struct slName *subtractFiles(struct slName *fileList) /* Subtract two files using subtractLists */ { struct slName *initialList = slNameLoadReal(fileList->name); struct slName *subtractMe = slNameLoadReal(fileList->next->name); struct slName *diffList = subtractLists(initialList, subtractMe); slNameFreeList(&initialList); slNameFreeList(&subtractMe); return diffList; }
static void showTableFieldsCt(char *db, char *table, boolean withGetButton) /* Put up html table with a check box for each field of custom * track. */ { struct customTrack *ct = ctLookupName(table); char *type = ct->dbTrackType; if (type == NULL) type = ct->tdb->type; struct sqlConnection *conn = hAllocConn(CUSTOM_TRASH); struct asObject *asObj = asForTdb(conn, ct->tdb); if (asObj) { struct slName *fieldList = NULL; if (ct->dbTableName != NULL) { if (isVcfTable(table, NULL)) fieldList = vcfGetFields(); else fieldList = sqlListFields(conn, ct->dbTableName); } if (fieldList == NULL) fieldList = asColNames(asObj); showTableFieldsOnList(db, table, asObj, fieldList, FALSE, withGetButton); asObjectFree(&asObj); slNameFreeList(&fieldList); } else showBedTableFields(db, table, ct->fieldCount, withGetButton); hFreeConn(&conn); }
static struct slName *setup_labels(char *long_form, struct slName *bw_list, struct slName **labels_from_bw_list) { struct slName *lf_labels = NULL; if (long_form && !sameString(long_form, "on")) /* first check labels from CL */ { lf_labels = slNameListFromComma(long_form); int num_labels = slCount(lf_labels); if (num_labels != slCount(bw_list)) errAbort("number of labels provided should equal the number of bigWigs given"); } /* from file */ else { if (*labels_from_bw_list) { if (slCount(*labels_from_bw_list) == slCount(bw_list)) lf_labels = *labels_from_bw_list; else slNameFreeList(labels_from_bw_list); } if (!lf_labels) lf_labels = slNameCloneList(bw_list); } return lf_labels; }
void doMiddle(struct cart *theCart) /* Set up globals and make web page */ { char *database = cgiOptionalString("db"); char *rtdbServer = cfgOption("rtdb.server"); char *rtdbPort = cfgOption("rtdb.port"); char *rtdbChoices = cfgOption("rtdb.databases"); struct slName *dbs = slNameListFromComma(rtdbChoices); cart = theCart; cartWebStart(cart, database, "MGC RTDB Update"); if (!rtdbServer) errAbort("rtdb.update not defined in the hg.conf file. " "Chances are this CGI isn't meant for this machine."); if (!rtdbPort) errAbort("rtdb.update not defined in the hg.conf file. " "Chances are this CGI isn't meant for this machine."); /* create HMTL form if button wasn't pressed. Otherwise, run the update */ if (!cgiVarExists("RTDBSubmit")) makeForm(dbs); else if ((database == NULL) || (!slNameInList(dbs, database))) { makeForm(dbs); printf("<br>Error: Select one of databases listed."); } else updateServer(rtdbServer, rtdbPort, database); cartWebEnd(); slNameFreeList(&dbs); }
void testDb(struct htmlPage *orgPage, char *org, char *db) /* Test on one database. */ { struct hash *genomeRa = hgReadRa(org, db, dataDir, "genome.ra", NULL); char *canonicalTable = hashMustFindVal(genomeRa, "canonicalTable"); char *accColumn = hashMustFindVal(genomeRa, "idColumn"); struct slName *geneList = sqlRandomSampleWithSeed(db, canonicalTable, "transcript", clRepeat, seed); struct htmlPage *dbPage; struct slName *ptr; verbose(1, "genelist:\n"); for (ptr = geneList; ptr != NULL; ptr = ptr->next) verbose(1, "%s\n", ptr->name); htmlPageSetVar(orgPage, NULL, "db", db); htmlPageSetVar(orgPage, NULL, searchVarName, ""); dbPage = quickSubmit(orgPage, NULL, org, db, NULL, NULL, "dbEmptyPage", "submit", "go"); quickErrReport(); if (dbPage != NULL) { testDbColumns(dbPage, org, db, geneList); testDbSorts(dbPage, org, db, accColumn, geneList); testDbFilters(dbPage, org, db, accColumn, geneList); } htmlPageFree(&dbPage); hashFree(&genomeRa); slNameFreeList(&geneList); }
static void returnPreview(struct customPp *cpp, struct slName **pList) /* Return list of lines back to cpp for reuse. */ { struct slName *el; slReverse(pList); for (el = *pList; el != NULL; el = el->next) customPpReuse(cpp, el->name); slNameFreeList(pList); }
struct slName *intersectFiles(struct slName *fileList) /* Successively intersect files. */ { struct slName *isectList = slNameLoadReal(fileList->name); struct slName *curFile = fileList->next; struct slName *cur; while (curFile != NULL) { struct hash *isectHash = hashList(isectList); struct slName *someWords = slNameLoadReal(curFile->name); struct slName *bothWords = thoseInHash(isectHash, someWords, FALSE); slNameFreeList(&someWords); slNameFreeList(&isectList); isectList = bothWords; freeHashAndVals(&isectHash); curFile = curFile->next; } return isectList; }
void cgapSageUi(struct trackDb *tdb) /* CGAP SAGE UI options. Highlight certain libs/tissues and filter by score. */ { struct sqlConnection *conn = hAllocConn(database); struct slName *tissueList = getListFromCgapSageLibs(conn, "tissue", FALSE, TRUE); char *tissueHl = cartUsualString(cart, "cgapSage.tissueHl", "All"); puts("<BR><B>Tissue:</B>"); cgapSageDropList(tissueList, NULL, "cgapSage.tissueHl", tissueHl); hFreeConn(&conn); slNameFreeList(&tissueList); }
struct slName *unionFiles(struct slName *fileList) /* Successively union files. */ { struct slName *initialList = slNameLoadReal(fileList->name); struct hash *theHash = hashList(initialList); struct slName *nextFile = fileList->next; struct slName *unionList = NULL; struct slName *cur; while (nextFile != NULL) { struct slName *someWords = slNameLoadReal(nextFile->name); addMoreToHash(theHash, someWords); slNameFreeList(&someWords); nextFile = nextFile->next; } unionList = hashToList(theHash); hashFree(&theHash); slNameFreeList(&initialList); return unionList; }
void parseAli(char *orderFileName, char *fastaFile, alignFunc afunc, columnFunc cfunc, void *closure) /* Parse a file of alignments. */ { struct hash *seqHash = newHash(5); struct slName *list = getOrderList(orderFileName); int numSpecies = fillSeqHash(list, seqHash); struct lineFile *lf = lineFileOpen(fastaFile, TRUE); parseFasta(lf, numSpecies, list, seqHash, afunc, cfunc, closure); slNameFreeList(&list); }
void metaBigSetRgList(struct metaBig* mb, char* commaSep, boolean isBlackList) /* sets the whitelist (or blacklist) */ { struct slName* commas = slNameListFromComma(commaSep); struct slName* rgName; struct hash* rgHash = newHash(10); for (rgName = commas; rgName != NULL; rgName = rgName->next) hashAdd(rgHash, rgName->name, rgName->name); slNameFreeList(&commas); mb->rgList = rgHash; mb->rgListIsBlack = isBlackList; }
void submitToDir(struct sqlConnection *conn, struct sqlConnection *conn2, struct sqlConnection *connSp, char *outDir, char *inJax) /* Create directory full of visiGeneLoad .ra/.tab files from * jackson database connection. Creates a pair of files for * each submission set. Returns outDir. */ { struct dyString *query = dyStringNew(0); struct slName *ref, *refList = sqlQuickList(conn, NOSQLINJ "select distinct(_Refs_key) from GXD_Assay"); int refCount = 0; makeDir(outDir); for (ref = refList; ref != NULL; ref = ref->next) { char path[PATH_LEN]; char *pub=NULL; boolean skip; /* Check that it isn't on our skip list - one that we * have already in the database from a higher resolution * source. */ dyStringClear(query); sqlDyStringPrintf(query, "select title from BIB_Refs where _Refs_key = %s", ref->name); pub = sqlQuickString(conn, query->string); if (!pub) { verbose(1,"ref %s: missing title from BIB_Refs, ref skipped\n",ref->name); continue; } skip = oneSubmissionSet ? oneSubmissionSet != sqlSigned(ref->name) : FALSE; if (!skip) { safef(path, sizeof(path), "%s/%s", outDir, ref->name); submitRefToFiles(conn, conn2, connSp, ref->name, path, inJax); refCount += 1; if (testMax != 0 && refCount >= testMax) errAbort("Reached testMax %d output dirs [%s]\n", testMax, path); } freeMem(pub); } verbose(1,"refCount=%d\n",refCount); slNameFreeList(&refList); dyStringFree(&query); }
/* free species info list */ void freeSpeciesInfo(struct speciesInfo *list) { struct speciesInfo *siNext; for(; list ; list = siNext) { siNext = list->next; freez(&list->nucSequence); freez(&list->aaSequence); slNameFreeList(&list->posStrings); } }
void sets(char *operation, struct slName *fileList) /* sets - Do set operations on one-word-per-line files.. */ { struct slName *finalList = NULL, *cur; if (sameWord(operation, "intersect")) finalList = intersectFiles(fileList); else if (sameWord(operation, "union")) finalList = unionFiles(fileList); else if (sameWord(operation, "subtract") && (slCount(fileList) == 2)) finalList = subtractFiles(fileList); else if (sameWord(operation, "symetricDiff")) { struct slName *theUnion = unionFiles(fileList); struct slName *theIntersect = intersectFiles(fileList); finalList = subtractLists(theUnion, theIntersect); slNameFreeList(&theUnion); slNameFreeList(&theIntersect); } else usage(); /* Output here */ for (cur = finalList; cur != NULL; cur = cur->next) printf("%s\n", cur->name); }
void checkTableForFields(struct sqlConnection *conn, char *tableName) /* Do basic checks on the table to make sure it's kosher. i.e. */ /* chrom, chromStart, name all exist along with the table itself. */ { struct slName *fieldList; if (!sqlTableExists(conn, tableName)) errAbort("table %s not found.", tableName); fieldList = sqlListFields(conn, tableName); if (!slNameInList(fieldList, "chrom")) errAbort("table %s doesn't have a chrom field. It must have chrom, chromStart, and name at the minimum.", tableName); if (!slNameInList(fieldList, "chromStart")) errAbort("table %s doesn't have a chrom field. It must have chrom, chromStart, and name at the minimum.", tableName); if (!slNameInList(fieldList, "name")) errAbort("table %s doesn't have a chrom field. It must have chrom, chromStart, and name at the minimum.", tableName); slNameFreeList(&fieldList); }
int main(int argc, char *argv[]) /* Process command line. */ { struct slName *fileList = NULL; int i; optionInit(&argc, argv, options); if (argc < 4) usage(); /* make a list out of the filenames. */ for (i = 2; i < argc; i++) slNameAddHead(&fileList, argv[i]); slReverse(&fileList); sets(argv[1], fileList); slNameFreeList(&fileList); return 0; }
void annoOptionFreeList(struct annoOption **pList) /* Free the same things that we clone above. */ { if (pList == NULL) return; struct annoOption *afo, *nextAfo; for (afo = *pList; afo != NULL; afo = nextAfo) { nextAfo = afo->next; freeMem(afo->spec.name); unsigned opFlags = opFlags; if (opFlags & OPTION_MULTI) { switch (opFlags & OPTION_TYPE_MASK) { case OPTION_STRING: slNameFreeList(&(afo->value)); break; default: errAbort("annoOptionFreeList: OPTION_MULTI implemented only for " "OPTION_STRING (not 0x%x)", opFlags); } } else { switch (opFlags & OPTION_TYPE_MASK) { // No need to free overloaded numeric values case OPTION_DOUBLE: case OPTION_FLOAT: case OPTION_LONG_LONG: case OPTION_INT: case OPTION_BOOLEAN: break; case OPTION_STRING: freeMem(afo->value); break; default: errAbort("annoOptionFreeList: unrecognized op type 0x%x", opFlags); } } freeMem(afo); } *pList = NULL; }
struct grp *groupsFilterForTdbList(struct grp **grps,struct trackDb *tdbList) { struct grp *grpList = *grps; *grps = NULL; struct slName *tdbGroups = tdbListGetGroups(tdbList); if (tdbList == NULL) return *grps; while (grpList != NULL) { struct grp *grp = slPopHead(&grpList); if (slNameInList(tdbGroups,grp->name)) slAddHead(grps,grp); } slNameFreeList(&tdbGroups); slReverse(grps); return *grps; }
void findCutters(char *gcgFile, char *genome, char *outputFile) /* findCutters - Find REBASE restriction enzymes using their GCG file. */ { struct cutter *cutters = readGcg(gcgFile); struct dnaSeq *seqs = dnaLoadAll(genome); struct slName *whiteList = NULL; if (justThis) whiteList = newSlName(justThis); if (justThese) { struct slName *listFromJustThese = getWhiteListFromFile(); whiteList = slCat(whiteList, listFromJustThese); } if (justThese || justThis) cullCutters(&cutters, TRUE, whiteList, 0); if (countsOnly) findCounts(cutters, seqs, outputFile); else findBeds(cutters, seqs, outputFile); cutterFreeList(&cutters); freeDnaSeqList(&seqs); slNameFreeList(&whiteList); }
struct slName *randomVcfIds(char *table, struct sqlConnection *conn, int count, boolean isTabix) /* Return some semi-random IDs from a VCF file. */ { /* Read 10000 items from vcf file, or if they ask for a big list, then 4x what they ask for. */ struct trackDb *tdb = hashFindVal(fullTableToTdbHash, table); char *fileName = vcfFileName(tdb, conn, table, hDefaultChrom(database)); struct lineFile *lf = isTabix ? lineFileTabixMayOpen(fileName, TRUE) : lineFileMayOpen(fileName, TRUE); if (lf == NULL) noWarnAbort(); int orderedCount = count * 4; if (orderedCount < 100) orderedCount = 100; struct slName *idList = NULL; char *words[4]; int i; for (i = 0; i < orderedCount && lineFileChop(lf, words); i++) { // compress runs of identical ID, in case most are placeholder if (i == 0 || !sameString(words[2], idList->name)) slAddHead(&idList, slNameNew(words[2])); } lineFileClose(&lf); /* Shuffle list and trim it to count if necessary. */ shuffleList(&idList); struct slName *sl; for (sl = idList, i = 0; sl != NULL; sl = sl->next, i++) { if (i+1 >= count) { slNameFreeList(&(sl->next)); break; } } freez(&fileName); return idList; }
struct slPair *mdbSelectPairs(struct cart *cart, struct slPair *mdbVars) // Returns the current mdb vars and vals in the table of drop down selects { // figure out how many metadata selects are visible. int numMetadataSelects = 0; struct slPair *mdbSelectPairs = NULL; if (mdbVars == NULL) return 0; // Get the current number of rows in the table of mdb selects for (;;) { char buf[256]; safef(buf, sizeof(buf), "%s%d", METADATA_NAME_PREFIX, numMetadataSelects + 1); char *str = cartOptionalString(cart, buf); if (isEmpty(str)) break; else numMetadataSelects++; } // Requesting to add or delete any? int delSearchSelect = cartUsualInt(cart, TRACK_SEARCH_DEL_ROW, 0); // 1-based row to delete int addSearchSelect = cartUsualInt(cart, TRACK_SEARCH_ADD_ROW, 0); // 1-based row to insert after if (delSearchSelect) numMetadataSelects--; if (addSearchSelect) numMetadataSelects++; if (numMetadataSelects) { int ix; char buf[256]; for (ix = 0; ix < numMetadataSelects; ix++) { int offset; // used to handle additions/deletions if (addSearchSelect > 0 && ix >= addSearchSelect) offset = 0; // do nothing to offset (i.e. copy data from previous row) else if (delSearchSelect > 0 && ix + 1 >= delSearchSelect) offset = 2; else offset = 1; safef(buf, sizeof(buf), "%s%d", METADATA_NAME_PREFIX, ix + offset); char *var = cartOptionalString(cart, buf); char *val = NULL; // We need to make sure var is valid in this assembly; if it isn't, reset it to "cell". if (slPairFindVal(mdbVars,var) == NULL) var = "cell"; else { safef(buf, sizeof(buf), "%s%d", METADATA_VALUE_PREFIX, ix + offset); enum cvSearchable searchBy = cvSearchMethod(var); if (searchBy == cvSearchByMultiSelect) { // Multi-selects as comma delimited list of values struct slName *vals = cartOptionalSlNameList(cart,buf); if (vals) { val = slNameListToString(vals,','); // A comma delimited list of values slNameFreeList(&vals); } } else if (searchBy == cvSearchBySingleSelect || searchBy == cvSearchByFreeText || searchBy == cvSearchByWildList) val = cloneString(cartUsualString(cart, buf,ANYLABEL)); //else if (searchBy == cvSearchByDateRange || searchBy == cvSearchByIntegerRange) // { // // TO BE IMPLEMENTED // } if (val != NULL && sameString(val, ANYLABEL)) val = NULL; } slPairAdd(&mdbSelectPairs,var,val); // val already cloned } if (delSearchSelect > 0) { safef(buf, sizeof(buf), "%s%d", METADATA_NAME_PREFIX, numMetadataSelects + 1); cartRemove(cart, buf); safef(buf, sizeof(buf), "%s%d", METADATA_VALUE_PREFIX, numMetadataSelects + 1); cartRemove(cart, buf); } } else { // create defaults slPairAdd(&mdbSelectPairs,"cell", NULL); slPairAdd(&mdbSelectPairs,"antibody",NULL); } slReverse(&mdbSelectPairs); return mdbSelectPairs; }
void verifyGreatAssemblies() { // First read in the assembly name and description information into name lists struct slName* supportedAssemblies = NULL; struct lineFile *lf = lineFileOpen(greatData, TRUE); int fieldCount = 1; char* row[fieldCount]; int wordCount; while ((wordCount = lineFileChopTab(lf, row)) != 0) { if (wordCount != fieldCount) errAbort("The %s file is not properly formatted.\n", greatData); slNameAddHead(&supportedAssemblies, row[0]); } lineFileClose(&lf); boolean invalidAssembly = TRUE; struct slName* currAssembly; for (currAssembly = supportedAssemblies; currAssembly != NULL; currAssembly = currAssembly->next) { if (!hDbIsActive(currAssembly->name)) { errAbort("Assembly %s in supported assembly file is not an active assembly.\n", currAssembly->name); } if (sameOk(database, currAssembly->name)) { invalidAssembly = FALSE; break; } } if (invalidAssembly) { slReverse(&supportedAssemblies); currAssembly = supportedAssemblies; struct dyString* dy = dyStringNew(0); addAssemblyToSupportedList(dy, currAssembly->name); currAssembly = currAssembly->next; while (currAssembly != NULL) { dyStringAppend(dy, ", "); if (currAssembly->next == NULL) dyStringAppend(dy, "and "); addAssemblyToSupportedList(dy, currAssembly->name); currAssembly = currAssembly->next; } hPrintf("<script type='text/javascript'>\n"); hPrintf("function logSpecies() {\n"); hPrintf("try {\n"); hPrintf("var r = new XMLHttpRequest();\n"); hPrintf("r.open('GET', 'http://great.stanford.edu/public/cgi-bin/logSpecies.php?species=%s');\n", database); hPrintf("r.send(null);\n"); hPrintf("} catch (err) { }\n"); hPrintf("}\n"); hPrintf("window.onload = logSpecies;\n"); hPrintf("</script>\n"); errAbort("GREAT only supports the %s assemblies." "\nPlease go back and ensure that one of those assemblies is chosen.", dyStringContents(dy)); htmlClose(); dyStringFree(&dy); } slNameFreeList(&supportedAssemblies); }
void submitRefToFiles(struct sqlConnection *conn, struct sqlConnection *conn2, struct sqlConnection *connSp, char *ref, char *fileRoot, char *inJax) /* Create a .ra and a .tab file for given reference. */ { /* Initially the tab file will have some duplicate lines, so * write to temp file, and then filter. */ char raName[PATH_LEN], tabName[PATH_LEN], capName[PATH_LEN]; FILE *ra = NULL, *tab = NULL, *cap = NULL; struct dyString *query = dyStringNew(0); struct sqlResult *sr; char **row; char *pubMed; struct slName *list, *el; boolean gotAny = FALSE; struct hash *uniqImageHash = newHash(0); struct hash *captionHash = newHash(0); int imageWidth = 0, imageHeight = 0; char path[PATH_LEN]; struct dyString *caption = dyStringNew(0); struct dyString *copyright = dyStringNew(0); struct dyString *probeNotes = dyStringNew(0); boolean lookedForCopyright = FALSE; safef(raName, sizeof(raName), "%s.ra", fileRoot); safef(tabName, sizeof(tabName), "%s.tab", fileRoot); safef(capName, sizeof(capName), "%s.txt", fileRoot); tab = mustOpen(tabName, "w"); cap = mustOpen(capName, "w"); sqlDyStringPrintf(query, "select authors,journal,title,year from BIB_Refs where "); sqlDyStringPrintf(query, "_Refs_key = '%s'", ref); sr = sqlGetResultVerbose(conn, query->string); row = sqlNextRow(sr); if (row == NULL) errAbort("Can't find _Refs_key %s in BIB_Refs", ref); /* Make ra file with stuff common to whole submission set. */ ra = mustOpen(raName, "w"); fprintf(ra, "submissionSource MGI\n"); fprintf(ra, "acknowledgement Thanks to the Gene Expression Database group at " "Mouse Genome Informatics (MGI) for collecting, annotating and sharing " "this image. The MGI images were last updated in VisiGene on March 28, 2006. " "Additional and more up to date annotations and images may be available " "directly at <A HREF='http://www.informatics.jax.org' target='_blank'>MGI.</A>\n"); fprintf(ra, "submitSet jax%s\n", ref); fprintf(ra, "taxon 10090\n"); /* Mus musculus taxon */ fprintf(ra, "fullDir http://hgwdev.gi.ucsc.edu/visiGene/full/inSitu/Mouse/jax\n"); fprintf(ra, "thumbDir http://hgwdev.gi.ucsc.edu/visiGene/200/inSitu/Mouse/jax\n"); fprintf(ra, "setUrl http://www.informatics.jax.org/\n"); fprintf(ra, "itemUrl http://www.informatics.jax.org/searches/image.cgi?%%s\n"); fprintf(ra, "abUrl http://www.informatics.jax.org/searches/antibody.cgi?%%s\n"); fprintf(ra, "journal %s\n", row[1]); fprintf(ra, "publication %s\n", row[2]); fprintf(ra, "year %s\n", row[3]); /* The contributor (author) list is in format Kent WJ; Haussler DH; format in * Jackson. We convert it to Kent W.J.,Haussler D.H., format for visiGene. */ fprintf(ra, "contributor "); list = charSepToSlNames(row[0], ';'); for (el = list; el != NULL; el = el->next) { char *lastName = skipLeadingSpaces(el->name); char *initials = strrchr(lastName, ' '); if (initials == NULL) initials = ""; else *initials++ = 0; fprintf(ra, "%s", lastName); if (initials[0] != 0) { char c; fprintf(ra, " "); while ((c = *initials++) != 0) fprintf(ra, "%c.", c); } fprintf(ra, ","); } fprintf(ra, "\n"); slNameFreeList(&list); sqlFreeResult(&sr); /* Add in link to PubMed record on publication. */ dyStringClear(query); sqlDyStringPrintf(query, "select ACC_Accession.accID from ACC_Accession,ACC_LogicalDB " "where ACC_Accession._Object_key = %s " "and ACC_Accession._LogicalDB_key = ACC_LogicalDB._LogicalDB_key " "and ACC_LogicalDB.name = 'PubMed'", ref); pubMed = sqlQuickStringVerbose(conn, query->string); if (pubMed != NULL) fprintf(ra, "pubUrl https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=%s\n", pubMed); freez(&pubMed); dyStringClear(query); sqlDyStringPrintf(query, "select distinct MRK_Marker.symbol as gene," "GXD_Specimen.sex as sex," "GXD_Specimen.age as age," "GXD_Specimen.ageMin as ageMin," "GXD_Specimen.ageMax as ageMax," "IMG_ImagePane.paneLabel as paneLabel," "ACC_Accession.numericPart as fileKey," "IMG_Image._Image_key as imageKey," "GXD_Assay._ProbePrep_key as probePrepKey," "GXD_Assay._AntibodyPrep_key as antibodyPrepKey," "GXD_Assay._ReporterGene_key as reporterGeneKey," "GXD_FixationMethod.fixation as fixation," "GXD_EmbeddingMethod.embeddingMethod as embedding," "GXD_Assay._Assay_key as assayKey," "GXD_Specimen.hybridization as sliceType," "GXD_Specimen._Genotype_key as genotypeKey," "IMG_ImagePane._ImagePane_key as imagePaneKey\n" "from MRK_Marker," "GXD_Assay," "GXD_Specimen," "GXD_InSituResult," "GXD_InSituResultImage," "GXD_FixationMethod," "GXD_EmbeddingMethod," "IMG_ImagePane," "IMG_Image," "ACC_Accession\n" "where MRK_Marker._Marker_key = GXD_Assay._Marker_key " "and GXD_Assay._Assay_key = GXD_Specimen._Assay_key " "and GXD_Specimen._Specimen_key = GXD_InSituResult._Specimen_key " "and GXD_InSituResult._Result_key = GXD_InSituResultImage._Result_key " "and GXD_InSituResultImage._ImagePane_key = IMG_ImagePane._ImagePane_key " "and GXD_FixationMethod._Fixation_key = GXD_Specimen._Fixation_key " "and GXD_EmbeddingMethod._Embedding_key = GXD_Specimen._Embedding_key " "and IMG_ImagePane._Image_key = IMG_Image._Image_key " "and IMG_Image._Image_key = ACC_Accession._Object_key " "and ACC_Accession.prefixPart = 'PIX:' " "and GXD_Assay._ImagePane_key is NULL " ); sqlDyStringPrintf(query, "and GXD_Assay._Refs_key = '%s'", ref); sr = sqlGetResultVerbose(conn, query->string); fprintf(tab, "#"); fprintf(tab, "gene\t"); fprintf(tab, "probeColor\t"); fprintf(tab, "sex\t"); fprintf(tab, "age\t"); fprintf(tab, "ageMin\t"); fprintf(tab, "ageMax\t"); fprintf(tab, "paneLabel\t"); fprintf(tab, "fileName\t"); fprintf(tab, "submitId\t"); fprintf(tab, "fPrimer\t"); fprintf(tab, "rPrimer\t"); fprintf(tab, "abName\t"); fprintf(tab, "abTaxon\t"); fprintf(tab, "abSubmitId\t"); fprintf(tab, "fixation\t"); fprintf(tab, "embedding\t"); fprintf(tab, "bodyPart\t"); fprintf(tab, "sliceType\t"); fprintf(tab, "genotype\t"); fprintf(tab, "strain\t"); fprintf(tab, "priority\t"); fprintf(tab, "captionId\t"); fprintf(tab, "imageWidth\t"); fprintf(tab, "imageHeight\n"); while ((row = sqlNextRow(sr)) != NULL) { char *gene = row[0]; char *sex = row[1]; char *age = row[2]; char *ageMin = row[3]; char *ageMax = row[4]; char *paneLabel = row[5]; char *fileKey = row[6]; char *imageKey = row[7]; char *probePrepKey = row[8]; char *antibodyPrepKey = row[9]; char *reporterGeneKey = row[10]; char *fixation = row[11]; char *embedding = row[12]; char *assayKey = row[13]; char *sliceType = row[14]; char *genotypeKey = row[15]; char *imagePaneKey = row[16]; double calcAge = -1; char *probeColor = ""; char *bodyPart = ""; char *abName = NULL; char *rPrimer = NULL, *fPrimer = NULL; char *genotype = NULL; char *strain = NULL; char *priority = NULL; char abTaxon[32]; char *captionId = ""; char *abSubmitId = NULL; verbose(3, " "); dumpRow(row, 16); if (age == NULL) continue; if (!lookedForCopyright) { struct sqlResult *sr = NULL; char **row; lookedForCopyright = TRUE; dyStringClear(query); sqlDyStringPrintf(query, "select note from MGI_NoteChunk,MGI_Note,MGI_NoteType,ACC_MGIType " "where MGI_Note._Object_key = %s " "and ACC_MGIType.name = 'Image' " "and ACC_MGIType._MGIType_key = MGI_Note._MGIType_key " "and MGI_NoteType.noteType='Copyright' " "and MGI_Note._NoteType_key = MGI_NoteType._NoteType_key " "and MGI_Note._Note_key = MGI_NoteChunk._Note_key " "order by sequenceNum" , imageKey); sr = sqlGetResultVerbose(conn2, query->string); while ((row = sqlNextRow(sr)) != NULL) dyStringAppend(copyright, row[0]); sqlFreeResult(&sr); verbose(2,"imageKey=%s\n",imageKey); if (copyright->stringSize != 0) { fprintf(ra, "copyright %s\n", copyright->string); } } /* Massage sex */ { if (sameString(sex, "Male")) sex = "male"; else if (sameString(sex, "Female")) sex = "female"; else sex = ""; } /* Massage age */ { char *embryoPat = "embryonic day "; char *newbornPat = "postnatal newborn"; char *dayPat = "postnatal day "; char *weekPat = "postnatal week "; char *adultPat = "postnatal adult"; double calcMinAge = atof(ageMin); double calcMaxAge = atof(ageMax); double mouseBirthAge = 21.0; //double mouseAdultAge = 63.0; /* Relative to conception, not birth */ if (age[0] == 0) { warn("age null, ageMin %s, ageMax %s\n", ageMin, ageMax); calcAge = (calcMinAge + calcMaxAge) * 0.5; } else if (startsWith(embryoPat, age)) calcAge = atof(age+strlen(embryoPat)); else if (sameString(newbornPat, age)) calcAge = mouseBirthAge; else if (startsWith(dayPat, age)) calcAge = atof(age+strlen(dayPat)) + mouseBirthAge; else if (startsWith(weekPat, age)) calcAge = 7.0 * atof(age+strlen(weekPat)) + mouseBirthAge; else if (sameString(adultPat, age) && calcMaxAge - calcMinAge > 1000 && calcMinAge < 365) calcAge = 365; /* Most adult mice are relatively young */ else { warn("Calculating age from %s", age); calcAge = (calcMinAge + calcMaxAge) * 0.5; } if (calcAge < calcMinAge) calcAge = calcMinAge; if (calcAge > calcMaxAge) calcAge = calcMaxAge; } /* Massage probeColor */ { if (!isStrNull(reporterGeneKey)) { /* Fixme: make sure that reporterGene's end up in probeType table. */ char *name = NULL; dyStringClear(query); sqlDyStringPrintf(query, "select term from VOC_Term where _Term_key = %s", reporterGeneKey); name = sqlQuickStringVerbose(conn2, query->string); if (name == NULL) warn("Can't find _ReporterGene_key %s in VOC_Term", reporterGeneKey); else if (sameString(name, "GFP")) probeColor = "green"; else if (sameString(name, "lacZ")) probeColor = "blue"; else warn("Don't know color of reporter gene %s", name); freez(&name); } if (!isStrNull(probePrepKey)) { char *name = NULL; dyStringClear(query); sqlDyStringPrintf(query, "select GXD_VisualizationMethod.visualization " "from GXD_VisualizationMethod,GXD_ProbePrep " "where GXD_ProbePrep._ProbePrep_key = %s " "and GXD_ProbePrep._Visualization_key = GXD_VisualizationMethod._Visualization_key" , probePrepKey); name = sqlQuickStringVerbose(conn2, query->string); if (name == NULL) warn("Can't find visualization from _ProbePrep_key %s", probePrepKey); probeColor = colorFromLabel(name, gene); freez(&name); if (probeColor[0] == 0) { dyStringClear(query); sqlDyStringPrintf(query, "select GXD_Label.label from GXD_Label,GXD_ProbePrep " "where GXD_ProbePrep._ProbePrep_key = %s " "and GXD_ProbePrep._Label_key = GXD_Label._Label_key" , probePrepKey); name = sqlQuickStringVerbose(conn2, query->string); if (name == NULL) warn("Can't find label from _ProbePrep_key %s", probePrepKey); probeColor = colorFromLabel(name, gene); } freez(&name); } if (!isStrNull(antibodyPrepKey) && probeColor[0] == 0 ) { char *name = NULL; dyStringClear(query); sqlDyStringPrintf(query, "select GXD_Label.label from GXD_Label,GXD_AntibodyPrep " "where GXD_AntibodyPrep._AntibodyPrep_key = %s " "and GXD_AntibodyPrep._Label_key = GXD_Label._Label_key" , antibodyPrepKey); name = sqlQuickStringVerbose(conn2, query->string); if (name == NULL) warn("Can't find label from _AntibodyPrep_key %s", antibodyPrepKey); probeColor = colorFromLabel(name, gene); freez(&name); } } /* Get abName, abTaxon, abSubmitId */ abTaxon[0] = 0; if (!isStrNull(antibodyPrepKey)) { struct sqlResult *sr = NULL; int orgKey = 0; char **row; dyStringClear(query); sqlDyStringPrintf(query, "select antibodyName,_Organism_key,GXD_Antibody._Antibody_key " "from GXD_AntibodyPrep,GXD_Antibody " "where GXD_AntibodyPrep._AntibodyPrep_key = %s " "and GXD_AntibodyPrep._Antibody_key = GXD_Antibody._Antibody_key" , antibodyPrepKey); sr = sqlGetResultVerbose(conn2, query->string); row = sqlNextRow(sr); if (row != NULL) { abName = cloneString(row[0]); orgKey = atoi(row[1]); abSubmitId = cloneString(row[2]); } sqlFreeResult(&sr); if (orgKey > 0) { char *latinName = NULL, *commonName = NULL; int spTaxon = 0; dyStringClear(query); sqlDyStringPrintf(query, "select latinName from MGI_Organism " "where _Organism_key = %d", orgKey); latinName = sqlQuickStringVerbose(conn2, query->string); if (latinName != NULL && !sameString(latinName, "Not Specified") && !sameString(latinName, "Not Applicable")) { char *e = strchr(latinName, '/'); if (e != NULL) *e = 0; /* Chop off / and after. */ spTaxon = spBinomialToTaxon(connSp, latinName); } else { dyStringClear(query); sqlDyStringPrintf(query, "select commonName from MGI_Organism " "where _Organism_key = %d", orgKey); commonName = sqlQuickStringVerbose(conn2, query->string); if (commonName != NULL && !sameString(commonName, "Not Applicable") && !sameString(commonName, "Not Specified")) { spTaxon = spCommonToTaxon(connSp, commonName); } } if (spTaxon != 0) safef(abTaxon, sizeof(abTaxon), "%d", spTaxon); freez(&latinName); freez(&commonName); } } if (abName == NULL) abName = cloneString(""); if (abSubmitId == NULL) abSubmitId = cloneString(""); /* Get rPrimer, lPrimer */ if (!isStrNull(probePrepKey)) { struct sqlResult *sr = NULL; char **row; dyStringClear(query); sqlDyStringPrintf(query, "select primer1sequence,primer2sequence " "from PRB_Probe,GXD_ProbePrep " "where PRB_Probe._Probe_key = GXD_ProbePrep._Probe_key " "and GXD_ProbePrep._ProbePrep_key = %s" , probePrepKey); sr = sqlGetResultVerbose(conn2, query->string); row = sqlNextRow(sr); if (row != NULL) { fPrimer = cloneString(row[0]); rPrimer = cloneString(row[1]); } sqlFreeResult(&sr); } /* Note Jackson database actually stores the primers very * erratically. In all the cases I can find for in situs * the primers are actually stored in free text in the PRB_Notes * e.g. ... primers CGCGGATCCAGGGGAAACAGAAGGGCTGCG and CCCAAGCTTAGACTGTACAGGCTGAGCC ... */ if (fPrimer == NULL || fPrimer[0]==0) { struct sqlResult *sr = NULL; char **row; dyStringClear(query); sqlDyStringPrintf(query, "select PRB_Notes.note from GXD_ProbePrep, PRB_Notes" " where GXD_ProbePrep._ProbePrep_key = %s" " and GXD_ProbePrep._Probe_key = PRB_Notes._Probe_key" " order by PRB_Notes.sequenceNum" , probePrepKey); sr = sqlGetResultVerbose(conn2, query->string); dyStringClear(probeNotes); while ((row = sqlNextRow(sr)) != NULL) dyStringAppend(probeNotes, row[0]); sqlFreeResult(&sr); if (probeNotes->stringSize > 0) { char f[256]; char r[256]; int i = 0; char *s = strstr(probeNotes->string," primers "); if (s) { s += strlen(" primers "); i = 0; while (strchr("ACGT",*s) && (i<sizeof(f))) f[i++] = *s++; f[i]=0; if (strstr(s," and ")==s) { s += strlen(" and "); i = 0; while (strchr("ACGT",*s) && (i<sizeof(r))) r[i++] = *s++; r[i]=0; if (strlen(f) >= 10 && strlen(r) >= 10) { fPrimer = cloneString(f); rPrimer = cloneString(r); } else { verbose(1, "bad primer parse:_ProbePrep_key=%s fPrimer=[%s], rPrimer=[%s]\n", probePrepKey,f,r); } } } } } if (fPrimer == NULL) fPrimer = cloneString(""); if (rPrimer == NULL) rPrimer = cloneString(""); fixation = blankOutUnknown(fixation); embedding = blankOutUnknown(embedding); /* Massage body part and slice type. We only handle whole mounts. */ if (sameString(sliceType, "whole mount")) { bodyPart = "whole"; priority = "100"; } else { sliceType = ""; priority = "1000"; } genotypeAndStrainFromKey(genotypeKey, conn2, &genotype, &strain); if (isStrNull(paneLabel)) paneLabel = cloneString(""); /* trying to suppress nulls in output */ stripChar(paneLabel, '"'); /* Get rid of a difficult quote to process. */ /* Fetch image dimensions from file. */ imageWidth=0; imageHeight=0; safef(path, sizeof(path), "%s/%s.jpg", inJax, fileKey); if (fileExists(path)) jpegSize(path,&imageWidth,&imageHeight); /* will errAbort if no valid .jpeg exists */ else warn("Picture Missing! %s ",path); /* Deal caption if any. Most of the work only happens the * first time see the image. */ if (!hashLookup(uniqImageHash, imageKey)) { struct sqlResult *sr = NULL; char **row; hashAdd(uniqImageHash, imageKey, NULL); dyStringClear(caption); dyStringClear(query); sqlDyStringPrintf(query, "select note from MGI_NoteChunk,MGI_Note,MGI_NoteType,ACC_MGIType " "where MGI_Note._Object_key = %s " "and ACC_MGIType.name = 'Image' " "and ACC_MGIType._MGIType_key = MGI_Note._MGIType_key " "and MGI_NoteType.noteType='Caption' " "and MGI_Note._NoteType_key = MGI_NoteType._NoteType_key " "and MGI_Note._Note_key = MGI_NoteChunk._Note_key " "order by sequenceNum" , imageKey); sr = sqlGetResultVerbose(conn2, query->string); while ((row = sqlNextRow(sr)) != NULL) dyStringAppend(caption, row[0]); sqlFreeResult(&sr); if (caption->stringSize > 0) { subChar(caption->string, '\t', ' '); subChar(caption->string, '\n', ' '); fprintf(cap, "%s\t%s\n", imageKey, caption->string); hashAdd(captionHash, imageKey, imageKey); } } if (hashLookup(captionHash, imageKey)) captionId = imageKey; else captionId = ""; fprintf(tab, "%s\t", gene); fprintf(tab, "%s\t", probeColor); fprintf(tab, "%s\t", sex); fprintf(tab, "%3.2f\t", calcAge); fprintf(tab, "%s\t", ageMin); fprintf(tab, "%s\t", ageMax); fprintf(tab, "%s\t", paneLabel); /* may have to change NULL to empty string or "0" ? */ fprintf(tab, "%s.jpg\t", fileKey); fprintf(tab, "%s\t", imageKey); fprintf(tab, "%s\t", fPrimer); fprintf(tab, "%s\t", rPrimer); fprintf(tab, "%s\t", abName); fprintf(tab, "%s\t", abTaxon); fprintf(tab, "%s\t", abSubmitId); fprintf(tab, "%s\t", fixation); fprintf(tab, "%s\t", embedding); fprintf(tab, "%s\t", bodyPart); fprintf(tab, "%s\t", sliceType); fprintf(tab, "%s\t", genotype); fprintf(tab, "%s\t", strain); fprintf(tab, "%s\t", priority); fprintf(tab, "%s\t", captionId); fprintf(tab, "%d\t", imageWidth); fprintf(tab, "%d\n", imageHeight); printExpression(tab, conn2, imagePaneKey, assayKey); gotAny = TRUE; freez(&genotype); freez(&abName); freez(&abSubmitId); freez(&rPrimer); freez(&fPrimer); } sqlFreeResult(&sr); carefulClose(&ra); carefulClose(&tab); carefulClose(&cap); if (!gotAny) { remove(raName); remove(capName); remove(tabName); } dyStringFree(&probeNotes); dyStringFree(©right); dyStringFree(&caption); dyStringFree(&query); hashFree(&uniqImageHash); hashFree(&captionHash); }
int palOutPredList(struct sqlConnection *conn, struct cart *cart, struct genePred *list) /* output a list of genePreds in pal format */ { if (list == NULL) return 0; char *mafTable = cartString(cart, hgtaCGIGeneMafTable); char *database = sqlGetDatabase(conn); struct trackDb *maftdb = hTrackDbForTrack(database, mafTable); struct wigMafSpecies *wmSpecies; int groupCnt; /* get maf parent (if any) */ maftdb->parent = hCompositeTrackDbForSubtrack(database,maftdb); /* this queries the state of the getSpecies dialog */ wigMafGetSpecies(cart, maftdb, maftdb->track, database, &wmSpecies, &groupCnt); /* since the species selection dialog doesn't list * the reference species, we just automatically include * it */ struct slName *includeList = slNameNew(database); /* now make a list of all species that are on */ for(; wmSpecies; wmSpecies = wmSpecies->next) { if (wmSpecies->on) { struct slName *newName = slNameNew(wmSpecies->name); slAddHead(&includeList, newName); } } slReverse(&includeList); boolean inExons = cartUsualBoolean(cart, hgtaCGIGeneExons , FALSE); boolean noTrans = cartUsualBoolean(cart, hgtaCGIGeneNoTrans, FALSE); boolean outBlank = cartUsualBoolean(cart, hgtaCGIGeneOutBlank, FALSE); boolean outTable = cartUsualBoolean(cart, hgtaCGIOutTable, FALSE); boolean truncHeader = cartUsualBoolean(cart, hgtaCGITruncHeader, FALSE); int numCols = cartUsualInt(cart, hgtaCGINumColumns, 20); unsigned options = 0; if (inExons) options |= MAFGENE_EXONS; if (noTrans) options |= MAFGENE_NOTRANS; if (outBlank) options |= MAFGENE_OUTBLANK; if (outTable) options |= MAFGENE_OUTTABLE; if (!truncHeader) numCols = -1; /* send out the alignments */ int outCount = 0; for( ; list ; list = list->next) { if (list->cdsStart != list->cdsEnd) { outCount++; mafGeneOutPred(stdout, list, database, mafTable, includeList, options, numCols); } } slNameFreeList(&includeList); return outCount; }
void bedListExpRecordAverage(struct bed **pBedList, struct expRecord **pERList, int extrasIndex) /* This is a mildy complicated function to make the details page have the */ /* same data as the track when the UI option "Tissue averages" is selected. */ /* This is done by hacking the bed and expRecord lists in place and keeping */ /* the original code for the most part. */ { struct bed *bed = NULL; struct expRecord *er, *newERList = NULL; struct slName *extras = NULL, *oneSlName; int M, N, i, columns; int *mapping; if (!pBedList || !pERList || !*pBedList || !*pERList) return; er = *pERList; if ((extrasIndex < 0) || (extrasIndex >= er->numExtras)) return; /* Build up a unique list of words from the specific "extras" column. */ for (er = *pERList; er != NULL; er = er->next) slNameStore(&extras, er->extras[extrasIndex]); slReverse(&extras); M = slCount(extras); N = slCount(*pERList); columns = N + 1; /* M rows, reserve first column for counts. */ mapping = needMem(sizeof(int) * M * columns); /* Create the mapping array: */ /* each row corresponds to one of the groupings. The first column is the number of */ /* things in the original list in the group (k things), and the next k elements on */ /* that row are indeces. */ for (er = *pERList, i = 0; er != NULL && i < N; er = er->next, i++) { int ix = slNameFindIx(extras, er->extras[extrasIndex]) * columns; mapping[ix + ++mapping[ix]] = er->id; } /* Make a new expRecord list. */ for (oneSlName = extras, i = 0; oneSlName != NULL && i < M; oneSlName = oneSlName->next, i++) { struct expRecord *newER = basicExpRecord(oneSlName->name, i, extrasIndex); slAddHead(&newERList, newER); } slReverse(&newERList); expRecordFreeList(pERList); *pERList = newERList; /* Go through each bed and change it. */ for (bed = *pBedList; bed != NULL; bed = bed->next) { float *newExpScores = needMem(sizeof(float) * M); int *newExpIds = needMem(sizeof(int) * M); /* Calculate averages. */ for (i = 0; i < M; i++) { int ix = i * columns; int size = mapping[ix]; int j; double sum = 0; for (j = 1; j < size + 1; j++) sum += (double)bed->expScores[mapping[ix + j]]; newExpScores[i] = (float)(sum/size); newExpIds[i] = i; } bed->expCount = M; freeMem(bed->expIds); bed->expIds = newExpIds; freeMem(bed->expScores); bed->expScores = newExpScores; } /* Free stuff. */ slNameFreeList(&extras); freez(&mapping); }