncio_task_is_pe(&input->files);
    err_occurred = !seqout_open(&outputs[i], input->out_base, args.fmt, is_pe);
    input->output = &outputs[i];
  }

  // Abandon if some of the output files already exist
  if(err_occurred) {
    for(i = 0; i < inputs->len; i++)
      seqout_close(&outputs[i], true);
    die("Error creating output files");
  }

  //
  // Allocate memory
  //

  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfile->hdr.kmer_size, ncols, 1, kmers_in_hash,
                 DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL);

  // Create a path store that does not tracks path counts
  gpath_reader_alloc_gpstore(gpfiles->b, gpfiles->len, path_mem, false, &db_graph);

  //
  // Load Graph and link files
  //
  GraphLoadingPrefs gprefs = graph_loading_prefs(&db_graph);
  gprefs.empty_colours = true;

  // Load graph, print stats, close file
  graph_load(gfile, gprefs, NULL);
  hash_table_print_stats_brief(&db_graph.ht);
  graph_file_close(gfile);

  // Load link files
  for(i = 0; i < gpfiles->len; i++) {
    gpath_reader_load(&gpfiles->b[i], GPATH_DIE_MISSING_KMERS, &db_graph);
    gpath_reader_close(&gpfiles->b[i]);
  }

  //
  // Run alignment
  //
  correct_reads(inputs->b, inputs->len,
                args.dump_seq_sizes, args.dump_frag_sizes,
                args.fq_zero, args.append_orig_seq,
                args.nthreads, &db_graph);

  // Close and free output files
  for(i = 0; i < inputs->len; i++)
    seqout_close(&outputs[i], false);
  ctx_free(outputs);

  // Closes input files
  read_thread_args_dealloc(&args);
  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #8
0
int ctx_correct(int argc, char **argv)
{
  size_t i, j;
  struct ReadThreadCmdArgs args = READ_THREAD_CMD_ARGS_INIT;
  read_thread_args_alloc(&args);
  read_thread_args_parse(&args, argc, argv, longopts, true);

  GraphFileReader *gfile = &args.gfile;
  PathFileBuffer *pfiles = &args.pfiles;
  CorrectAlnInputBuffer *inputs = &args.inputs;
  size_t ctx_total_cols = gfile->hdr.num_of_cols;
  size_t ctx_num_kmers = gfile->num_of_kmers;

  if(args.colour > ctx_total_cols)
    cmd_print_usage("-c %zu is too big [> %zu]", args.colour, ctx_total_cols);

  size_t ctp_usedcols = 0;
  for(i = 0; i < pfiles->len; i++) {
    if(!file_filter_iscolloaded(&pfiles->data[i].fltr, args.colour)) {
      cmd_print_usage("Path file doesn't load into colour %zu: %s",
                      args.colour, pfiles->data[i].fltr.orig_path.buff);
    }
    ctp_usedcols = MAX2(ctp_usedcols, path_file_usedcols(&pfiles->data[i]));
  }

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem, path_mem, total_mem;

  // 1 bit needed per kmer if we need to keep track of noreseed
  bits_per_kmer = sizeof(Edges)*8 + ctx_num_kmers + sizeof(uint64_t)*8;
  kmers_in_hash = cmd_get_kmers_in_hash2(args.memargs.mem_to_use,
                                         args.memargs.mem_to_use_set,
                                         args.memargs.num_kmers,
                                         args.memargs.num_kmers_set,
                                         bits_per_kmer,
                                         ctx_num_kmers, ctx_num_kmers,
                                         false, &graph_mem);

  // Paths memory
  path_mem = path_files_mem_required(pfiles->data, pfiles->len, false, false,
                                     ctp_usedcols, 0);
  cmd_print_mem(path_mem, "paths");

  // Total memory
  total_mem = graph_mem + path_mem;
  cmd_check_mem_limit(args.memargs.mem_to_use, total_mem);

  //
  // Check we can read all output files
  //
  // Open output files
  SeqOutput *outputs = ctx_calloc(inputs->len, sizeof(SeqOutput));
  bool output_files_exist = false;

  for(i = 0; i < inputs->len; i++)
  {
    CorrectAlnInput *input = &inputs->data[i];
    input->crt_params.ctxcol = input->crt_params.ctpcol = args.colour;
    SeqOutput *output = &outputs[i];
    seq_output_alloc(output);
    seq_output_set_paths(output, input->out_base,
                         async_task_pe_output(&input->files));
    input->output = output;
    // output check prints warnings and returns true if errors
    output_files_exist |= seq_output_files_exist_check(output);
  }

  // Abandon if some of the output files already exist
  if(output_files_exist) die("Output files already exist");

  // Attempt to open all files
  for(i = 0; i < inputs->len && seq_output_open(&outputs[i]); i++) {}

  // Check if something went wrong - if so remove all output files
  if(i < inputs->len) {
    for(j = 0; j < i; j++) seq_output_delete(&outputs[i]);
    die("Couldn't open output files");
  }

  //
  // Allocate memory
  //

  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfile->hdr.kmer_size, ctx_total_cols, 1, kmers_in_hash);

  size_t bytes_per_col = roundup_bits2bytes(db_graph.ht.capacity);

  db_graph.col_edges = ctx_calloc(db_graph.ht.capacity, sizeof(Edges));
  db_graph.node_in_cols = ctx_calloc(bytes_per_col * ctx_total_cols, 1);

  // Paths
  path_store_alloc(&db_graph.pstore, path_mem, false,
                   db_graph.ht.capacity, ctp_usedcols);

  //
  // Load Graph and Path files
  //
  LoadingStats gstats = LOAD_STATS_INIT_MACRO;
  GraphLoadingPrefs gprefs = {.db_graph = &db_graph,
                              .boolean_covgs = false,
                              .must_exist_in_graph = false,
                              .must_exist_in_edges = NULL,
                              .empty_colours = true};

  // Load graph, print stats, close file
  graph_load(gfile, gprefs, &gstats);
  hash_table_print_stats_brief(&db_graph.ht);
  graph_file_close(gfile);

  // Load path files (does nothing if num_fpiles == 0)
  paths_format_merge(pfiles->data, pfiles->len, false, false,
                     args.num_of_threads, &db_graph);

  //
  // Run alignment
  //
  correct_reads(args.num_of_threads, MAX_IO_THREADS,
                inputs->data, inputs->len,
                &db_graph);

  // Close and free output files
  for(i = 0; i < inputs->len; i++) seq_output_dealloc(&outputs[i]);
  ctx_free(outputs);

  read_thread_args_dealloc(&args);

  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #9
0
// Returns 0 on success, otherwise != 0
int ctx_unitigs(int argc, char **argv)
{
  size_t nthreads = 0;
  struct MemArgs memargs = MEM_ARGS_INIT;
  const char *out_path = NULL;
  UnitigSyntax syntax = PRINT_FASTA;
  bool dot_use_points = false;

  // Arg parsing
  char cmd[100];
  char shortopts[300];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  // silence error messages from getopt_long
  // opterr = 0;

  while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 'o': cmd_check(!out_path, cmd); out_path = optarg; break;
      case 't': cmd_check(!nthreads, cmd); nthreads = cmd_uint32_nonzero(cmd, optarg); break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'F': cmd_check(!syntax, cmd); syntax = PRINT_FASTA; break;
      case 'g': cmd_check(!syntax, cmd); syntax = PRINT_GFA; break;
      case 'd': cmd_check(!syntax, cmd); syntax = PRINT_DOT; break;
      case 'P': cmd_check(!dot_use_points, cmd); dot_use_points = true; break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        die("`"CMD" unitigs -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  if(dot_use_points && syntax == PRINT_FASTA)
    cmd_print_usage("--point is only for use with --dot");

  // Defaults for unset values
  if(out_path == NULL) out_path = "-";
  if(nthreads == 0) nthreads = DEFAULT_NTHREADS;

  if(optind >= argc) cmd_print_usage(NULL);

  size_t i, num_gfiles = (size_t)(argc - optind);
  char **gfile_paths = argv + optind;

  if(dot_use_points && syntax != PRINT_DOT)
    cmd_print_usage("--points only valid with --graphviz / --dot");

  ctx_assert(num_gfiles > 0);

  // Open graph files
  GraphFileReader *gfiles = ctx_calloc(num_gfiles, sizeof(GraphFileReader));
  size_t ctx_max_kmers = 0, ctx_sum_kmers = 0;

  graph_files_open(gfile_paths, gfiles, num_gfiles,
                   &ctx_max_kmers, &ctx_sum_kmers);

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem;

  bits_per_kmer = sizeof(BinaryKmer)*8 + sizeof(Edges)*8 + 1;
  if(syntax != PRINT_FASTA) bits_per_kmer += sizeof(UnitigEnd) * 8;

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        ctx_max_kmers, ctx_sum_kmers,
                                        true, &graph_mem);

  cmd_check_mem_limit(memargs.mem_to_use, graph_mem);

  status("Output in %s format to %s\n", syntax_strs[syntax],
         futil_outpath_str(out_path));

  //
  // Open output file
  //

  // Print to stdout unless --out <out> is specified
  FILE *fout = futil_fopen_create(out_path, "w");

  //
  // Allocate memory
  //
  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size, 1, 1, kmers_in_hash,
                 DBG_ALLOC_EDGES);

  UnitigPrinter printer;
  unitig_printer_init(&printer, &db_graph, nthreads, syntax, fout);

  if(syntax == PRINT_DOT || syntax == PRINT_GFA)
    unitig_graph_alloc(&printer.ugraph, &db_graph);

  // Load graphs
  GraphLoadingPrefs gprefs = {.db_graph = &db_graph,
                              .boolean_covgs = false,
                              .must_exist_in_graph = false,
                              .empty_colours = false};

  for(i = 0; i < num_gfiles; i++) {
    file_filter_flatten(&gfiles[i].fltr, 0);
    graph_load(&gfiles[i], gprefs, NULL);
    graph_file_close(&gfiles[i]);
  }
  ctx_free(gfiles);

  hash_table_print_stats(&db_graph.ht);

  switch(syntax)
  {
    case PRINT_FASTA:
      status("Printing unitgs in FASTA using %zu threads", nthreads);
      supernodes_iterate(nthreads, printer.visited, &db_graph,
                         print_unitig_fasta, &printer);
      break;
    case PRINT_GFA:
      print_gfa_syntax(&printer);
      break;
    case PRINT_DOT:
      print_dot_syntax(&printer, dot_use_points);
      break;
    default:
      die("Invalid print syntax: %i", syntax);
  }

  char num_unitigs_str[50];
  ulong_to_str(printer.num_unitigs, num_unitigs_str);
  status("Dumped %s unitigs\n", num_unitigs_str);

  fclose(fout);

  unitig_printer_destroy(&printer);
  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #10
0
int ctx_pop_bubbles(int argc, char **argv)
{
  size_t nthreads = 0;
  struct MemArgs memargs = MEM_ARGS_INIT;
  const char *out_path = NULL;
  int32_t max_covg  = -1; // max mean coverage to remove <=0 => ignore
  int32_t max_klen  = -1; // max length (kmers) to remove <=0 => ignore
  int32_t max_kdiff = -1; // max diff between bubble branch lengths <0 => ignore

  // Arg parsing
  char cmd[100];
  char shortopts[300];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  // silence error messages from getopt_long
  // opterr = 0;

  while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'o': cmd_check(!out_path, cmd); out_path = optarg; break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 't': cmd_check(!nthreads, cmd); nthreads = cmd_uint32_nonzero(cmd, optarg); break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'C': cmd_check(max_covg<0,  cmd); max_covg  = cmd_uint32(cmd, optarg); break;
      case 'L': cmd_check(max_klen<0,  cmd); max_klen  = cmd_uint32(cmd, optarg); break;
      case 'D': cmd_check(max_kdiff<0, cmd); max_kdiff = cmd_uint32(cmd, optarg); break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        // cmd_print_usage(NULL);
        die("`"CMD" pop -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  // Defaults for unset values
  if(out_path == NULL) out_path = "-";
  if(nthreads == 0) nthreads = DEFAULT_NTHREADS;

  if(optind >= argc) cmd_print_usage("Require input graph files (.ctx)");

  //
  // Open graph files
  //
  const size_t num_gfiles = argc - optind;
  char **graph_paths = argv + optind;
  ctx_assert(num_gfiles > 0);

  GraphFileReader *gfiles = ctx_calloc(num_gfiles, sizeof(GraphFileReader));
  size_t i, ncols, ctx_max_kmers = 0, ctx_sum_kmers = 0;

  ncols = graph_files_open(graph_paths, gfiles, num_gfiles,
                           &ctx_max_kmers, &ctx_sum_kmers);

  bool reread_graph_to_filter = (num_gfiles == 1 &&
                                 strcmp(file_filter_path(&gfiles[0].fltr),"-") != 0);

  if(reread_graph_to_filter) {
    file_filter_flatten(&gfiles[0].fltr, 0);
    ncols = 1;
  }

  // Check graphs are compatible
  graphs_gpaths_compatible(gfiles, num_gfiles, NULL, 0, -1);

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem;

  bits_per_kmer = sizeof(BinaryKmer)*8 +
                  sizeof(Covg)*8*ncols +
                  sizeof(Edges)*8*ncols +
                  2; // 1 bit for visited, 1 for removed

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        ctx_max_kmers, ctx_sum_kmers,
                                        false, &graph_mem);

  cmd_check_mem_limit(memargs.mem_to_use, graph_mem);

  // Check out_path is writable
  futil_create_output(out_path);

  // Allocate memory
  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size, ncols, ncols,
                 kmers_in_hash,  DBG_ALLOC_EDGES | DBG_ALLOC_COVGS);

  size_t nkwords = roundup_bits2bytes(db_graph.ht.capacity);
  uint8_t *visited = ctx_calloc(1, nkwords);
  uint8_t *rmvbits  = ctx_calloc(1, nkwords);

  //
  // Load graphs
  //
  GraphLoadingPrefs gprefs = graph_loading_prefs(&db_graph);
  gprefs.empty_colours = true;

  for(i = 0; i < num_gfiles; i++) {
    graph_load(&gfiles[i], gprefs, NULL);
    graph_file_close(&gfiles[i]);
    gprefs.empty_colours = false;
  }
  ctx_free(gfiles);

  hash_table_print_stats(&db_graph.ht);

  PopBubblesPrefs prefs = {.max_rmv_covg = max_covg,
                           .max_rmv_klen = max_klen,
                           .max_rmv_kdiff = max_kdiff};
  size_t npopped = 0;
  char npopped_str[50];

  status("Popping bubbles...");
  npopped = pop_bubbles(&db_graph, nthreads, prefs, visited, rmvbits);
  ulong_to_str(npopped, npopped_str);
  status("Popped %s bubbles", npopped_str);

  size_t nkmers0 = db_graph.ht.num_kmers;
  status("Removing nodes...");
  for(i = 0; i < nkwords; i++) rmvbits[i] = ~rmvbits[i];
  prune_nodes_lacking_flag(nthreads, rmvbits, &db_graph);
  size_t nkmers1 = db_graph.ht.num_kmers;

  ctx_assert(nkmers1 <= nkmers0);
  char nkmers0str[50], nkmers1str[50], ndiffstr[50];
  ulong_to_str(nkmers0, nkmers0str);
  ulong_to_str(nkmers1, nkmers1str);
  ulong_to_str(nkmers0-nkmers1, ndiffstr);
  status("Number of kmers %s -> %s (-%s)", nkmers0str, nkmers1str, ndiffstr);

  if(reread_graph_to_filter)
  {
    status("Streaming filtered file to: %s\n", out_path);
    GraphFileReader gfile;
    memset(&gfile, 0, sizeof(GraphFileReader));
    graph_file_open(&gfile, graph_paths[0]);
    graph_writer_stream_mkhdr(out_path, &gfile, &db_graph,
                              db_graph.col_edges, NULL);
    graph_file_close(&gfile);
  }
  else
  {
    status("Saving to: %s\n", out_path);
    graph_writer_save_mkhdr(out_path, &db_graph, CTX_GRAPH_FILEFORMAT, NULL,
                          0, ncols);
  }

  ctx_free(visited);
  ctx_free(rmvbits);

  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #11
0
int ctx_contigs(int argc, char **argv)
{
  size_t nthreads = 0;
  struct MemArgs memargs = MEM_ARGS_INIT;
  const char *out_path = NULL;
  size_t i, contig_limit = 0, colour = 0;
  bool cmd_reseed = false, cmd_no_reseed = false; // -r, -R
  const char *conf_table_path = NULL; // save confidence table to here
  bool use_missing_info_check = true, seed_with_unused_paths = false;
  double min_step_confid = -1.0, min_cumul_confid = -1.0; // < 0 => no min

  // Read length and expected depth for calculating confidences
  size_t genome_size = 0;

  seq_file_t *tmp_seed_file = NULL;
  SeqFilePtrBuffer seed_buf;
  seq_file_ptr_buf_alloc(&seed_buf, 16);

  GPathReader tmp_gpfile;
  GPathFileBuffer gpfiles;
  gpfile_buf_alloc(&gpfiles, 8);

  // Arg parsing
  char cmd[100], shortopts[300];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  // silence error messages from getopt_long
  // opterr = 0;

  while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 'o': cmd_check(!out_path,cmd); out_path = optarg; break;
      case 't': cmd_check(!nthreads,cmd); nthreads = cmd_uint32_nonzero(cmd, optarg); break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'p':
        memset(&tmp_gpfile, 0, sizeof(GPathReader));
        gpath_reader_open(&tmp_gpfile, optarg);
        gpfile_buf_push(&gpfiles, &tmp_gpfile, 1);
        break;
      case '1':
      case 's': // --seed <in.fa>
        if((tmp_seed_file = seq_open(optarg)) == NULL)
          die("Cannot read --seed file: %s", optarg);
        seq_file_ptr_buf_add(&seed_buf, tmp_seed_file);
        break;
      case 'r': cmd_check(!cmd_reseed,cmd); cmd_reseed = true; break;
      case 'R': cmd_check(!cmd_no_reseed,cmd); cmd_no_reseed = true; break;
      case 'N':
        cmd_check(!contig_limit,cmd);
        contig_limit = cmd_uint32_nonzero(cmd, optarg);
        break;
      case 'c': cmd_check(!colour,cmd); colour = cmd_uint32(cmd, optarg); break;
      case 'G': cmd_check(!genome_size,cmd); genome_size = cmd_bases(cmd, optarg); break;
      case 'S': cmd_check(!conf_table_path,cmd); conf_table_path = optarg; break;
      case 'M': cmd_check(use_missing_info_check,cmd); use_missing_info_check = false; break;
      case 'P': cmd_check(!seed_with_unused_paths,cmd); seed_with_unused_paths = true; break;
      case 'C':
        cmd_check(min_cumul_confid < 0,cmd);
        min_cumul_confid = cmd_udouble(cmd,optarg);
        if(min_cumul_confid > 1) die("%s must be 0 <= x <= 1", cmd);
        break;
      case 'T':
        cmd_check(min_step_confid < 0,cmd);
        min_step_confid = cmd_udouble(cmd,optarg);
        if(min_step_confid > 1) die("%s must be 0 <= x <= 1", cmd);
        break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        die("`"CMD" contigs -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  if(cmd_no_reseed && cmd_reseed)
    cmd_print_usage("Cannot specify both -r and -R");

  if(contig_limit && seed_with_unused_paths)
    cmd_print_usage("Cannot combine --ncontigs with --use-seed-paths");

  bool sample_with_replacement = cmd_reseed;

  // Defaults
  if(nthreads == 0) nthreads = DEFAULT_NTHREADS;

  if(!seed_buf.len && !contig_limit && sample_with_replacement) {
    cmd_print_usage("Please specify one or more of: "
                    "--no-reseed | --ncontigs | --seed <in.fa>");
  }

  if(optind >= argc) cmd_print_usage("Require input graph files (.ctx)");

  //
  // Open graph files
  //
  const size_t num_gfiles = argc - optind;
  char **graph_paths = argv + optind;
  ctx_assert(num_gfiles > 0);

  GraphFileReader *gfiles = ctx_calloc(num_gfiles, sizeof(GraphFileReader));
  size_t ncols, ctx_max_kmers = 0, ctx_sum_kmers = 0;

  graph_files_open(graph_paths, gfiles, num_gfiles,
                   &ctx_max_kmers, &ctx_sum_kmers);

  // char *ctx_path = argv[optind];

  //
  // Open Graph file
  //
  // GraphFileReader gfile;
  // memset(&gfile, 0, sizeof(GraphFileReader));
  // graph_file_open(&gfile, ctx_path);

  // Update colours in graph file - sample in 0, all others in 1
  // never need more than two colours
  ncols = gpath_load_sample_pop(gfiles, num_gfiles,
                                gpfiles.b, gpfiles.len, colour);

  // Check for compatibility between graph files and path files
  // pop_colour is colour 1
  graphs_gpaths_compatible(gfiles, num_gfiles, gpfiles.b, gpfiles.len, 1);

  if(!genome_size)
  {
    char nk_str[50];
    if(ctx_max_kmers <= 0) die("Please pass --genome <G> if streaming");
    genome_size = ctx_max_kmers;
    ulong_to_str(genome_size, nk_str);
    status("Taking number of kmers as genome size: %s", nk_str);
  }

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem, path_mem, total_mem;

  // 1 bit needed per kmer if we need to keep track of kmer usage
  bits_per_kmer = sizeof(BinaryKmer)*8 + sizeof(Edges)*8 + sizeof(GPath*)*8 +
                  ncols + !sample_with_replacement;

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        ctx_max_kmers, ctx_sum_kmers,
                                        false, &graph_mem);

  // Paths memory
  size_t rem_mem = memargs.mem_to_use - MIN2(memargs.mem_to_use, graph_mem);
  path_mem = gpath_reader_mem_req(gpfiles.b, gpfiles.len, ncols, rem_mem, false);

  // Shift path store memory from graphs->paths
  graph_mem -= sizeof(GPath*)*kmers_in_hash;
  path_mem  += sizeof(GPath*)*kmers_in_hash;
  cmd_print_mem(path_mem, "paths");

  // Total memory
  total_mem = graph_mem + path_mem;
  cmd_check_mem_limit(memargs.mem_to_use, total_mem);

  // Load contig hist distribution from ctp files
  ZeroSizeBuffer contig_hist;
  memset(&contig_hist, 0, sizeof(contig_hist));

  for(i = 0; i < gpfiles.len; i++) {
    gpath_reader_load_contig_hist(gpfiles.b[i].json,
                                  gpfiles.b[i].fltr.path.b,
                                  file_filter_fromcol(&gpfiles.b[i].fltr, 0),
                                  &contig_hist);
  }

  // Calculate confidences, only for one colour
  ContigConfidenceTable conf_table;
  conf_table_alloc(&conf_table, 1);
  conf_table_update_hist(&conf_table, 0, genome_size,
                         contig_hist.b, contig_hist.len);

  if(conf_table_path != NULL) {
    conf_table_save(&conf_table, conf_table_path);
  }

  zsize_buf_dealloc(&contig_hist);

  //
  // Output file if printing
  //
  FILE *fout = out_path ? futil_fopen_create(out_path, "w") : NULL;

  // Allocate
  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size, ncols, 1, kmers_in_hash,
                 DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL);

  // Paths
  gpath_reader_alloc_gpstore(gpfiles.b, gpfiles.len, path_mem,
                             false, &db_graph);

  uint8_t *visited = NULL;

  if(!sample_with_replacement)
    visited = ctx_calloc(roundup_bits2bytes(db_graph.ht.capacity), 1);

  // Load graph
  LoadingStats stats = LOAD_STATS_INIT_MACRO;

  GraphLoadingPrefs gprefs = {.db_graph = &db_graph,
                              .boolean_covgs = false,
                              .must_exist_in_graph = false,
                              .empty_colours = true};

  for(i = 0; i < num_gfiles; i++) {
    graph_load(&gfiles[i], gprefs, &stats);
    graph_file_close(&gfiles[i]);
    gprefs.empty_colours = false;
  }
  ctx_free(gfiles);

  hash_table_print_stats(&db_graph.ht);

  // Load path files
  for(i = 0; i < gpfiles.len; i++) {
    gpath_reader_load(&gpfiles.b[i], GPATH_DIE_MISSING_KMERS, &db_graph);
    gpath_reader_close(&gpfiles.b[i]);
  }
  gpfile_buf_dealloc(&gpfiles);

  AssembleContigStats assem_stats;
  assemble_contigs_stats_init(&assem_stats);

  assemble_contigs(nthreads, seed_buf.b, seed_buf.len,
                   contig_limit, visited,
                   use_missing_info_check, seed_with_unused_paths,
                   min_step_confid, min_cumul_confid,
                   fout, out_path, &assem_stats, &conf_table,
                   &db_graph, 0); // Sample always loaded into colour zero

  if(fout && fout != stdout) fclose(fout);

  assemble_contigs_stats_print(&assem_stats);
  assemble_contigs_stats_destroy(&assem_stats);

  conf_table_dealloc(&conf_table);

  for(i = 0; i < seed_buf.len; i++)
    seq_close(seed_buf.b[i]);

  seq_file_ptr_buf_dealloc(&seed_buf);

  ctx_free(visited);
  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #12
0
int ctx_exp_abc(int argc, char **argv)
{
  size_t i, nthreads = 0, num_repeats = 0, max_AB_dist = 0;
  struct MemArgs memargs = MEM_ARGS_INIT;
  bool print_failed_contigs = false;

  GPathReader tmp_gpfile;
  GPathFileBuffer gpfiles;
  gpfile_buf_alloc(&gpfiles, 8);

  // Arg parsing
  char cmd[100];
  char shortopts[300];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  // silence error messages from getopt_long
  // opterr = 0;

  while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 't': cmd_check(!nthreads,cmd); nthreads = cmd_uint32_nonzero(cmd, optarg); break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'p':
        memset(&tmp_gpfile, 0, sizeof(GPathReader));
        gpath_reader_open(&tmp_gpfile, optarg);
        gpfile_buf_push(&gpfiles, &tmp_gpfile, 1);
        break;
      case 'N': cmd_check(!num_repeats,cmd); num_repeats = cmd_uint32_nonzero(cmd, optarg); break;
      case 'M': cmd_check(!max_AB_dist,cmd); max_AB_dist = cmd_uint32_nonzero(cmd, optarg); break;
      case 'P': cmd_check(!print_failed_contigs,cmd); print_failed_contigs = true; break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        // cmd_print_usage(NULL);
        die("`"CMD" exp_abc -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  // Defaults
  if(nthreads == 0) nthreads = DEFAULT_NTHREADS;
  if(num_repeats == 0) num_repeats = DEFAULT_NUM_REPEATS;
  if(max_AB_dist == 0) max_AB_dist = DEFAULT_MAX_AB_DIST;

  if(print_failed_contigs && nthreads != 1) {
    warn("--print forces nthreads to be one. soz.");
    nthreads = 1;
  }

  if(optind+1 != argc) cmd_print_usage("Require exactly one input graph file (.ctx)");

  const char *ctx_path = argv[optind];

  //
  // Open Graph file
  //
  GraphFileReader gfile;
  memset(&gfile, 0, sizeof(GraphFileReader));
  graph_file_open(&gfile, ctx_path);

  size_t ncols = file_filter_into_ncols(&gfile.fltr);

  // Check only loading one colour
  if(ncols > 1) die("Only implemented for one colour currently");

  // Check graph + paths are compatible
  graphs_gpaths_compatible(&gfile, 1, gpfiles.b, gpfiles.len, -1);

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem, path_mem, total_mem;

  // 1 bit needed per kmer if we need to keep track of kmer usage
  bits_per_kmer = sizeof(BinaryKmer)*8 + sizeof(Edges)*8 + sizeof(GPath*)*8 +
                  ncols;

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        gfile.num_of_kmers, gfile.num_of_kmers,
                                        false, &graph_mem);

  // Paths memory
  size_t rem_mem = memargs.mem_to_use - MIN2(memargs.mem_to_use, graph_mem);
  path_mem = gpath_reader_mem_req(gpfiles.b, gpfiles.len, ncols, rem_mem, false,
                                  kmers_in_hash, false);

  // Shift path store memory from graphs->paths
  graph_mem -= sizeof(GPath*)*kmers_in_hash;
  path_mem  += sizeof(GPath*)*kmers_in_hash;
  cmd_print_mem(path_mem, "paths");

  total_mem = graph_mem + path_mem;
  cmd_check_mem_limit(memargs.mem_to_use, total_mem);

  //
  // Allocate memory
  //
  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfile.hdr.kmer_size, 1, 1, kmers_in_hash,
                 DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL);

  // Paths
  gpath_reader_alloc_gpstore(gpfiles.b, gpfiles.len, path_mem, false, &db_graph);

  // Load the graph
  GraphLoadingPrefs gprefs = graph_loading_prefs(&db_graph);
  gprefs.empty_colours = true;

  graph_load(&gfile, gprefs, NULL);
  graph_file_close(&gfile);

  hash_table_print_stats(&db_graph.ht);

  // Load link files
  for(i = 0; i < gpfiles.len; i++) {
    gpath_reader_load(&gpfiles.b[i], GPATH_DIE_MISSING_KMERS, &db_graph);
    gpath_reader_close(&gpfiles.b[i]);
  }
  gpfile_buf_dealloc(&gpfiles);

  status("\n");
  status("Test 1: Priming region A->B (n: %zu max_AB_dist: %zu)",
         num_repeats, max_AB_dist);

  run_exp_abc(&db_graph, true, nthreads, num_repeats,
              max_AB_dist, print_failed_contigs);

  status("\n");
  status("Test 2: Trying to traverse A->B (n: %zu max_AB_dist: %zu)",
         num_repeats, max_AB_dist);

  run_exp_abc(&db_graph, false, nthreads, num_repeats,
              max_AB_dist, print_failed_contigs);

  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #13
0
int ctx_clean(int argc, char **argv)
{
  size_t nthreads = 0, use_ncols = 0;
  struct MemArgs memargs = MEM_ARGS_INIT;
  const char *out_ctx_path = NULL;
  bool tip_cleaning = false, supernode_cleaning = false;
  size_t min_keep_tip = 0;
  Covg threshold = 0, fallback_thresh = 0;
  const char *len_before_path = NULL, *len_after_path = NULL;
  const char *covg_before_path = NULL, *covg_after_path = NULL;

  // Arg parsing
  char cmd[100];
  char shortopts[300];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  // silence error messages from getopt_long
  // opterr = 0;

  while((c = getopt_long(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 'o':
        if(out_ctx_path != NULL) cmd_print_usage(NULL);
        out_ctx_path = optarg;
        break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'N': use_ncols = cmd_uint32_nonzero(cmd, optarg); break;
      case 't': cmd_check(!nthreads, cmd); nthreads = cmd_uint32_nonzero(cmd, optarg); break;
      case 'T':
        cmd_check(!tip_cleaning, cmd);
        min_keep_tip = cmd_uint32_nonzero(cmd, optarg);
        tip_cleaning = true;
        break;
      case 'S':
        cmd_check(!supernode_cleaning, cmd);
        if(optarg != NULL) threshold = cmd_uint32_nonzero(cmd, optarg);
        supernode_cleaning = true;
        break;
      case 'B': cmd_check(!fallback_thresh, cmd); fallback_thresh = cmd_uint32_nonzero(cmd, optarg); break;
      case 'l': cmd_check(!len_before_path, cmd); len_before_path = optarg; break;
      case 'L': cmd_check(!len_after_path, cmd); len_after_path = optarg; break;
      case 'c': cmd_check(!covg_before_path, cmd); covg_before_path = optarg; break;
      case 'C': cmd_check(!covg_after_path, cmd); covg_after_path = optarg; break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        // cmd_print_usage(NULL);
        die("`"CMD" clean -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  if(nthreads == 0) nthreads = DEFAULT_NTHREADS;

  if(optind >= argc) cmd_print_usage("Please give input graph files");

  // Default behaviour
  if(!tip_cleaning && !supernode_cleaning) {
    if(out_ctx_path != NULL)
      supernode_cleaning = tip_cleaning = true; // do both
    else
      warn("No cleaning being done: you did not specify --out <out.ctx>");
  }

  bool doing_cleaning = (supernode_cleaning || tip_cleaning);

  if(doing_cleaning && out_ctx_path == NULL) {
    cmd_print_usage("Please specify --out <out.ctx> for cleaned graph");
  }

  if(!doing_cleaning && (covg_after_path || len_after_path)) {
    cmd_print_usage("You gave --len-after <out> / --covg-after <out> without "
                    "any cleaning (set -s, --supernodes or -t, --tips)");
  }

  if(doing_cleaning && strcmp(out_ctx_path,"-") != 0 &&
     !futil_get_force() && futil_file_exists(out_ctx_path))
  {
    cmd_print_usage("Output file already exists: %s", out_ctx_path);
  }

  if(fallback_thresh && !supernode_cleaning)
    cmd_print_usage("-B, --fallback <T> without --supernodes");

  // Use remaining args as graph files
  char **gfile_paths = argv + optind;
  size_t i, j, num_gfiles = (size_t)(argc - optind);

  // Open graph files
  GraphFileReader *gfiles = ctx_calloc(num_gfiles, sizeof(GraphFileReader));
  size_t ncols, ctx_max_kmers = 0, ctx_sum_kmers = 0;

  ncols = graph_files_open(gfile_paths, gfiles, num_gfiles,
                           &ctx_max_kmers, &ctx_sum_kmers);

  size_t kmer_size = gfiles[0].hdr.kmer_size;

  // default to one colour for now
  if(use_ncols == 0) use_ncols = 1;

  // Flatten if we don't have to remember colours / output a graph
  if(!doing_cleaning)
  {
    ncols = use_ncols = 1;
    for(i = 0; i < num_gfiles; i++)
      file_filter_flatten(&gfiles[i].fltr, 0);
  }

  if(ncols < use_ncols) {
    warn("I only need %zu colour%s ('--ncols %zu' ignored)",
         ncols, util_plural_str(ncols), use_ncols);
    use_ncols = ncols;
  }

  char max_kmers_str[100];
  ulong_to_str(ctx_max_kmers, max_kmers_str);
  status("%zu input graph%s, max kmers: %s, using %zu colours",
         num_gfiles, util_plural_str(num_gfiles), max_kmers_str, use_ncols);

  // If no arguments given we default to removing tips < 2*kmer_size
  if(tip_cleaning && min_keep_tip == 0)
    min_keep_tip = 2 * kmer_size;

  // Warn if any graph files already cleaned
  size_t fromcol, intocol;
  ErrorCleaning *cleaning;

  for(i = 0; i < num_gfiles; i++) {
    for(j = 0; j < file_filter_num(&gfiles[i].fltr); j++) {
      fromcol = file_filter_fromcol(&gfiles[i].fltr, j);
      cleaning = &gfiles[i].hdr.ginfo[fromcol].cleaning;
      if(cleaning->cleaned_snodes && supernode_cleaning) {
        warn("%s:%zu already has supernode cleaning with threshold: <%zu",
             file_filter_path(&gfiles[i].fltr), fromcol,
             (size_t)cleaning->clean_snodes_thresh);
      }
      if(cleaning->cleaned_tips && tip_cleaning) {
        warn("%s:%zu already has had tip cleaned",
             file_filter_path(&gfiles[i].fltr), fromcol);
      }
    }
  }

  // Print steps
  size_t step = 0;
  status("Actions:\n");
  if(covg_before_path != NULL)
    status("%zu. Saving kmer coverage distribution to: %s", step++, covg_before_path);
  if(len_before_path != NULL)
    status("%zu. Saving supernode length distribution to: %s", step++, len_before_path);
  if(tip_cleaning)
    status("%zu. Cleaning tips shorter than %zu nodes", step++, min_keep_tip);
  if(supernode_cleaning && threshold > 0)
    status("%zu. Cleaning supernodes with coverage < %u", step++, threshold);
  if(supernode_cleaning && threshold <= 0)
    status("%zu. Cleaning supernodes with auto-detected threshold", step++);
  if(covg_after_path != NULL)
    status("%zu. Saving kmer coverage distribution to: %s", step++, covg_after_path);
  if(len_after_path != NULL)
    status("%zu. Saving supernode length distribution to: %s", step++, len_after_path);

  //
  // Decide memory usage
  //
  bool all_colours_loaded = (ncols <= use_ncols);
  bool use_mem_limit = (memargs.mem_to_use_set && num_gfiles > 1) || !ctx_max_kmers;

  size_t kmers_in_hash, bits_per_kmer, graph_mem;
  size_t per_kmer_per_col_bits = (sizeof(BinaryKmer)+sizeof(Covg)+sizeof(Edges)) * 8;
  size_t pop_edges_per_kmer_bits = (all_colours_loaded ? 0 : sizeof(Edges) * 8);

  bits_per_kmer = per_kmer_per_col_bits * use_ncols + pop_edges_per_kmer_bits;

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        ctx_max_kmers, ctx_sum_kmers,
                                        use_mem_limit, &graph_mem);

  // Maximise the number of colours we load to fill the mem
  size_t max_usencols = (memargs.mem_to_use*8 - pop_edges_per_kmer_bits * kmers_in_hash) /
                        (per_kmer_per_col_bits * kmers_in_hash);
  use_ncols = MIN2(max_usencols, ncols);

  cmd_check_mem_limit(memargs.mem_to_use, graph_mem);

  //
  // Check output files are writable
  //
  futil_create_output(out_ctx_path);

  // Does nothing if arg is NULL
  futil_create_output(covg_before_path);
  futil_create_output(covg_after_path);
  futil_create_output(len_before_path);
  futil_create_output(len_after_path);

  // Create db_graph
  // Load as many colours as possible
  // Use an extra set of edge to take intersections
  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size, use_ncols, use_ncols,
                 kmers_in_hash, DBG_ALLOC_COVGS);

  // Edges is a special case
  size_t num_edges = db_graph.ht.capacity * (use_ncols + !all_colours_loaded);
  db_graph.col_edges = ctx_calloc(num_edges, sizeof(Edges));

  // Load graph into a single colour
  LoadingStats stats = LOAD_STATS_INIT_MACRO;

  GraphLoadingPrefs gprefs = {.db_graph = &db_graph,
                              .boolean_covgs = false,
                              .must_exist_in_graph = false,
                              .must_exist_in_edges = NULL,
                              .empty_colours = false};

  // Construct cleaned graph header
  GraphFileHeader outhdr;
  memset(&outhdr, 0, sizeof(GraphFileHeader));
  outhdr.version = CTX_GRAPH_FILEFORMAT;
  outhdr.kmer_size = db_graph.kmer_size;
  outhdr.num_of_cols = ncols;
  outhdr.num_of_bitfields = (db_graph.kmer_size*2+63)/64;
  graph_header_alloc(&outhdr, ncols);

  // Merge info into header
  size_t gcol = 0;
  for(i = 0; i < num_gfiles; i++) {
    for(j = 0; j < file_filter_num(&gfiles[i].fltr); j++, gcol++) {
      fromcol = file_filter_fromcol(&gfiles[i].fltr, j);
      intocol = file_filter_intocol(&gfiles[i].fltr, j);
      graph_info_merge(&outhdr.ginfo[intocol], &gfiles[i].hdr.ginfo[fromcol]);
    }
  }

  if(ncols > use_ncols) {
    graph_files_load_flat(gfiles, num_gfiles, gprefs, &stats);
  } else {
    for(i = 0; i < num_gfiles; i++)
      graph_load(&gfiles[i], gprefs, &stats);
  }

  char num_kmers_str[100];
  ulong_to_str(db_graph.ht.num_kmers, num_kmers_str);
  status("Total kmers loaded: %s\n", num_kmers_str);

  size_t initial_nkmers = db_graph.ht.num_kmers;
  hash_table_print_stats(&db_graph.ht);

  uint8_t *visited = ctx_calloc(roundup_bits2bytes(db_graph.ht.capacity), 1);
  uint8_t *keep = ctx_calloc(roundup_bits2bytes(db_graph.ht.capacity), 1);

  if((supernode_cleaning && threshold <= 0) || covg_before_path || len_before_path)
  {
    // Get coverage distribution and estimate cleaning threshold
    int est_threshold = cleaning_get_threshold(nthreads,
                                               covg_before_path,
                                               len_before_path,
                                               visited, &db_graph);

    if(est_threshold < 0) status("Cannot find recommended cleaning threshold");
    else status("Recommended cleaning threshold is: %i", est_threshold);

    // Use estimated threshold if threshold not set
    if(threshold <= 0) {
      if(fallback_thresh > 0 && est_threshold < (int)fallback_thresh) {
        status("Using fallback threshold: %i", fallback_thresh);
        threshold = fallback_thresh;
      }
      else if(est_threshold >= 0) threshold = est_threshold;
    }
  }

  // Die if we failed to find suitable cleaning threshold
  if(supernode_cleaning && threshold <= 0)
    die("Need cleaning threshold (--supernodes=<D> or --fallback <D>)");

  if(doing_cleaning) {
    // Clean graph of tips (if min_keep_tip > 0) and supernodes (if threshold > 0)
    clean_graph(nthreads, threshold, min_keep_tip,
                covg_after_path, len_after_path,
                visited, keep, &db_graph);
  }

  ctx_free(visited);
  ctx_free(keep);

  if(doing_cleaning)
  {
    // Output graph file
    Edges *intersect_edges = NULL;
    bool kmers_loaded = true;
    size_t col, thresh;

    // Set output header ginfo cleaned
    for(col = 0; col < ncols; col++)
    {
      cleaning = &outhdr.ginfo[col].cleaning;
      cleaning->cleaned_snodes |= supernode_cleaning;
      cleaning->cleaned_tips |= tip_cleaning;

      // if(tip_cleaning) {
      //   strbuf_append_str(&outhdr.ginfo[col].sample_name, ".tipclean");
      // }

      if(supernode_cleaning) {
        thresh = cleaning->clean_snodes_thresh;
        thresh = cleaning->cleaned_snodes ? MAX2(thresh, (uint32_t)threshold)
                                          : (uint32_t)threshold;
        cleaning->clean_snodes_thresh = thresh;

        // char name_append[200];
        // sprintf(name_append, ".supclean%zu", thresh);
        // strbuf_append_str(&outhdr.ginfo[col].sample_name, name_append);
      }
    }

    if(!all_colours_loaded)
    {
      // We haven't loaded all the colours
      // intersect_edges are edges to mask with
      // resets graph edges
      intersect_edges = db_graph.col_edges;
      db_graph.col_edges += db_graph.ht.capacity;
    }

    // Print stats on removed kmers
    size_t removed_nkmers = initial_nkmers - db_graph.ht.num_kmers;
    double removed_pct = (100.0 * removed_nkmers) / initial_nkmers;
    char removed_str[100], init_str[100];
    ulong_to_str(removed_nkmers, removed_str);
    ulong_to_str(initial_nkmers, init_str);
    status("Removed %s of %s (%.2f%%) kmers", removed_str, init_str, removed_pct);

    graph_files_merge(out_ctx_path, gfiles, num_gfiles,
                      kmers_loaded, all_colours_loaded,
                      intersect_edges, &outhdr, &db_graph);

    // Swap back
    if(!all_colours_loaded)
      db_graph.col_edges = intersect_edges;
  }

  ctx_check(db_graph.ht.num_kmers == hash_table_count_kmers(&db_graph.ht));

  graph_header_dealloc(&outhdr);

  for(i = 0; i < num_gfiles; i++) graph_file_close(&gfiles[i]);
  ctx_free(gfiles);

  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #14
0
// Load each sequence into a separate colour
static void test_bubbles(dBGraph *graph, const char **seqs, size_t nseqs,
                         const char *flank5p, const char *flank3p,
                         const char **alleles, size_t nalleles)
{
  db_graph_reset(graph);

  TASSERT(graph->num_of_cols >= nseqs);

  size_t i;
  for(i = 0; i < nseqs; i++)
    build_graph_from_str_mt(graph, i, seqs[i], strlen(seqs[i]), false);

  graph->num_of_cols_used = MAX2(graph->num_of_cols_used, 1);

  StrBuf sbuf;
  dBNodeBuffer nbuf;
  strbuf_alloc(&sbuf, 128);
  db_node_buf_alloc(&nbuf, 128);

  BubbleCallingPrefs prefs = {.max_allele_len = 100, .max_flank_len = 100,
                              .haploid_cols = NULL, .nhaploid_cols = 0,
                              .remove_serial_bubbles = true};

  BubbleCaller *caller = bubble_callers_new(1, &prefs, NULL, graph);

  _call_bubble(caller, flank5p, flank3p, alleles, nalleles, &nbuf, &sbuf);

  strbuf_dealloc(&sbuf);
  db_node_buf_dealloc(&nbuf);
  bubble_callers_destroy(caller, 1);
}

void test_bubble_caller()
{
  test_status("Testing bubble calling...");

  // Construct 1 colour graph with kmer-size=11
  dBGraph graph;
  const size_t kmer_size = 11, ncols = 3;

  // Create graph
  db_graph_alloc(&graph, kmer_size, ncols, 1, 2000,
                 DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL | DBG_ALLOC_BKTLOCKS);

  //   mutations:                      x
  const char *seqs0[] = {"AGGGATAAAACTCTGTACTGGATCTCCCT",
                         "AGGGATAAAACTCTcTACTGGATCTCCCT"};
  const char flank5p0[] = "AGGGATAAAACTCT";
  const char flank3p0[] = "TACTGGATCTCCCT";
  const char *alleles0[] = {"ATAAAACTCTGTACTGGATCT", "ATAAAACTCTcTACTGGATCT"};

  test_bubbles(&graph, seqs0, 2, flank5p0, flank3p0, alleles0, 2);

  //   mutations:                     x                  y
  const char *seqs1[] = {"CCCGTAGGTAAGGGCGTTAGTGCAAGGCCACATTGGGACACGAGTTGATA",
                         "CCCGTAGGTAAGtGCGTTAGTGCAAGGCCACATTGGGACACGAGTTGATA",
                         "CCCGTAGGTAAGGGCGTTAGTGCAAGGCCACtTTGGGACACGAGTTGATA"};

  // forwards
  const char flank5p1a[] = "CCCGTAGGTAAG";
  const char flank3p1a[] = "GCGTTAGTGCAAGGCCAC";
  const char *alleles1a[] = {"CGTAGGTAAGGGCGTTAGTGC", "CGTAGGTAAGtGCGTTAGTGC"};

  const char flank5p1b[] = "GCGTTAGTGCAAGGCCAC";
  const char flank3p1b[] = "TTGGGACACGAGTTGATA";
  const char *alleles1b[] = {"GCAAGGCCACATTGGGACACG", "GCAAGGCCACtTTGGGACACG"};

  test_bubbles(&graph, seqs1, 3, flank5p1a, flank3p1a, alleles1a, 2);
  test_bubbles(&graph, seqs1, 3, flank5p1b, flank3p1b, alleles1b, 2);

  // reverse
  // mutations:        y                  x
  // TATCAACTCGTGTCCCAATGTGGCCTTGCACTAACGCCCTTACCTACGGG
  // TATCAACTCGTGTCCCAATGTGGCCTTGCACTAACGCaCTTACCTACGGG
  // TATCAACTCGTGTCCCAAaGTGGCCTTGCACTAACGCCCTTACCTACGGG
  //
  const char flank5p1c[] = "GTGGCCTTGCACTAACGC";
  const char flank3p1c[] = "CTTACCTACGGG";
  const char *alleles1c[] = {"GCACTAACGCCCTTACCTACG", "GCACTAACGCaCTTACCTACG"};

  const char flank5p1d[] = "TATCAACTCGTGTCCCAA";
  const char flank3p1d[] = "GTGGCCTTGCACTAACGC";
  const char *alleles1d[] = {"CGTGTCCCAATGTGGCCTTGC", "CGTGTCCCAAaGTGGCCTTGC"};

  test_bubbles(&graph, seqs1, 3, flank5p1c, flank3p1c, alleles1c, 2);
  test_bubbles(&graph, seqs1, 3, flank5p1d, flank3p1d, alleles1d, 2);

  db_graph_dealloc(&graph);
}
예제 #15
0
int ctx_bubbles(int argc, char **argv)
{
  size_t nthreads = 0;
  struct MemArgs memargs = MEM_ARGS_INIT;
  const char *out_path = NULL;
  size_t max_allele_len = 0, max_flank_len = 0;
  bool remove_serial_bubbles = true;

  // List of haploid colours
  size_t *hapcols = NULL;
  int nhapcols = 0;
  char *hapcols_arg = NULL;

  GPathReader tmp_gpfile;
  GPathFileBuffer gpfiles;
  gpfile_buf_alloc(&gpfiles, 8);

  // Arg parsing
  char cmd[100];
  char shortopts[300];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  // silence error messages from getopt_long
  // opterr = 0;

  while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'o': cmd_check(!out_path, cmd); out_path = optarg; break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 'p':
        memset(&tmp_gpfile, 0, sizeof(GPathReader));
        gpath_reader_open(&tmp_gpfile, optarg);
        gpfile_buf_push(&gpfiles, &tmp_gpfile, 1);
        break;
      case 't': cmd_check(!nthreads, cmd); nthreads = cmd_uint32_nonzero(cmd, optarg); break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'H': cmd_check(!hapcols_arg, cmd); hapcols_arg = optarg; break;
      case 'A': cmd_check(!max_allele_len, cmd); max_allele_len = cmd_uint32_nonzero(cmd, optarg); break;
      case 'F': cmd_check(!max_flank_len, cmd); max_flank_len = cmd_uint32_nonzero(cmd, optarg); break;
      case 'S': cmd_check(remove_serial_bubbles,cmd); remove_serial_bubbles = false; break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        // cmd_print_usage(NULL);
        die("`"CMD" "SUBCMD" -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  // Defaults for unset values
  if(out_path == NULL) out_path = "-";
  if(nthreads == 0) nthreads = DEFAULT_NTHREADS;
  if(max_allele_len == 0) max_allele_len = DEFAULT_MAX_ALLELE;
  if(max_flank_len == 0) max_flank_len = DEFAULT_MAX_FLANK;

  if(optind >= argc) cmd_print_usage("Require input graph files (.ctx)");

  //
  // Open graph files
  //
  const size_t num_gfiles = argc - optind;
  char **graph_paths = argv + optind;
  ctx_assert(num_gfiles > 0);

  GraphFileReader *gfiles = ctx_calloc(num_gfiles, sizeof(GraphFileReader));
  size_t i, ncols, ctx_max_kmers = 0, ctx_sum_kmers = 0;

  ncols = graph_files_open(graph_paths, gfiles, num_gfiles,
                           &ctx_max_kmers, &ctx_sum_kmers);

  // Check graph + paths are compatible
  graphs_gpaths_compatible(gfiles, num_gfiles, gpfiles.b, gpfiles.len, -1);

  //
  // Check haploid colours are valid
  //
  if(hapcols_arg != NULL) {
    if((nhapcols = range_get_num(hapcols_arg, ncols)) < 0)
      die("Invalid haploid colour list: %s", hapcols_arg);

    hapcols = ctx_calloc(nhapcols, sizeof(hapcols[0]));
    if(range_parse_array(hapcols_arg, hapcols, ncols) < 0)
      die("Invalid haploid colour list: %s", hapcols_arg);
  }

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem, path_mem, thread_mem;
  char thread_mem_str[100];

  // edges(1bytes) + kmer_paths(8bytes) + in_colour(1bit/col) +
  // visitedfw/rv(2bits/thread)

  bits_per_kmer = sizeof(BinaryKmer)*8 + sizeof(Edges)*8 +
                  (gpfiles.len > 0 ? sizeof(GPath*)*8 : 0) +
                  ncols + 2*nthreads;

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        ctx_max_kmers, ctx_sum_kmers,
                                        false, &graph_mem);

  // Thread memory
  thread_mem = roundup_bits2bytes(kmers_in_hash) * 2;
  bytes_to_str(thread_mem * nthreads, 1, thread_mem_str);
  status("[memory] (of which threads: %zu x %zu = %s)\n",
          nthreads, thread_mem, thread_mem_str);

  // Paths memory
  size_t rem_mem = memargs.mem_to_use - MIN2(memargs.mem_to_use, graph_mem+thread_mem);
  path_mem = gpath_reader_mem_req(gpfiles.b, gpfiles.len, ncols, rem_mem, false,
                                  kmers_in_hash, false);

  // Shift path store memory from graphs->paths
  graph_mem -= sizeof(GPath*)*kmers_in_hash;
  path_mem  += sizeof(GPath*)*kmers_in_hash;
  cmd_print_mem(path_mem, "paths");

  size_t total_mem = graph_mem + thread_mem + path_mem;
  cmd_check_mem_limit(memargs.mem_to_use, total_mem);

  //
  // Open output file
  //
  gzFile gzout = futil_gzopen_create(out_path, "w");

  // Allocate memory
  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size, ncols, 1, kmers_in_hash,
                 DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL);

  // Paths
  gpath_reader_alloc_gpstore(gpfiles.b, gpfiles.len, path_mem, false, &db_graph);

  //
  // Load graphs
  //
  GraphLoadingPrefs gprefs = graph_loading_prefs(&db_graph);
  gprefs.empty_colours = true;

  for(i = 0; i < num_gfiles; i++) {
    graph_load(&gfiles[i], gprefs, NULL);
    graph_file_close(&gfiles[i]);
    gprefs.empty_colours = false;
  }
  ctx_free(gfiles);

  hash_table_print_stats(&db_graph.ht);

  // Load link files
  for(i = 0; i < gpfiles.len; i++)
    gpath_reader_load(&gpfiles.b[i], GPATH_DIE_MISSING_KMERS, &db_graph);

  // Create array of cJSON** from input files
  cJSON **hdrs = ctx_malloc(gpfiles.len * sizeof(cJSON*));
  for(i = 0; i < gpfiles.len; i++) hdrs[i] = gpfiles.b[i].json;

  // Now call variants
  BubbleCallingPrefs call_prefs = {.max_allele_len = max_allele_len,
                                   .max_flank_len = max_flank_len,
                                   .haploid_cols = hapcols,
                                   .nhaploid_cols = nhapcols,
                                   .remove_serial_bubbles = remove_serial_bubbles};

  invoke_bubble_caller(nthreads, &call_prefs,
                       gzout, out_path,
                       hdrs, gpfiles.len,
                       &db_graph);

  status("  saved to: %s\n", out_path);
  gzclose(gzout);
  ctx_free(hdrs);

  // Close input link files
  for(i = 0; i < gpfiles.len; i++)
    gpath_reader_close(&gpfiles.b[i]);
  gpfile_buf_dealloc(&gpfiles);

  ctx_free(hapcols);
  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #16
0
int ctx_clean(int argc, char **argv)
{
  size_t nthreads = 0, use_ncols = 0;
  struct MemArgs memargs = MEM_ARGS_INIT;
  const char *out_ctx_path = NULL;
  int min_keep_tip = -1, unitig_min = -1; // <0 => default, 0 => noclean
  uint32_t fallback_thresh = 0;
  const char *len_before_path = NULL, *len_after_path = NULL;
  const char *covg_before_path = NULL, *covg_after_path = NULL;

  // Arg parsing
  char cmd[100];
  char shortopts[300];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  // silence error messages from getopt_long
  // opterr = 0;

  while((c = getopt_long(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 'o':
        if(out_ctx_path != NULL) cmd_print_usage(NULL);
        out_ctx_path = optarg;
        break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'N': use_ncols = cmd_uint32_nonzero(cmd, optarg); break;
      case 't': cmd_check(!nthreads, cmd); nthreads = cmd_uint32_nonzero(cmd, optarg); break;
      case 'T':
        cmd_check(min_keep_tip<0, cmd);
        min_keep_tip = (optarg != NULL ? (int)cmd_uint32(cmd, optarg) : -1);
        break;
      case 'S':
      case 'U':
        cmd_check(unitig_min<0, cmd);
        unitig_min = (optarg != NULL ? cmd_uint32(cmd, optarg) : -1);
        break;
      case 'B': cmd_check(!fallback_thresh, cmd); fallback_thresh = cmd_uint32_nonzero(cmd, optarg); break;
      case 'l': cmd_check(!len_before_path, cmd); len_before_path = optarg; break;
      case 'L': cmd_check(!len_after_path, cmd); len_after_path = optarg; break;
      case 'c': cmd_check(!covg_before_path, cmd); covg_before_path = optarg; break;
      case 'C': cmd_check(!covg_after_path, cmd); covg_after_path = optarg; break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        // cmd_print_usage(NULL);
        die("`"CMD" clean -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  if(nthreads == 0) nthreads = DEFAULT_NTHREADS;

  if(optind >= argc) cmd_print_usage("Please give input graph files");

  bool unitig_cleaning = (unitig_min != 0);
  bool tip_cleaning = (min_keep_tip != 0);
  bool doing_cleaning = (unitig_cleaning || tip_cleaning);

  // If you ever want to estimate cleaning threshold without outputting
  // a graph, change this to a warning
  if(doing_cleaning && out_ctx_path == NULL) {
    cmd_print_usage("Please specify --out <out.ctx> for cleaned graph");
    // warn("No cleaning being done: you did not specify --out <out.ctx>");
  }

  if(!doing_cleaning && (covg_after_path || len_after_path)) {
    warn("You gave --len-after <out> / --covg-after <out> without "
         "any cleaning (set -U, --unitigs or -t, --tips)");
  }

  if(doing_cleaning && strcmp(out_ctx_path,"-") != 0 &&
     !futil_get_force() && futil_file_exists(out_ctx_path))
  {
    cmd_print_usage("Output file already exists: %s", out_ctx_path);
  }

  if(fallback_thresh && !unitig_cleaning)
    warn("-B, --fallback <T> without --unitigs");

  // Use remaining args as graph files
  char **gfile_paths = argv + optind;
  size_t i, j, num_gfiles = (size_t)(argc - optind);

  // Open graph files
  GraphFileReader *gfiles = ctx_calloc(num_gfiles, sizeof(GraphFileReader));
  size_t col, ncols, ctx_max_kmers = 0, ctx_sum_kmers = 0;

  ncols = graph_files_open(gfile_paths, gfiles, num_gfiles,
                           &ctx_max_kmers, &ctx_sum_kmers);

  size_t kmer_size = gfiles[0].hdr.kmer_size;

  // default to one colour for now
  if(use_ncols == 0) use_ncols = 1;

  // Flatten if we don't have to remember colours / output a graph
  if(out_ctx_path == NULL)
  {
    ncols = use_ncols = 1;
    for(i = 0; i < num_gfiles; i++)
      file_filter_flatten(&gfiles[i].fltr, 0);
  }

  if(ncols < use_ncols) {
    warn("I only need %zu colour%s ('--ncols %zu' ignored)",
         ncols, util_plural_str(ncols), use_ncols);
    use_ncols = ncols;
  }

  char max_kmers_str[100];
  ulong_to_str(ctx_max_kmers, max_kmers_str);
  status("%zu input graph%s, max kmers: %s, using %zu colours",
         num_gfiles, util_plural_str(num_gfiles), max_kmers_str, use_ncols);

  // If no arguments given we default to removing tips < 2*kmer_size
  if(min_keep_tip < 0)
    min_keep_tip = 2 * kmer_size;

  // Warn if any graph files already cleaned
  size_t fromcol;
  ErrorCleaning *cleaning;

  for(i = 0; i < num_gfiles; i++) {
    for(j = 0; j < file_filter_num(&gfiles[i].fltr); j++) {
      fromcol = file_filter_fromcol(&gfiles[i].fltr, j);
      cleaning = &gfiles[i].hdr.ginfo[fromcol].cleaning;
      if(cleaning->cleaned_snodes && unitig_cleaning) {
        warn("%s:%zu already has unitig cleaning with threshold: <%zu",
             file_filter_path(&gfiles[i].fltr), fromcol,
             (size_t)cleaning->clean_snodes_thresh);
      }
      if(cleaning->cleaned_tips && tip_cleaning) {
        warn("%s:%zu already has had tip cleaned",
             file_filter_path(&gfiles[i].fltr), fromcol);
      }
    }
  }

  // Print steps
  size_t step = 0;
  status("Actions:\n");
  if(covg_before_path != NULL)
    status("%zu. Saving kmer coverage distribution to: %s", step++, covg_before_path);
  if(len_before_path != NULL)
    status("%zu. Saving unitig length distribution to: %s", step++, len_before_path);
  if(min_keep_tip > 0)
    status("%zu. Cleaning tips shorter than %i nodes", step++, min_keep_tip);
  if(unitig_min > 0)
    status("%zu. Cleaning unitigs with coverage < %i", step++, unitig_min);
  if(unitig_min < 0)
    status("%zu. Cleaning unitigs with auto-detected threshold", step++);
  if(covg_after_path != NULL)
    status("%zu. Saving kmer coverage distribution to: %s", step++, covg_after_path);
  if(len_after_path != NULL)
    status("%zu. Saving unitig length distribution to: %s", step++, len_after_path);

  //
  // Decide memory usage
  //
  bool all_colours_loaded = (ncols <= use_ncols);
  bool use_mem_limit = (memargs.mem_to_use_set && num_gfiles > 1) || !ctx_max_kmers;

  size_t kmers_in_hash, bits_per_kmer, graph_mem;
  size_t per_col_bits = (sizeof(Covg)+sizeof(Edges)) * 8;
  size_t extra_edge_bits = (all_colours_loaded ? 0 : sizeof(Edges) * 8);

  bits_per_kmer = sizeof(BinaryKmer)*8 +
                  per_col_bits * use_ncols +
                  extra_edge_bits;

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        ctx_max_kmers, ctx_sum_kmers,
                                        use_mem_limit, &graph_mem);

  // Maximise the number of colours we load to fill the mem
  size_t max_usencols = (memargs.mem_to_use*8 -
                         sizeof(BinaryKmer)*8*kmers_in_hash +
                         extra_edge_bits*kmers_in_hash) /
                        (per_col_bits*kmers_in_hash);
  use_ncols = MIN2(max_usencols, ncols);

  cmd_check_mem_limit(memargs.mem_to_use, graph_mem);

  //
  // Check output files are writable
  //
  futil_create_output(out_ctx_path);

  // Does nothing if arg is NULL
  futil_create_output(covg_before_path);
  futil_create_output(covg_after_path);
  futil_create_output(len_before_path);
  futil_create_output(len_after_path);

  // Create db_graph
  // Load as many colours as possible
  // Use an extra set of edge to take intersections
  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size, use_ncols, use_ncols,
                 kmers_in_hash, DBG_ALLOC_EDGES | DBG_ALLOC_COVGS);

  // Extra edges required to hold union of kept edges
  Edges *edges_union = NULL;
  if(use_ncols < ncols)
    edges_union = ctx_calloc(db_graph.ht.capacity, sizeof(Edges));

  // Load graph into a single colour
  GraphLoadingPrefs gprefs = graph_loading_prefs(&db_graph);

  // Construct cleaned graph header
  GraphFileHeader outhdr;
  memset(&outhdr, 0, sizeof(GraphFileHeader));
  for(i = 0; i < num_gfiles; i++)
    graph_file_merge_header(&outhdr, &gfiles[i]);

  if(ncols > use_ncols)
  {
    db_graph.num_of_cols = db_graph.num_edge_cols = 1;
    SWAP(edges_union, db_graph.col_edges);
    graphs_load_files_flat(gfiles, num_gfiles, gprefs, NULL);
    SWAP(edges_union, db_graph.col_edges);
    db_graph.num_of_cols = db_graph.num_edge_cols = use_ncols;
  }
  else {
    for(i = 0; i < num_gfiles; i++)
      graph_load(&gfiles[i], gprefs, NULL);
  }

  char num_kmers_str[100];
  ulong_to_str(db_graph.ht.num_kmers, num_kmers_str);
  status("Total kmers loaded: %s\n", num_kmers_str);

  size_t initial_nkmers = db_graph.ht.num_kmers;
  hash_table_print_stats(&db_graph.ht);

  uint8_t *visited = ctx_calloc(roundup_bits2bytes(db_graph.ht.capacity), 1);
  uint8_t *keep = ctx_calloc(roundup_bits2bytes(db_graph.ht.capacity), 1);

  // Always estimate cleaning threshold
  // if(unitig_min <= 0 || covg_before_path || len_before_path)
  // {
    // Get coverage distribution and estimate cleaning threshold
    int est_min_covg = cleaning_get_threshold(nthreads,
                                              covg_before_path,
                                              len_before_path,
                                              visited, &db_graph);

    if(est_min_covg < 0) status("Cannot find recommended cleaning threshold");
    else status("Recommended cleaning threshold is: %i", est_min_covg);

    // Use estimated threshold if threshold not set
    if(unitig_min < 0) {
      if(fallback_thresh > 0 && est_min_covg < (int)fallback_thresh) {
        status("Using fallback threshold: %i", fallback_thresh);
        unitig_min = fallback_thresh;
      }
      else if(est_min_covg >= 0) unitig_min = est_min_covg;
    }
  // }

  // Die if we failed to find suitable cleaning threshold
  if(unitig_min < 0)
    die("Need cleaning threshold (--unitigs=<D> or --fallback <D>)");

  // Cleaning parameters should now be set (>0) or turned off (==0)
  ctx_assert(unitig_min >= 0);
  ctx_assert(min_keep_tip >= 0);

  if(unitig_min || min_keep_tip)
  {
    // Clean graph of tips (if min_keep_tip > 0) and unitigs (if threshold > 0)
    clean_graph(nthreads, unitig_min, min_keep_tip,
                covg_after_path, len_after_path,
                visited, keep, &db_graph);
  }

  ctx_free(visited);
  ctx_free(keep);

  if(out_ctx_path != NULL)
  {
    // Set output header ginfo cleaned
    for(col = 0; col < ncols; col++)
    {
      cleaning = &outhdr.ginfo[col].cleaning;
      cleaning->cleaned_snodes |= unitig_cleaning;
      cleaning->cleaned_tips |= tip_cleaning;

      // if(tip_cleaning) {
      //   strbuf_append_str(&outhdr.ginfo[col].sample_name, ".tipclean");
      // }

      if(unitig_cleaning) {
        size_t thresh = cleaning->clean_snodes_thresh;
        thresh = cleaning->cleaned_snodes ? MAX2(thresh, (uint32_t)unitig_min)
                                          : (uint32_t)unitig_min;
        cleaning->clean_snodes_thresh = thresh;

        // char name_append[200];
        // sprintf(name_append, ".supclean%zu", thresh);
        // strbuf_append_str(&outhdr.ginfo[col].sample_name, name_append);
      }
    }

    // Print stats on removed kmers
    size_t removed_nkmers = initial_nkmers - db_graph.ht.num_kmers;
    double removed_pct = (100.0 * removed_nkmers) / initial_nkmers;
    char removed_str[100], init_str[100];
    ulong_to_str(removed_nkmers, removed_str);
    ulong_to_str(initial_nkmers, init_str);
    status("Removed %s of %s (%.2f%%) kmers", removed_str, init_str, removed_pct);

    // kmers_loaded=true
    graph_writer_merge(out_ctx_path, gfiles, num_gfiles,
                      true, all_colours_loaded,
                      edges_union, &outhdr, &db_graph);
  }

  ctx_check(db_graph.ht.num_kmers == hash_table_count_kmers(&db_graph.ht));

  // TODO: report kmer coverage for each sample

  graph_header_dealloc(&outhdr);

  for(i = 0; i < num_gfiles; i++) graph_file_close(&gfiles[i]);
  ctx_free(gfiles);

  ctx_free(edges_union);
  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #17
0
int ctx_reads(int argc, char **argv)
{
  parse_args(argc, argv);

  //
  // Open input graphs
  //
  GraphFileReader *gfiles = ctx_calloc(num_gfiles, sizeof(GraphFileReader));
  size_t i, ctx_max_kmers = 0, ctx_sum_kmers = 0;

  graph_files_open(gfile_paths, gfiles, num_gfiles,
                   &ctx_max_kmers, &ctx_sum_kmers);

  // Will exit and remove output files on error
  inputs_attempt_open();

  //
  // Calculate memory use
  //
  size_t kmers_in_hash, graph_mem, bits_per_kmer = sizeof(BinaryKmer)*8;

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        ctx_max_kmers, ctx_sum_kmers,
                                        true, &graph_mem);

  cmd_check_mem_limit(memargs.mem_to_use, graph_mem);

  //
  // Set up graph
  //
  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size, 1, 0, kmers_in_hash, 0);

  // Load graphs
  LoadingStats gstats = LOAD_STATS_INIT_MACRO;

  GraphLoadingPrefs gprefs = {.db_graph = &db_graph,
                              .must_exist_in_graph = false,
                              .empty_colours = true,
                              .boolean_covgs = false};

  for(i = 0; i < num_gfiles; i++) {
    file_filter_flatten(&gfiles[i].fltr, 0);
    graph_load(&gfiles[i], gprefs, &gstats);
    graph_file_close(&gfiles[i]);
    gprefs.empty_colours = false;
  }
  ctx_free(gfiles);

  status("Printing reads that do %stouch the graph\n",
         inputs.b[0].invert ? "not " : "");

  //
  // Filter reads using async io
  //
  LoadingStats seq_stats = LOAD_STATS_INIT_MACRO;

  for(i = 0; i < inputs.len; i++) {
    inputs.b[i].stats = &seq_stats;
    inputs.b[i].db_graph = &db_graph;
  }

  // Deal with a set of files at once
  size_t start, end;
  for(start = 0; start < inputs.len; start += MAX_IO_THREADS)
  {
    // Can have different numbers of inputs vs threads
    end = MIN2(inputs.len, start+MAX_IO_THREADS);
    asyncio_run_pool(files.b+start, end-start, filter_reads, NULL, nthreads, 0);
  }

  size_t total_reads_printed = 0;
  size_t total_reads = seq_stats.num_se_reads + seq_stats.num_pe_reads;

  for(i = 0; i < inputs.len; i++)
    total_reads_printed += inputs.b[i].num_of_reads_printed;

  for(i = 0; i < inputs.len; i++) {
    seqout_close(&inputs.b[i].seqout, false);
    asyncio_task_close(&files.b[i]);
  }

  aln_reads_buf_dealloc(&inputs);
  asyncio_buf_dealloc(&files);

  status("Total printed %zu / %zu (%.2f%%) reads\n",
         total_reads_printed, total_reads,
         total_reads ? (100.0 * total_reads_printed) / total_reads : 0.0);

  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #18
0
int ctx_infer_edges(int argc, char **argv)
{
  size_t num_of_threads = DEFAULT_NTHREADS;
  struct MemArgs memargs = MEM_ARGS_INIT;
  char *out_ctx_path = NULL;
  bool add_pop_edges = false, add_all_edges = false;

  // Arg parsing
  char cmd[100];
  char shortopts[100];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 'o': cmd_check(!out_ctx_path,cmd); out_ctx_path = optarg; break;
      case 't': num_of_threads = cmd_uint32_nonzero(cmd, optarg); break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'A': add_all_edges = true; break;
      case 'P': add_pop_edges = true; break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        // cmd_print_usage(NULL);
        die("`"CMD" inferedges -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  // Default to adding all edges
  if(!add_pop_edges && !add_all_edges) add_all_edges = true;

  // Can only specify one of --pop --all
  if(add_pop_edges && add_all_edges)
    cmd_print_usage("Please specify only one of --all --pop");

  // Check that optind+1 == argc
  if(optind+1 > argc)
    cmd_print_usage("Expected exactly one graph file");
  else if(optind+1 < argc)
    cmd_print_usage("Expected only one graph file. What is this: '%s'", argv[optind]);

  //
  // Open graph file
  //
  char *graph_path = argv[optind];
  status("Reading graph: %s", graph_path);

  if(strchr(graph_path,':') != NULL)
    cmd_print_usage("Cannot use ':' in input graph for `"CMD" inferedges`");

  GraphFileReader file;
  memset(&file, 0, sizeof(file));

  file_filter_open(&file.fltr, graph_path);

  // Use stat to detect if we are reading from a stream
  struct stat st;
  bool reading_stream = (stat(file.fltr.path.b, &st) != 0);

  // Mode r+ means open (not create) for update (read & write)
  graph_file_open2(&file, graph_path, reading_stream ? "r" : "r+", 0);

  if(!file_filter_is_direct(&file.fltr))
    cmd_print_usage("Inferedges with filter not implemented - sorry");

  bool editing_file = !(out_ctx_path || reading_stream);

  FILE *fout = NULL;

  // Editing input file or writing a new file
  if(!editing_file)
    fout = futil_fopen_create(out_ctx_path ? out_ctx_path : "-", "w");

  // Print output status
  if(fout == stdout) status("Writing to STDOUT");
  else if(fout != NULL) status("Writing to: %s", out_ctx_path);
  else status("Editing file in place: %s", graph_path);

  status("Inferring all missing %sedges", add_pop_edges ? "population " : "");

  //
  // Decide on memory
  //
  const size_t ncols = file.hdr.num_of_cols;
  size_t kmers_in_hash, graph_mem, bits_per_kmer;

  // reading stream: all covgs + edges
  // reading file: one bit per kmer per colour for 'in colour'
  bits_per_kmer = sizeof(BinaryKmer)*8;

  if(reading_stream) {
    bits_per_kmer += ncols * 8 * (sizeof(Edges) + sizeof(Covg));
  } else {
    bits_per_kmer += ncols; // in colour
  }

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        file.num_of_kmers, file.num_of_kmers,
                                        memargs.mem_to_use_set, &graph_mem);

  cmd_check_mem_limit(memargs.mem_to_use, graph_mem);

  //
  // Allocate memory
  //
  int alloc_flags = reading_stream ? DBG_ALLOC_EDGES | DBG_ALLOC_COVGS
                                   : DBG_ALLOC_NODE_IN_COL;

  dBGraph db_graph;
  db_graph_alloc(&db_graph, file.hdr.kmer_size,
                 ncols, reading_stream ? ncols : 1,
                 kmers_in_hash, alloc_flags);

  LoadingStats stats = LOAD_STATS_INIT_MACRO;
  GraphLoadingPrefs gprefs = {.db_graph = &db_graph,
                              .boolean_covgs = false,
                              .must_exist_in_graph = false,
                              .must_exist_in_edges = NULL,
                              .empty_colours = false};

  // We need to load the graph for both --pop and --all since we need to check
  // if the next kmer is in each of the colours
  graph_load(&file, gprefs, &stats);

  if(add_pop_edges) status("Inferring edges from population...\n");
  else status("Inferring all missing edges...\n");

  size_t num_kmers_edited;

  if(reading_stream)
  {
    ctx_assert(fout != NULL);
    num_kmers_edited = infer_edges(num_of_threads, add_all_edges, &db_graph);
    graph_write_header(fout, &file.hdr);
    graph_write_all_kmers(fout, &db_graph);
  }
  else if(fout == NULL) {
    num_kmers_edited = inferedges_on_mmap(&db_graph, add_all_edges, &file);
  } else {
    num_kmers_edited = inferedges_on_file(&db_graph, add_all_edges, &file, fout);
  }

  if(fout != NULL && fout != stdout) fclose(fout);

  char modified_str[100], kmers_str[100];
  ulong_to_str(num_kmers_edited, modified_str);
  ulong_to_str(db_graph.ht.num_kmers, kmers_str);

  double modified_rate = 0;
  if(db_graph.ht.num_kmers)
    modified_rate = (100.0 * num_kmers_edited) / db_graph.ht.num_kmers;

  status("%s of %s (%.2f%%) nodes modified\n",
         modified_str, kmers_str, modified_rate);

  if(editing_file)
  {
    // Close and re-open
    fclose(file.fh);
    file.fh = NULL;
    futil_update_timestamp(file.fltr.path.b);
  }

  graph_file_close(&file);
  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #19
0
int ctx_thread(int argc, char **argv)
{
  struct ReadThreadCmdArgs args;
  read_thread_args_alloc(&args);
  read_thread_args_parse(&args, argc, argv, longopts, false);

  GraphFileReader *gfile = &args.gfile;
  GPathFileBuffer *gpfiles = &args.gpfiles;
  CorrectAlnInputBuffer *inputs = &args.inputs;
  size_t i;

  if(args.zero_link_counts && gpfiles->len == 0)
    cmd_print_usage("-0,--zero-paths without -p,--paths <in.ctp> has no meaning");

  // Check each path file only loads one colour
  gpaths_only_for_colour(gpfiles->b, gpfiles->len, 0);

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem, total_mem;
  size_t path_hash_mem, path_store_mem, path_mem;
  bool sep_path_list = (!args.use_new_paths && gpfiles->len > 0);

  bits_per_kmer = sizeof(BinaryKmer)*8 + sizeof(Edges)*8 + sizeof(GPath*)*8 +
                  2 * args.nthreads; // Have traversed

  // false -> don't use mem_to_use to decide how many kmers to store in hash
  // since we need some of that memory for storing paths
  kmers_in_hash = cmd_get_kmers_in_hash(args.memargs.mem_to_use,
                                        args.memargs.mem_to_use_set,
                                        args.memargs.num_kmers,
                                        args.memargs.num_kmers_set,
                                        bits_per_kmer,
                                        gfile->num_of_kmers,
                                        gfile->num_of_kmers,
                                        false, &graph_mem);

  // Paths memory
  size_t min_path_mem = 0;
  gpath_reader_sum_mem(gpfiles->b, gpfiles->len, 1, true, true, &min_path_mem);

  if(graph_mem + min_path_mem > args.memargs.mem_to_use) {
    char buf[50];
    die("Require at least %s memory", bytes_to_str(graph_mem+min_path_mem, 1, buf));
  }

  path_mem = args.memargs.mem_to_use - graph_mem;
  size_t pentry_hash_mem = sizeof(GPEntry)/0.7;
  size_t pentry_store_mem = sizeof(GPath) + 8 + // struct + sequence
                            1 + // in colour
                            sizeof(uint8_t) + // counts
                            sizeof(uint32_t); // kmer length

  size_t max_paths = path_mem / (pentry_store_mem + pentry_hash_mem);
  path_store_mem = max_paths * pentry_store_mem;
  path_hash_mem = max_paths * pentry_hash_mem;
  cmd_print_mem(path_hash_mem, "paths hash");
  cmd_print_mem(path_store_mem, "paths store");

  total_mem = graph_mem + path_mem;
  cmd_check_mem_limit(args.memargs.mem_to_use, total_mem);

  //
  // Open output file
  //
  gzFile gzout = futil_gzopen_create(args.out_ctp_path, "w");

  status("Creating paths file: %s", futil_outpath_str(args.out_ctp_path));

  //
  // Allocate memory
  //
  dBGraph db_graph;
  size_t kmer_size = gfile->hdr.kmer_size;
  db_graph_alloc(&db_graph, kmer_size, 1, 1, kmers_in_hash,
                 DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL);

  // Split path memory 2:1 between store and hash
  // Create a path store that tracks path counts
  gpath_store_alloc(&db_graph.gpstore,
                    db_graph.num_of_cols, db_graph.ht.capacity,
                    0, path_store_mem, true, sep_path_list);

  // Create path hash table for fast lookup
  gpath_hash_alloc(&db_graph.gphash, &db_graph.gpstore, path_hash_mem);

  if(args.use_new_paths) {
    status("Using paths as they are added (risky)");
  } else {
    status("Not using new paths as they are added (safe)");
  }

  //
  // Start up workers to add paths to the graph
  //
  GenPathWorker *workers;
  workers = gen_paths_workers_alloc(args.nthreads, &db_graph);

  // Setup for loading graphs graph
  LoadingStats gstats;
  loading_stats_init(&gstats);

  // Path statistics
  LoadingStats *load_stats = gen_paths_get_stats(workers);
  CorrectAlnStats *aln_stats = gen_paths_get_aln_stats(workers);

  // Load contig hist distribution
  for(i = 0; i < gpfiles->len; i++) {
    gpath_reader_load_contig_hist(gpfiles->b[i].json,
                                  gpfiles->b[i].fltr.path.b,
                                  file_filter_fromcol(&gpfiles->b[i].fltr, 0),
                                  &aln_stats->contig_histgrm);
  }

  GraphLoadingPrefs gprefs = {.db_graph = &db_graph,
                              .boolean_covgs = false,
                              .must_exist_in_graph = false,
                              .must_exist_in_edges = NULL,
                              .empty_colours = false}; // already loaded paths

  // Load graph, print stats, close file
  graph_load(gfile, gprefs, &gstats);
  hash_table_print_stats_brief(&db_graph.ht);
  graph_file_close(gfile);

  // Load existing paths
  for(i = 0; i < gpfiles->len; i++)
    gpath_reader_load(&gpfiles->b[i], GPATH_DIE_MISSING_KMERS, &db_graph);

  // zero link counts of already loaded links
  if(args.zero_link_counts) {
    status("Zeroing link counts for loaded links");
    gpath_set_zero_nseen(&db_graph.gpstore.gpset);
  }

  if(!args.use_new_paths)
    gpath_store_split_read_write(&db_graph.gpstore);

  // Deal with a set of files at once
  // Can have different numbers of inputs vs threads
  size_t start, end;
  for(start = 0; start < inputs->len; start += MAX_IO_THREADS)
  {
    end = MIN2(inputs->len, start+MAX_IO_THREADS);
    generate_paths(inputs->b+start, end-start, workers, args.nthreads);
  }

  // Print memory statistics
  gpath_hash_print_stats(&db_graph.gphash);
  gpath_store_print_stats(&db_graph.gpstore);

  correct_aln_dump_stats(aln_stats, load_stats,
                         args.dump_seq_sizes,
                         args.dump_frag_sizes,
                         db_graph.ht.num_kmers);

  // Don't need GPathHash anymore
  gpath_hash_dealloc(&db_graph.gphash);

  cJSON **hdrs = ctx_malloc(gpfiles->len * sizeof(cJSON*));
  for(i = 0; i < gpfiles->len; i++) hdrs[i] = gpfiles->b[i].json;

  size_t output_threads = MIN2(args.nthreads, MAX_IO_THREADS);

  // Generate a cJSON header for all inputs
  cJSON *thread_hdr = cJSON_CreateObject();
  cJSON *inputs_hdr = cJSON_CreateArray();
  cJSON_AddItemToObject(thread_hdr, "inputs", inputs_hdr);
  for(i = 0; i < inputs->len; i++)
    cJSON_AddItemToArray(inputs_hdr, correct_aln_input_json_hdr(&inputs->b[i]));

  // Write output file
  gpath_save(gzout, args.out_ctp_path, output_threads, true,
             "thread", thread_hdr, hdrs, gpfiles->len,
             &aln_stats->contig_histgrm, 1,
             &db_graph);

  gzclose(gzout);
  ctx_free(hdrs);

  // Optionally run path checks for debugging
  // gpath_checks_all_paths(&db_graph, args.nthreads);

  // ins_gap, err_gap no longer allocated after this line
  gen_paths_workers_dealloc(workers, args.nthreads);

  // Close and free input files etc.
  read_thread_args_dealloc(&args);
  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #20
0
void all_tests_add_paths_multi(dBGraph *graph, const char **seqs, size_t nseqs,
                               CorrectAlnParam params,
                               int exp_npaths, int exp_nkmers)
{
  size_t npaths = graph->gpstore.num_paths;
  size_t nkmers = graph->gpstore.num_kmers_with_paths;

  size_t i, nworkers = 1;
  GenPathWorker *wrkrs = gen_paths_workers_alloc(nworkers, graph);

  // Set up asyncio input data
  AsyncIOInput io = {.file1 = NULL, .file2 = NULL,
                     .fq_offset = 0, .interleaved = false};

  CorrectAlnInput task = {.files = io, .fq_cutoff = 0, .hp_cutoff = 0,
                          .matedir = READPAIR_FR, .crt_params = params,
                          .out_base = NULL, .output = NULL};

  AsyncIOData iodata;
  asynciodata_alloc(&iodata);
  seq_read_reset(&iodata.r2);
  iodata.fq_offset1 = iodata.fq_offset2 = 0;
  iodata.ptr = NULL;

  // Add paths
  for(i = 0; i < nseqs; i++) {
    seq_read_set(&iodata.r1, seqs[i]);
    gen_paths_worker_seq(wrkrs, &iodata, &task);
  }

  asynciodata_dealloc(&iodata);
  gen_paths_workers_dealloc(wrkrs, nworkers);

  // Check we added the right number of paths
  if(exp_npaths >= 0) {
    TASSERT2(graph->gpstore.num_paths == npaths + (size_t)exp_npaths, "%zu %zu %zu",
             (size_t)graph->gpstore.num_paths, (size_t)npaths, (size_t)exp_npaths);
  }

  if(exp_nkmers >= 0) {
    TASSERT(graph->gpstore.num_kmers_with_paths == nkmers + (size_t)exp_nkmers);
  }
}

void all_tests_add_paths(dBGraph *graph, const char *seq,
                         CorrectAlnParam params,
                         int exp_npaths, int exp_nkmers)
{
  all_tests_add_paths_multi(graph, &seq, 1, params, exp_npaths, exp_nkmers);
}

void all_tests_construct_graph(dBGraph *graph,
                               size_t kmer_size, size_t ncols,
                               const char **seqs, size_t nseqs,
                               CorrectAlnParam path_params)
{
  size_t i;
  db_graph_alloc(graph, kmer_size, ncols, ncols, 1024,
                 DBG_ALLOC_EDGES | DBG_ALLOC_COVGS |
                 DBG_ALLOC_NODE_IN_COL | DBG_ALLOC_BKTLOCKS);

  // Path data
  gpath_store_alloc(&graph->gpstore, ncols, graph->ht.capacity,
                    0, ONE_MEGABYTE, true, false);

  // Don't use links to add new links
  gpath_store_split_read_write(&graph->gpstore);

  // Allocate path hash table just in case
  gpath_hash_alloc(&graph->gphash, &graph->gpstore, ONE_MEGABYTE);

  // Build graph
  for(i = 0; i < nseqs; i++)
    build_graph_from_str_mt(graph, 0, seqs[i], strlen(seqs[i]), false);

  gpath_store_merge_read_write(&graph->gpstore);

  graph->num_of_cols_used = MAX2(graph->num_of_cols_used, 1);

  all_tests_add_paths_multi(graph, seqs, nseqs, path_params, -1, -1);
}
예제 #21
0
static void test_kmer_occur_filter()
{
  // Construct 1 colour graph with kmer-size=11
  dBGraph graph;
  const size_t kmer_size = 11, ncols = 3;
  size_t i;

  // Create graph
  db_graph_alloc(&graph, kmer_size, ncols, 1, 2000,
                 DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL | DBG_ALLOC_BKTLOCKS);

  //      xyz------->>>      y         >  <         X
  // TTCGACCCGACAGGGCAACGTAGTCCGACAGGGCACAGCCCTGTCGGGGGGTGCA

  #define NUM_NODES 3
  #define NUM_READS 3

  const char *tmp[NUM_READS]
  = {
    "AACA",
    "TTCGACCCGACAGGGCAACGTAGTCCGACAGGGCACAGCCCTGTCGGGGGGTGCA",
    "TCTAGCATGTGTGTT"};

  read_t reads[NUM_READS];
  for(i = 0; i < NUM_READS; i++) {
    seq_read_alloc(&reads[i]);
    seq_read_set(&reads[i], tmp[i]);
  }

  KOGraph kograph = kograph_create(reads, NUM_READS, true, 0, 1, &graph);

  TASSERT(kograph.nchroms == NUM_READS);
  TASSERT(kograph.koccurs != NULL);

  KOccurRunBuffer koruns, koruns_tmp, koruns_ended;
  korun_buf_alloc(&koruns, 16);
  korun_buf_alloc(&koruns_tmp, 16);
  korun_buf_alloc(&koruns_ended, 16);

  // Check CCCGACAGGGCAA starts at CCCGACAGGGC
  // x=CCCGACAGGGC, y=CCGACAGGGCA, z=CGACAGGGCAA
  // X=GCCCTGTCGGG, Y=TGCCCTGTCGG, Z=TTGCCCTGTCG
  dBNode nodes[NUM_NODES];
  for(i = 0; i < NUM_NODES; i++)
    nodes[i] = db_graph_find_str(&graph, &"CCCGACAGGGCAA"[i]);

  korun_buf_reset(&koruns);
  korun_buf_reset(&koruns_ended);
  kograph_filter_extend(&kograph, nodes, NUM_NODES, true, 0, 0,
                        &koruns, &koruns_tmp, &koruns_ended);

  // Checks
  TASSERT2(koruns.len == 1, "koruns.len: %zu", koruns.len);
  TASSERT(koruns.b[0].strand == STRAND_PLUS); // left-to-right with ref
  TASSERT2(koruns.b[0].chrom == 1, "chrom: %zu", (size_t)koruns.b[0].chrom);
  TASSERT2(koruns.b[0].first == 5, "offset: %zu", (size_t)koruns.b[0].first);
  TASSERT2(koruns.b[0].last == 7, "last: %zu", (size_t)koruns.b[0].last);

  // Test reverse
  db_nodes_reverse_complement(nodes, NUM_NODES);

  korun_buf_reset(&koruns);
  korun_buf_reset(&koruns_ended);
  kograph_filter_extend(&kograph, nodes, 1, true, 0, 0, &koruns, &koruns_tmp, &koruns_ended);
  kograph_filter_extend(&kograph, nodes+1, 1, true, 0, 1, &koruns, &koruns_tmp, &koruns_ended);
  kograph_filter_extend(&kograph, nodes+2, 1, true, 0, 2, &koruns, &koruns_tmp, &koruns_ended);

  // Print out for debugging
  // printf("koruns: ");
  // koruns_print(koruns.b, koruns.len, kmer_size, stdout);
  // printf("\nkoruns_ended: ");
  // koruns_print(koruns_ended.b, koruns_ended.len, kmer_size, stdout);
  // printf("\n");

  // Check results match:
  // koruns: chromid:1:17-5:-, chromid:1:37-47:+
  // koruns_ended: chromid:1:34-24:-
  TASSERT2(koruns.len == 2, "koruns.len: %zu", koruns.len);
  TASSERT2(koruns_ended.len == 1, "koruns_ended.len: %zu", koruns_ended.len);
  TASSERT(koruns.b[0].strand == STRAND_MINUS); // reverse complement of ref
  TASSERT2(koruns.b[0].chrom == 1, "chrom: %zu", (size_t)koruns.b[0].chrom);
  TASSERT2(koruns.b[0].first == 7, "offset: %zu", (size_t)koruns.b[0].first);
  TASSERT2(koruns.b[0].last == 5, "last: %zu", (size_t)koruns.b[0].last);

  korun_buf_dealloc(&koruns);
  korun_buf_dealloc(&koruns_tmp);
  korun_buf_dealloc(&koruns_ended);

  for(i = 0; i < NUM_READS; i++) seq_read_dealloc(&reads[i]);
  kograph_dealloc(&kograph);

  db_graph_dealloc(&graph);
}
예제 #22
0
파일: ctx_join.c 프로젝트: Phelimb/mccortex
int ctx_join(int argc, char **argv)
{
  struct MemArgs memargs = MEM_ARGS_INIT;
  const char *out_path = NULL;
  size_t use_ncols = 0;

  GraphFileReader tmp_gfile;
  GraphFileBuffer isec_gfiles_buf;
  gfile_buf_alloc(&isec_gfiles_buf, 8);

  // Arg parsing
  char cmd[100], shortopts[100];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;

  while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'o': cmd_check(!out_path, cmd); out_path = optarg; break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'N': cmd_check(!use_ncols, cmd); use_ncols = cmd_uint32_nonzero(cmd, optarg); break;
      case 'i':
        graph_file_reset(&tmp_gfile);
        graph_file_open(&tmp_gfile, optarg);
        if(file_filter_into_ncols(&tmp_gfile.fltr) > 1)
          warn("Flattening intersection graph into colour 0: %s", optarg);
        file_filter_flatten(&tmp_gfile.fltr, 0);
        gfile_buf_push(&isec_gfiles_buf, &tmp_gfile, 1);
        break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        // cmd_print_usage(NULL);
        die("`"CMD" join -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  GraphFileReader *igfiles = isec_gfiles_buf.b;
  size_t num_igfiles = isec_gfiles_buf.len;

  if(!out_path) cmd_print_usage("--out <out.ctx> required");

  if(optind >= argc)
    cmd_print_usage("Please specify at least one input graph file");

  // optind .. argend-1 are graphs to load
  size_t num_gfiles = (size_t)(argc - optind);
  char **gfile_paths = argv + optind;

  GraphFileReader *gfiles = ctx_calloc(num_gfiles, sizeof(GraphFileReader));

  status("Probing %zu graph files and %zu intersect files", num_gfiles, num_igfiles);

  // Check all binaries are valid binaries with matching kmer size
  size_t i;
  size_t ctx_max_cols = 0;
  uint64_t min_intersect_num_kmers = 0, ctx_max_kmers = 0, ctx_sum_kmers = 0;

  for(i = 0; i < num_gfiles; i++)
  {
    graph_file_open2(&gfiles[i], gfile_paths[i], "r", true, ctx_max_cols);

    if(gfiles[0].hdr.kmer_size != gfiles[i].hdr.kmer_size) {
      cmd_print_usage("Kmer sizes don't match [%u vs %u]",
                      gfiles[0].hdr.kmer_size, gfiles[i].hdr.kmer_size);
    }

    ctx_max_cols = MAX2(ctx_max_cols, file_filter_into_ncols(&gfiles[i].fltr));
    ctx_max_kmers = MAX2(ctx_max_kmers, graph_file_nkmers(&gfiles[i]));
    ctx_sum_kmers += graph_file_nkmers(&gfiles[i]);
  }

  // Probe intersection graph files
  for(i = 0; i < num_igfiles; i++)
  {
    if(gfiles[0].hdr.kmer_size != igfiles[i].hdr.kmer_size) {
      cmd_print_usage("Kmer sizes don't match [%u vs %u]",
                  gfiles[0].hdr.kmer_size, igfiles[i].hdr.kmer_size);
    }

    uint64_t nkmers = graph_file_nkmers(&igfiles[i]);

    if(i == 0) min_intersect_num_kmers = nkmers;
    else if(nkmers < min_intersect_num_kmers)
    {
      // Put smallest intersection binary first
      SWAP(igfiles[i], igfiles[0]);
      min_intersect_num_kmers = nkmers;
    }
  }

  bool take_intersect = (num_igfiles > 0);

  // If we are taking an intersection,
  // all kmers intersection kmers will need to be loaded
  if(take_intersect)
    ctx_max_kmers = ctx_sum_kmers = min_intersect_num_kmers;

  bool use_ncols_set = (use_ncols > 0);
  bool output_to_stdout = (strcmp(out_path,"-") == 0);

  // if(use_ncols == 0) use_ncols = 1;
  if(use_ncols_set) {
    if(use_ncols < ctx_max_cols && output_to_stdout)
      die("I need %zu colours if outputting to STDOUT (--ncols)", ctx_max_cols);
    if(use_ncols > ctx_max_cols) {
      warn("I only need %zu colour%s ('--ncols %zu' ignored)",
           ctx_max_cols, util_plural_str(ctx_max_cols), use_ncols);
      use_ncols = ctx_max_cols;
    }
  }
  else {
    use_ncols = output_to_stdout ? ctx_max_cols : 1;
  }

  // Check out_path is writable
  futil_create_output(out_path);

  status("Output %zu cols; from %zu files; intersecting %zu graphs; ",
         ctx_max_cols, num_gfiles, num_igfiles);

  if(num_gfiles == 1 && num_igfiles == 0)
  {
    // Loading only one file with no intersection files
    // Don't need to store a graph in memory, can filter as stream
    // Don't actually store anything in the de Bruijn graph, but we need to
    // pass it, so mock one up
    dBGraph db_graph;
    db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size,
                   file_filter_into_ncols(&gfiles[0].fltr), 0, 1024, 0);

    graph_writer_stream_mkhdr(out_path, &gfiles[0], &db_graph, NULL, NULL);
    graph_file_close(&gfiles[0]);
    gfile_buf_dealloc(&isec_gfiles_buf);
    ctx_free(gfiles);

    db_graph_dealloc(&db_graph);

    return EXIT_SUCCESS;
  }

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem;

  bits_per_kmer = sizeof(BinaryKmer)*8 +
                  (sizeof(Covg) + sizeof(Edges)) * 8 * use_ncols;

  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        ctx_max_kmers, ctx_sum_kmers,
                                        true, &graph_mem);

  if(!use_ncols_set)
  {
    // Maximise use_ncols
    size_t max_usencols = (memargs.mem_to_use*8) / bits_per_kmer;

    use_ncols = MIN2(max_usencols, ctx_max_cols);
    bits_per_kmer = sizeof(BinaryKmer)*8 +
                    (sizeof(Covg) + sizeof(Edges)) * 8 * use_ncols;

    // Re-check memory used
    kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                          memargs.mem_to_use_set,
                                          memargs.num_kmers,
                                          memargs.num_kmers_set,
                                          bits_per_kmer,
                                          ctx_max_kmers, ctx_sum_kmers,
                                          true, &graph_mem);
  }

  status("Using %zu colour%s in memory", use_ncols, util_plural_str(use_ncols));

  cmd_check_mem_limit(memargs.mem_to_use, graph_mem);

  // Create db_graph
  dBGraph db_graph;
  Edges *intersect_edges = NULL;
  size_t edge_cols = (use_ncols + take_intersect);

  db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size, use_ncols, use_ncols,
                 kmers_in_hash, DBG_ALLOC_COVGS);

  // We allocate edges ourself since it's a special case
  db_graph.col_edges = ctx_calloc(db_graph.ht.capacity*edge_cols, sizeof(Edges));

  // Load intersection binaries
  char *intsct_gname_ptr = NULL;
  StrBuf intersect_gname;
  strbuf_alloc(&intersect_gname, 1024);

  if(take_intersect)
  {
    GraphLoadingPrefs gprefs = graph_loading_prefs(&db_graph);
    gprefs.boolean_covgs = true; // covg++ only

    for(i = 0; i < num_igfiles; i++)
    {
      graph_load(&igfiles[i], gprefs, NULL);

      // Update intersect header
      // note: intersection graphs all load exactly one colour into colour 0
      graph_info_make_intersect(&igfiles[i].hdr.ginfo[0], &intersect_gname);

      gprefs.must_exist_in_graph = true;
      gprefs.must_exist_in_edges = db_graph.col_edges;
    }

    if(num_igfiles > 1)
    {
      // Remove nodes where covg != num_igfiles
      HASH_ITERATE_SAFE(&db_graph.ht, remove_non_intersect_nodes,
                        db_graph.col_covgs, (Covg)num_igfiles, &db_graph.ht);
    }

    status("Loaded intersection set\n");
    intsct_gname_ptr = intersect_gname.b;

    for(i = 0; i < num_igfiles; i++) graph_file_close(&igfiles[i]);

    // Reset graph info
    for(i = 0; i < db_graph.num_of_cols; i++)
      graph_info_init(&db_graph.ginfo[i]);

    // Zero covgs
    memset(db_graph.col_covgs, 0, db_graph.ht.capacity * sizeof(Covg));

    // Use union edges we loaded to intersect new edges
    intersect_edges = db_graph.col_edges;
    db_graph.col_edges += db_graph.ht.capacity;
  }

  bool kmers_loaded = take_intersect, colours_loaded = false;

  graph_writer_merge_mkhdr(out_path, gfiles, num_gfiles,
                          kmers_loaded, colours_loaded, intersect_edges,
                          intsct_gname_ptr, &db_graph);

  if(take_intersect)
    db_graph.col_edges -= db_graph.ht.capacity;

  for(i = 0; i < num_gfiles; i++) graph_file_close(&gfiles[i]);

  strbuf_dealloc(&intersect_gname);
  gfile_buf_dealloc(&isec_gfiles_buf);
  ctx_free(gfiles);

  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}
예제 #23
0
int ctx_vcfcov(int argc, char **argv)
{
  struct MemArgs memargs = MEM_ARGS_INIT;
  const char *out_path = NULL, *out_type = NULL;

  uint32_t max_allele_len = 0, max_gt_vars = 0;
  char *ref_path = NULL;
  bool low_mem = false;

  // Arg parsing
  char cmd[100];
  char shortopts[300];
  cmd_long_opts_to_short(longopts, shortopts, sizeof(shortopts));
  int c;
  size_t i;

  // silence error messages from getopt_long
  // opterr = 0;

  while((c = getopt_long_only(argc, argv, shortopts, longopts, NULL)) != -1) {
    cmd_get_longopt_str(longopts, c, cmd, sizeof(cmd));
    switch(c) {
      case 0: /* flag set */ break;
      case 'h': cmd_print_usage(NULL); break;
      case 'o': cmd_check(!out_path, cmd); out_path = optarg; break;
      case 'O': cmd_check(!out_type, cmd); out_type = optarg; break;
      case 'f': cmd_check(!futil_get_force(), cmd); futil_set_force(true); break;
      case 'm': cmd_mem_args_set_memory(&memargs, optarg); break;
      case 'n': cmd_mem_args_set_nkmers(&memargs, optarg); break;
      case 'r': cmd_check(!ref_path, cmd); ref_path = optarg; break;
      case 'L': cmd_check(!max_allele_len,cmd); max_allele_len = cmd_uint32(cmd,optarg); break;
      case 'N': cmd_check(!max_gt_vars,cmd); max_gt_vars = cmd_uint32(cmd,optarg); break;
      case 'M': cmd_check(!low_mem, cmd); low_mem = true; break;
      case ':': /* BADARG */
      case '?': /* BADCH getopt_long has already printed error */
        // cmd_print_usage(NULL);
        die("`"CMD" "SUBCMD" -h` for help. Bad option: %s", argv[optind-1]);
      default: abort();
    }
  }

  // Defaults for unset values
  if(out_path == NULL) out_path = "-";
  if(ref_path == NULL) cmd_print_usage("Require a reference (-r,--ref <ref.fa>)");
  if(optind+2 > argc) cmd_print_usage("Require VCF and graph files");

  if(!max_allele_len) max_allele_len = DEFAULT_MAX_ALLELE_LEN;
  if(!max_gt_vars) max_gt_vars = DEFAULT_MAX_GT_VARS;

  status("[vcfcov] max allele length: %u; max number of variants: %u",
         max_allele_len, max_gt_vars);

  // open ref
  // index fasta with: samtools faidx ref.fa
  faidx_t *fai = fai_load(ref_path);
  if(fai == NULL) die("Cannot load ref index: %s / %s.fai", ref_path, ref_path);

  // Open input VCF file
  const char *vcf_path = argv[optind++];
  htsFile *vcffh = hts_open(vcf_path, "r");
  if(vcffh == NULL) die("Cannot open VCF file: %s", vcf_path);
  bcf_hdr_t *vcfhdr = bcf_hdr_read(vcffh);
  if(vcfhdr == NULL) die("Cannot read VCF header: %s", vcf_path);

  // Test we can close and reopen files
  if(low_mem) {
    if((vcffh = hts_open(vcf_path, "r")) == NULL)
      die("Cannot re-open VCF file: %s", vcf_path);
    if((vcfhdr = bcf_hdr_read(vcffh)) == NULL)
      die("Cannot re-read VCF header: %s", vcf_path);
  }

  //
  // Open graph files
  //
  const size_t num_gfiles = argc - optind;
  char **graph_paths = argv + optind;
  ctx_assert(num_gfiles > 0);

  GraphFileReader *gfiles = ctx_calloc(num_gfiles, sizeof(GraphFileReader));
  size_t ncols, ctx_max_kmers = 0, ctx_sum_kmers = 0;

  ncols = graph_files_open(graph_paths, gfiles, num_gfiles,
                           &ctx_max_kmers, &ctx_sum_kmers);

  // Check graph + paths are compatible
  graphs_gpaths_compatible(gfiles, num_gfiles, NULL, 0, -1);

  //
  // Decide on memory
  //
  size_t bits_per_kmer, kmers_in_hash, graph_mem;

  bits_per_kmer = sizeof(BinaryKmer)*8 + sizeof(Covg)*8 * ncols;
  kmers_in_hash = cmd_get_kmers_in_hash(memargs.mem_to_use,
                                        memargs.mem_to_use_set,
                                        memargs.num_kmers,
                                        memargs.num_kmers_set,
                                        bits_per_kmer,
                                        low_mem ? -1 : (int64_t)ctx_max_kmers,
                                        ctx_sum_kmers,
                                        true, &graph_mem);

  cmd_check_mem_limit(memargs.mem_to_use, graph_mem);

  //
  // Open output file
  //
  // v=>vcf, z=>compressed vcf, b=>bcf, bu=>uncompressed bcf
  int mode = vcf_misc_get_outtype(out_type, out_path);
  futil_create_output(out_path);
  htsFile *outfh = hts_open(out_path, modes_htslib[mode]);
  status("[vcfcov] Output format: %s", hsmodes_htslib[mode]);


  // Allocate memory
  dBGraph db_graph;
  db_graph_alloc(&db_graph, gfiles[0].hdr.kmer_size, ncols, 1, kmers_in_hash,
                 DBG_ALLOC_COVGS);

  //
  // Set up tag names
  //

  // *R => ref, *A => alt
  sprintf(kcov_ref_tag, "K%zuR", db_graph.kmer_size); // mean coverage
  sprintf(kcov_alt_tag, "K%zuA", db_graph.kmer_size);

  // #SAMPLE=<ID=...,K29KCOV=...,K29NK=...,K29RLK>
  // - K29_kcov is empirical kmer coverage
  // - K29_nkmers is the number of kmers in the sample
  // - mean_read_length is the mean read length in bases
  char sample_kcov_tag[20], sample_nk_tag[20], sample_rlk_tag[20];
  sprintf(sample_kcov_tag, "K%zu_kcov", db_graph.kmer_size); // mean coverage
  sprintf(sample_nk_tag, "K%zu_nkmers", db_graph.kmer_size);
  sprintf(sample_rlk_tag, "mean_read_length");

  //
  // Load kmers if we are using --low-mem
  //

  VcfCovStats st;
  memset(&st, 0, sizeof(st));
  VcfCovPrefs prefs = {.kcov_ref_tag = kcov_ref_tag,
                       .kcov_alt_tag = kcov_alt_tag,
                       .max_allele_len = max_allele_len,
                       .max_gt_vars = max_gt_vars,
                       .load_kmers_only = false};

  if(low_mem)
  {
    status("[vcfcov] Loading kmers from VCF+ref");

    prefs.load_kmers_only = true;
    vcfcov_file(vcffh, vcfhdr, NULL, NULL, vcf_path, fai,
                NULL, &prefs, &st, &db_graph);

    // Close files
    hts_close(vcffh);
    bcf_hdr_destroy(vcfhdr);

    // Re-open files
    if((vcffh = hts_open(vcf_path, "r")) == NULL)
      die("Cannot re-open VCF file: %s", vcf_path);
    if((vcfhdr = bcf_hdr_read(vcffh)) == NULL)
      die("Cannot re-read VCF header: %s", vcf_path);

    prefs.load_kmers_only = false;
  }

  //
  // Load graphs
  //
  GraphLoadingStats gstats;
  memset(&gstats, 0, sizeof(gstats));

  GraphLoadingPrefs gprefs = graph_loading_prefs(&db_graph);
  gprefs.must_exist_in_graph = low_mem;

  for(i = 0; i < num_gfiles; i++) {
    graph_load(&gfiles[i], gprefs, &gstats);
    graph_file_close(&gfiles[i]);
  }
  ctx_free(gfiles);

  hash_table_print_stats(&db_graph.ht);

  //
  // Set up VCF header / graph matchup
  //
  size_t *samplehdrids = ctx_malloc(db_graph.num_of_cols * sizeof(size_t));

  // Add samples to vcf header
  bcf_hdr_t *outhdr = bcf_hdr_dup(vcfhdr);
  bcf_hrec_t *hrec;
  int sid;
  char hdrstr[200];

  for(i = 0; i < db_graph.num_of_cols; i++) {
    char *sname = db_graph.ginfo[i].sample_name.b;
    if((sid = bcf_hdr_id2int(outhdr, BCF_DT_SAMPLE, sname)) < 0) {
      bcf_hdr_add_sample(outhdr, sname);
      sid = bcf_hdr_id2int(outhdr, BCF_DT_SAMPLE, sname);
    }
    samplehdrids[i] = sid;

    // Add SAMPLE field
    hrec = bcf_hdr_get_hrec(outhdr, BCF_HL_STR, "ID", sname, "SAMPLE");

    if(hrec == NULL) {
      sprintf(hdrstr, "##SAMPLE=<ID=%s,%s=%"PRIu64",%s=%"PRIu64",%s=%zu>", sname,
              sample_kcov_tag,
              gstats.nkmers[i] ? gstats.sumcov[i] / gstats.nkmers[i] : 0,
              sample_nk_tag, gstats.nkmers[i],
              sample_rlk_tag, (size_t)db_graph.ginfo[i].mean_read_length);
      bcf_hdr_append(outhdr, hdrstr);
    }
    else {
      // mean kcovg
      sprintf(hdrstr, "%"PRIu64, gstats.sumcov[i] / gstats.nkmers[i]);
      vcf_misc_add_update_hrec(hrec, sample_kcov_tag, hdrstr);
      // num kmers
      sprintf(hdrstr, "%"PRIu64, gstats.nkmers[i]);
      vcf_misc_add_update_hrec(hrec, sample_nk_tag, hdrstr);
      // mean read length in kmers
      sprintf(hdrstr, "%zu", (size_t)db_graph.ginfo[i].mean_read_length);
      vcf_misc_add_update_hrec(hrec, sample_rlk_tag, hdrstr);
    }

    status("[vcfcov] Colour %zu: %s [VCF column %zu]", i, sname, samplehdrids[i]);
  }

  // Add genotype format fields
  // One field per alternative allele

  sprintf(hdrstr, "##FORMAT=<ID=%s,Number=A,Type=Integer,"
          "Description=\"Coverage on ref (k=%zu): sum(kmer_covs) / exp_num_kmers\">\n",
          kcov_ref_tag, db_graph.kmer_size);
  bcf_hdr_append(outhdr, hdrstr);
  sprintf(hdrstr, "##FORMAT=<ID=%s,Number=A,Type=Integer,"
          "Description=\"Coverage on alt (k=%zu): sum(kmer_covs) / exp_num_kmers\">\n",
          kcov_alt_tag, db_graph.kmer_size);
  bcf_hdr_append(outhdr, hdrstr);

  bcf_hdr_set_version(outhdr, "VCFv4.2");

  // Add command string to header
  vcf_misc_hdr_add_cmd(outhdr, cmd_get_cmdline(), cmd_get_cwd());

  if(bcf_hdr_write(outfh, outhdr) != 0)
    die("Cannot write header to: %s", futil_outpath_str(out_path));

  status("[vcfcov] Reading %s and adding coverage", vcf_path);

  // Reset stats and get coverage
  memset(&st, 0, sizeof(st));

  vcfcov_file(vcffh, vcfhdr, outfh, outhdr, vcf_path, fai,
              samplehdrids, &prefs, &st, &db_graph);

  // Print statistics
  char ns0[50], ns1[50];
  status("[vcfcov] Read %s VCF lines", ulong_to_str(st.nvcf_lines, ns0));
  status("[vcfcov] Read %s ALTs", ulong_to_str(st.nalts_read, ns0));
  status("[vcfcov] Used %s kmers", ulong_to_str(st.ngt_kmers, ns0));
  status("[vcfcov] ALTs used: %s / %s (%.2f%%)",
         ulong_to_str(st.nalts_loaded, ns0), ulong_to_str(st.nalts_read, ns1),
         st.nalts_read ? (100.0*st.nalts_loaded) / st.nalts_read : 0.0);
  status("[vcfcov] ALTs too long (>%ubp): %s / %s (%.2f%%)", max_allele_len,
         ulong_to_str(st.nalts_too_long, ns0), ulong_to_str(st.nalts_read, ns1),
         st.nalts_read ? (100.0*st.nalts_too_long) / st.nalts_read : 0.0);
  status("[vcfcov] ALTs too dense (>%u within %zubp): %s / %s (%.2f%%)",
         max_gt_vars, db_graph.kmer_size,
         ulong_to_str(st.nalts_no_covg, ns0), ulong_to_str(st.nalts_read, ns1),
         st.nalts_read ? (100.0*st.nalts_no_covg) / st.nalts_read : 0.0);
  status("[vcfcov] ALTs printed with coverage: %s / %s (%.2f%%)",
         ulong_to_str(st.nalts_with_covg, ns0), ulong_to_str(st.nalts_read, ns1),
         st.nalts_read ? (100.0*st.nalts_with_covg) / st.nalts_read : 0.0);

  status("[vcfcov] Saved to: %s\n", out_path);

  ctx_free(samplehdrids);
  graph_loading_stats_destroy(&gstats);

  bcf_hdr_destroy(vcfhdr);
  bcf_hdr_destroy(outhdr);
  hts_close(vcffh);
  hts_close(outfh);
  fai_destroy(fai);
  db_graph_dealloc(&db_graph);

  return EXIT_SUCCESS;
}