// Edges restricted to this colour, only in one direction (node.orient)
Edges db_node_edges_in_col(dBNode node, size_t col, const dBGraph *db_graph)
{
if(db_graph->num_edge_cols > 1)
{
Edges edges = db_node_get_edges(db_graph, node.key, col);
return edges_mask_orientation(edges, node.orient);
}
// Edges are merged into one colour
ctx_assert(db_graph->num_edge_cols == 1);
ctx_assert(db_graph->node_in_cols != NULL || db_graph->col_covgs != NULL);
// Check which next nodes are in the given colour
dBNode nodes[4];
Nucleotide nucs[4];
Edges edges = 0;
size_t i, n;
n = db_graph_next_nodes_in_col(db_graph, node, col, nodes, nucs);
for(i = 0; i < n; i++)
edges = edges_set_edge(edges, nucs[i], node.orient);
return edges;
}
/*
* Get position after current segment. A segement is a stretch of kmers aligned
* to the graph with no gaps.
* @param aln alignment of read to the graph
* @param start offset in the alignment that starts this segments
* @param missing_edge set to 1 if the segment was ended due to a missing edge
* @return index of node after next gap or aln->nodes.len if no more gaps
*/
size_t db_alignment_next_gap(const dBAlignment *aln, size_t start,
bool *missing_edge, const dBGraph *db_graph)
{
size_t i, end = aln->rpos.len;
const int32_t *rpos = aln->rpos.b;
const dBNode *nodes = aln->nodes.b;
int colour = aln->colour;
Edges edges;
Nucleotide nuc;
*missing_edge = false;
if(end == 0) return 0;
// Set upper bound on position of the next gap as within this read
if(aln->used_r1 && aln->used_r2 && start < aln->r2strtidx)
end = aln->r2strtidx;
for(i = start+1; i < end && rpos[i-1]+1 == rpos[i]; i++)
{
// Check for a missing edge
edges = colour < 0 ? db_node_get_edges_union(db_graph, nodes[i-1].key)
: db_node_get_edges(db_graph, nodes[i-1].key, colour);
nuc = db_node_get_last_nuc(nodes[i], db_graph);
if(!edges_has_edge(edges, nuc, nodes[i-1].orient)) {
*missing_edge = true;
break;
}
}
// Return position after gap
return i;
}
void breakpoint_caller_node(hkey_t hkey, BreakpointCaller *caller)
{
Edges edges;
graph_crawler_reset(&caller->crawlers[0]);
graph_crawler_reset(&caller->crawlers[1]);
// check node is in the ref
if(kograph_num(caller->kograph, hkey) > 0) {
edges = db_node_get_edges(caller->db_graph, hkey, 0);
if(edges_get_outdegree(edges, FORWARD) > 1) {
follow_break(caller, (dBNode){.key = hkey, .orient = FORWARD});
// Edges restricted to this colour, only in one direction (node.orient)
Edges db_node_edges_in_col(dBNode node, size_t col, const dBGraph *db_graph)
{
if(db_graph->node_in_cols == NULL && db_graph->col_covgs == NULL) {
Edges edges = db_node_get_edges(db_graph, node.key, col);
return edges_mask_orientation(edges, node.orient);
}
// Edges are merged into one colour
ctx_assert(db_graph->num_edge_cols == 1);
ctx_assert(db_graph->node_in_cols != NULL || db_graph->col_covgs != NULL);
Edges edges = db_node_get_edges(db_graph, node.key, 0);
// Check which next nodes are in the given colour
BinaryKmer bkmer = db_node_get_bkmer(db_graph, node.key);
dBNode nodes[4];
Nucleotide nucs[4];
size_t i, n;
n = db_graph_next_nodes(db_graph, bkmer, node.orient,
edges, nodes, nucs);
edges = 0;
if(db_graph->node_in_cols != NULL) {
for(i = 0; i < n; i++)
if(db_node_has_col(db_graph, nodes[i].key, col))
edges = edges_set_edge(edges, nucs[i], node.orient);
}
else if(db_graph->col_covgs != NULL) {
for(i = 0; i < n; i++)
if(db_node_col_covg(db_graph, nodes[i].key, col) > 0)
edges = edges_set_edge(edges, nucs[i], node.orient);
}
else ctx_assert(0);
return edges;
}
// For every kmer in the graph, we run this function
static inline bool print_edges(hkey_t hkey, size_t threadid, void *arg)
{
(void)threadid;
UnitigPrinter *p = (UnitigPrinter*)arg;
UnitigEnd uend = p->ugraph.unitig_ends[hkey];
// Check if node is an end of a unitig
if(uend.assigned) {
BinaryKmer bkey = db_node_get_bkmer(p->db_graph, hkey);
Edges edges = db_node_get_edges(p->db_graph, hkey, 0);
if(uend.left) {
_print_edge(hkey, false, bkey, edges, uend, p);
}
if(uend.right) {
_print_edge(hkey, true, bkey, edges, uend, p);
}
}
return false; // keep iterating
}
void test_graph_crawler()
{
test_status("Testing graph crawler...");
// Construct 1 colour graph with kmer-size=11
dBGraph graph;
const size_t kmer_size = 11, ncols = 3;
db_graph_alloc(&graph, kmer_size, ncols, 1, 2048,
DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL | DBG_ALLOC_BKTLOCKS);
char graphseq[3][77] =
// < X X X...............
{"GTTCCAGAGCGGAGGTCTCCCAACAACATGGTATAAGTTGTCTAGCCCCGGTTCGCGCGGGTACTTCTTACAGCGC",
"GTTCCAGAGCGGAGGTCTCCCAACAACTTGGTATAAGTTGTCTAGTCCCGGTTCGCGCGGCATTTCAGCATTGTTA",
"GTTCCAGAGCGCGACAGAGTGCATATCACGCTAAGCACAGCCCTCTTCTATCTGCTTTTAAATGGATCAATAATCG"};
build_graph_from_str_mt(&graph, 0, graphseq[0], strlen(graphseq[0]));
build_graph_from_str_mt(&graph, 1, graphseq[1], strlen(graphseq[1]));
build_graph_from_str_mt(&graph, 2, graphseq[2], strlen(graphseq[2]));
// Crawl graph
GraphCrawler crawler;
graph_crawler_alloc(&crawler, &graph);
dBNode node = db_graph_find_str(&graph, graphseq[0]);
dBNode next_node = db_graph_find_str(&graph, graphseq[0]+1);
TASSERT(node.key != HASH_NOT_FOUND);
TASSERT(next_node.key != HASH_NOT_FOUND);
BinaryKmer bkey = db_node_get_bkmer(&graph, node.key);
Edges edges = db_node_get_edges(&graph, node.key, 0);
dBNode next_nodes[4];
Nucleotide next_nucs[4];
size_t i, p, num_next, next_idx;
num_next = db_graph_next_nodes(&graph, bkey, node.orient, edges,
next_nodes, next_nucs);
next_idx = 0;
while(next_idx < num_next && !db_nodes_are_equal(next_nodes[next_idx],next_node))
next_idx++;
TASSERT(next_idx < num_next && db_nodes_are_equal(next_nodes[next_idx],next_node));
// Crawl in all colours
graph_crawler_fetch(&crawler, node, next_nodes, next_idx, num_next,
NULL, graph.num_of_cols, NULL, NULL, NULL);
TASSERT2(crawler.num_paths == 2, "crawler.num_paths: %u", crawler.num_paths);
// Fetch paths
dBNodeBuffer nbuf;
db_node_buf_alloc(&nbuf, 16);
StrBuf sbuf;
strbuf_alloc(&sbuf, 128);
for(p = 0; p < crawler.num_paths; p++) {
db_node_buf_reset(&nbuf);
graph_crawler_get_path_nodes(&crawler, p, &nbuf);
strbuf_ensure_capacity(&sbuf, nbuf.len+graph.kmer_size);
sbuf.end = db_nodes_to_str(nbuf.b, nbuf.len, &graph, sbuf.b);
for(i = 0; i < 3 && strcmp(graphseq[i]+1,sbuf.b) != 0; i++) {}
TASSERT2(i < 3, "seq: %s", sbuf.b);
TASSERT2(sbuf.end == 75, "sbuf.end: %zu", sbuf.end);
TASSERT2(nbuf.len == 65, "nbuf.len: %zu", nbuf.len);
}
strbuf_dealloc(&sbuf);
db_node_buf_dealloc(&nbuf);
graph_crawler_dealloc(&crawler);
db_graph_dealloc(&graph);
}
// Walk the graph remembering the last time we met the ref
// When traversal fails, dump sequence up to last meeting with the ref
static void follow_break(BreakpointCaller *caller, dBNode node)
{
size_t i, j, k, num_next;
dBNode next_nodes[4];
Nucleotide next_nucs[4];
size_t nonref_idx[4], num_nonref_next = 0;
const dBGraph *db_graph = caller->db_graph;
BinaryKmer bkey = db_node_get_bkmer(db_graph, node.key);
Edges edges = db_node_get_edges(db_graph, node.key, 0);
num_next = db_graph_next_nodes(db_graph, bkey, node.orient, edges,
next_nodes, next_nucs);
// Filter out next nodes in the reference
for(i = 0; i < num_next; i++) {
if(kograph_num(caller->kograph, next_nodes[i].key) == 0) {
nonref_idx[num_nonref_next] = i;
num_nonref_next++;
}
}
// Abandon if all options are in ref or none are
if(num_nonref_next == num_next || num_nonref_next == 0) return;
// Follow all paths not in ref, in all colours
GraphCrawler *fw_crawler = &caller->crawlers[node.orient];
GraphCrawler *rv_crawler = &caller->crawlers[!node.orient];
dBNodeBuffer *allelebuf = &caller->allelebuf, *flank5pbuf = &caller->flank5pbuf;
GCMultiColPath *flank5p_multicolpath, *allele_multicolpath;
KOccurRun *flank5p_runs, *flank3p_runs;
size_t flank5p_pathid, allele_pathid;
size_t num_flank5p_runs, num_flank3p_runs;
// We fetch 5' flanks in all colours then merge matching paths
// we stop fetching a single path if it stops tracking the reference
// Alternatively, we could fetch the 5' flank in everyone and stop after a
// given distance, then check for that set of paths how much it tracks the
// reference. This has the advantage of scaling much better with number of
// samples, but not so well as min_ref_nkmers increases (since we fetch
// many flanks that can't be used) - I think this is less of a worry.
// Loop over possible next nodes at this junction
for(i = 0; i < num_nonref_next; i++)
{
size_t next_idx = nonref_idx[i];
// Go backwards to get 5p flank
traverse_5pflank(caller, rv_crawler, db_node_reverse(next_nodes[next_idx]),
db_node_reverse(node));
// Loop over the flanks we got
for(j = 0; j < rv_crawler->num_paths; j++)
{
// Get 5p flank
db_node_buf_reset(flank5pbuf);
graph_crawler_get_path_nodes(rv_crawler, j, flank5pbuf);
flank5p_multicolpath = &rv_crawler->multicol_paths[j];
flank5p_pathid = flank5p_multicolpath->pathid;
// Fetch 3pflank ref position
num_flank5p_runs = caller->flank5p_refs[flank5p_pathid].num_runs;
flank5p_runs = fetch_ref_contact(&rv_crawler->cache, flank5p_pathid,
caller->flank5p_refs,
&caller->flank5p_run_buf);
koruns_reverse(flank5p_runs, num_flank5p_runs, flank5pbuf->len);
koruns_sort_by_qoffset(flank5p_runs, num_flank5p_runs);
db_nodes_reverse_complement(flank5pbuf->data, flank5pbuf->len);
if(num_flank5p_runs > 0)
{
// Reset caller
kmer_run_buf_reset(&caller->koruns_3p);
kmer_run_buf_reset(&caller->koruns_3p_ended);
kmer_run_buf_reset(&caller->allele_run_buf);
// functions gcrawler_path_stop_at_ref_covg(),
// gcrawler_path_finish_ref_covg()
// both fill koruns_3p, koruns_3p_ended and allele_run_buf
// Only traverse in the colours we have a flank for
graph_crawler_fetch(fw_crawler, node,
next_nodes, next_nucs, next_idx, num_next,
flank5p_multicolpath->cols,
flank5p_multicolpath->num_cols,
gcrawler_path_stop_at_ref_covg,
gcrawler_path_finish_ref_covg,
caller);
// Assemble contigs - fetch forwards for each path for given 5p flank
for(k = 0; k < fw_crawler->num_paths; k++)
{
// Fetch nodes
db_node_buf_reset(allelebuf);
graph_crawler_get_path_nodes(fw_crawler, k, allelebuf);
ctx_assert(allelebuf->len > 0);
allele_multicolpath = &fw_crawler->multicol_paths[k];
allele_pathid = allele_multicolpath->pathid;
// Fetch 3pflank ref position
num_flank3p_runs = caller->allele_refs[allele_pathid].num_runs;
flank3p_runs = fetch_ref_contact(&fw_crawler->cache, allele_pathid,
caller->allele_refs,
&caller->allele_run_buf);
process_contig(caller,
allele_multicolpath->cols,
allele_multicolpath->num_cols,
flank5pbuf, allelebuf,
flank5p_runs, num_flank5p_runs,
flank3p_runs, num_flank3p_runs);
}
}
}
}
}
static inline int bubble_caller_node(hkey_t hkey, BubbleCaller *caller)
{
Edges edges = db_node_get_edges(caller->db_graph, hkey, 0);
if(edges_get_outdegree(edges, FORWARD) > 1) {
find_bubbles(caller, (dBNode){.key = hkey, .orient = FORWARD});
