//**********************************************************************************************************************
GetCurrentCommand::GetCurrentCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
//check to make sure all parameters are valid for command
for (map<string,string>::iterator it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
clearTypes = validParameter.validFile(parameters, "clear", false);
if (clearTypes == "not found") { clearTypes = ""; }
else { m->splitAtDash(clearTypes, types); }
}
}
catch(exception& e) {
m->errorOut(e, "GetCurrentCommand", "GetCurrentCommand");
exit(1);
}
}
SetLogFileCommand::SetLogFileCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
//check to make sure all parameters are valid for command
for (map<string,string>::iterator it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
name = validParameter.validFile(parameters, "name", false);
if (name == "not found") { m->mothurOut("name is a required parameter for the set.logfile command."); abort = true; }
string temp = validParameter.validFile(parameters, "append", false); if (temp == "not found") { temp = "F"; }
append = m->isTrue(temp);
}
}
catch(exception& e) {
m->errorOut(e, "SetLogFileCommand", "SetLogFileCommand");
exit(1);
}
}
//**********************************************************************************************************************
LoadLogfileCommand::LoadLogfileCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
//valid paramters for this command
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string,string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("logfile");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["logfile"] = inputDir + it->second; }
}
}
//get shared file, it is required
logfile = validParameter.validFile(parameters, "logfile", true);
if (logfile == "not open") { logfile = ""; abort = true; }
else if (logfile == "not found") { m->mothurOut("The logfile parameter is required."); m->mothurOutEndLine();abort = true; }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){
outputDir = m->hasPath(logfile); //if user entered a file with a path then preserve it
}
}
}
catch(exception& e) {
m->errorOut(e, "NewCommand", "NewCommand");
exit(1);
}
}
//**********************************************************************************************************************
SystemCommand::SystemCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
map<string, string>::iterator it;
ValidParameters validParameter;
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
string commandOption = validParameter.validFile(parameters, "command", false);
if (commandOption == "not found") { commandOption = ""; }
else { command = commandOption; }
if ((option == "") && (commandOption == "")) { m->mothurOut("You must enter a command to run."); m->mothurOutEndLine(); abort = true; }
else if (commandOption == "") {
//check for outputdir and inputdir parameters
int commaPos = option.find_first_of(',');
//if there is a comma then grab string up to that pos
if (commaPos != option.npos) {
option = option.substr(0, commaPos);
}
command = option;
}
}
}
catch(exception& e) {
m->errorOut(e, "SystemCommand", "SystemCommand");
exit(1);
}
}
SetDirectoryCommand::SetDirectoryCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
//check to make sure all parameters are valid for command
for (map<string,string>::iterator it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
output = validParameter.validFile(parameters, "output", false);
if (output == "not found") { output = ""; }
input = validParameter.validFile(parameters, "input", false);
if (input == "not found") { input = ""; }
tempdefault = validParameter.validFile(parameters, "tempdefault", false);
if (tempdefault == "not found") { tempdefault = ""; }
if ((input == "") && (output == "") && (tempdefault == "")) {
m->mothurOut("You must provide either an input, output or tempdefault for the set.outdir command."); m->mothurOutEndLine(); abort = true;
}
}
}
catch(exception& e) {
m->errorOut(e, "SetDirectoryCommand", "SetDirectoryCommand");
exit(1);
}
}
MakeFileCommand::MakeFileCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string, string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["file"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; m->mothurOut("[ERROR]: The inputdir parameter is required, aborting."); m->mothurOutEndLine(); abort = true; }
else {
if (m->dirCheck(inputDir)) {} // all set
else { abort = true; }
}
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = inputDir; }
//if the user changes the input directory command factory will send this info to us in the output parameter
typeFile = validParameter.validFile(parameters, "type", false);
if (typeFile == "not found"){ typeFile = "fastq"; }
if ((typeFile != "fastq") && (typeFile != "gz")) { m->mothurOut(typeFile + " is not a valid type. Options are fastq or gz. I will use fastq."); m->mothurOutEndLine(); typeFile = "fastq"; }
string temp = validParameter.validFile(parameters, "numcols", false); if(temp == "not found"){ temp = "3"; }
if ((temp != "2") && (temp != "3")) { m->mothurOut(temp + " is not a valid numcols. Options are 2 or 3. I will use 3."); m->mothurOutEndLine(); temp = "3"; }
m->mothurConvert(temp, numCols);
}
}
catch(exception& e) {
m->errorOut(e, "MakeFileCommand", "MakeFileCommand");
exit(1);
}
}
AnosimCommand::AnosimCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
//check to make sure all parameters are valid for command
map<string,string>::iterator it;
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["anosim"] = tempOutNames;
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("design");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["design"] = inputDir + it->second; }
}
it = parameters.find("phylip");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["phylip"] = inputDir + it->second; }
}
}
phylipFileName = validParameter.validFile(parameters, "phylip", true);
if (phylipFileName == "not open") { phylipFileName = ""; abort = true; }
else if (phylipFileName == "not found") {
//if there is a current phylip file, use it
phylipFileName = m->getPhylipFile();
if (phylipFileName != "") { m->mothurOut("Using " + phylipFileName + " as input file for the phylip parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current phylip file and the phylip parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { m->setPhylipFile(phylipFileName); }
//check for required parameters
designFileName = validParameter.validFile(parameters, "design", true);
if (designFileName == "not open") { designFileName = ""; abort = true; }
else if (designFileName == "not found") {
//if there is a current design file, use it
designFileName = m->getDesignFile();
if (designFileName != "") { m->mothurOut("Using " + designFileName + " as input file for the design parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current design file and the design parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { m->setDesignFile(designFileName); }
string temp = validParameter.validFile(parameters, "iters", false);
if (temp == "not found") { temp = "1000"; }
m->mothurConvert(temp, iters);
temp = validParameter.validFile(parameters, "alpha", false);
if (temp == "not found") { temp = "0.05"; }
m->mothurConvert(temp, experimentwiseAlpha);
}
}
catch(exception& e) {
m->errorOut(e, "AnosimCommand", "AnosimCommand");
exit(1);
}
}
MakeGroupCommand::MakeGroupCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string, string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["group"] = tempOutNames;
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
fastaFileName = validParameter.validFile(parameters, "fasta", false);
if (fastaFileName == "not found") { //if there is a current fasta file, use it
string filename = m->getFastaFile();
if (filename != "") { fastaFileNames.push_back(filename); m->mothurOut("Using " + filename + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; }
}else {
m->splitAtDash(fastaFileName, fastaFileNames);
//go through files and make sure they are good, if not, then disregard them
for (int i = 0; i < fastaFileNames.size(); i++) {
bool ignore = false;
if (fastaFileNames[i] == "current") {
fastaFileNames[i] = m->getFastaFile();
if (fastaFileNames[i] != "") {
m->mothurOut("Using " + fastaFileNames[i] + " as input file for the fasta parameter where you had given current."); m->mothurOutEndLine();
filename += m->getRootName(m->getSimpleName(fastaFileNames[i]));
}
else {
m->mothurOut("You have no current fastafile, ignoring current."); m->mothurOutEndLine(); ignore=true;
//erase from file list
fastaFileNames.erase(fastaFileNames.begin()+i);
i--;
}
}
if (!ignore) {
if (inputDir != "") {
string path = m->hasPath(fastaFileNames[i]);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { fastaFileNames[i] = inputDir + fastaFileNames[i]; }
}
ifstream in;
bool ableToOpen = m->openInputFile(fastaFileNames[i], in, "noerror");
//if you can't open it, try default location
if (!ableToOpen) {
if (m->getDefaultPath() != "") { //default path is set
string tryPath = m->getDefaultPath() + m->getSimpleName(fastaFileNames[i]);
m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
fastaFileNames[i] = tryPath;
}
}
//if you can't open it, try default location
if (!ableToOpen) {
if (m->getOutputDir() != "") { //default path is set
string tryPath = m->getOutputDir() + m->getSimpleName(fastaFileNames[i]);
m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
fastaFileNames[i] = tryPath;
}
}
in.close();
if (!ableToOpen) {
m->mothurOut("Unable to open " + fastaFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
//erase from file list
fastaFileNames.erase(fastaFileNames.begin()+i);
i--;
}else{ filename += m->getRootName(m->getSimpleName(fastaFileNames[i])); m->setFastaFile(fastaFileNames[i]); }
}
}
//prevent giantic file name
map<string, string> variables;
variables["[filename]"] = filename;
if (fastaFileNames.size() > 3) { variables["[filename]"] = "merge"; }
filename = getOutputFileName("group",variables);
//make sure there is at least one valid file left
if (fastaFileNames.size() == 0) { m->mothurOut("no valid files."); m->mothurOutEndLine(); abort = true; }
}
output = validParameter.validFile(parameters, "output", false);
if (output == "not found") { output = ""; }
else{ filename = output; }
groups = validParameter.validFile(parameters, "groups", false);
if (groups == "not found") { m->mothurOut("groups is a required parameter for the make.group command."); m->mothurOutEndLine(); abort = true; }
else { m->splitAtDash(groups, groupsNames); }
if (groupsNames.size() != fastaFileNames.size()) { m->mothurOut("You do not have the same number of valid fastfile files as groups. This could be because we could not open a fastafile."); m->mothurOutEndLine(); abort = true; }
}
}
catch(exception& e) {
m->errorOut(e, "MakeGroupCommand", "MakeGroupCommand");
exit(1);
}
}
MatrixOutputCommand::MatrixOutputCommand(string option) {
try {
abort = false; calledHelp = false;
allLines = 1;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
map<string,string>::iterator it;
ValidParameters validParameter;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["phylip"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("shared");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["shared"] = inputDir + it->second; }
}
}
sharedfile = validParameter.validFile(parameters, "shared", true);
if (sharedfile == "not found") {
//if there is a current shared file, use it
sharedfile = m->getSharedFile();
if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current sharedfile and the shared parameter is required."); m->mothurOutEndLine(); abort = true; }
}else if (sharedfile == "not open") { sharedfile = ""; abort = true; }
else { m->setSharedFile(sharedfile); }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){
outputDir = "";
outputDir += m->hasPath(sharedfile); //if user entered a file with a path then preserve it
}
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
label = validParameter.validFile(parameters, "label", false);
if (label == "not found") { label = ""; }
else {
if(label != "all") { m->splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
output = validParameter.validFile(parameters, "output", false); if(output == "not found"){ output = "lt"; }
if ((output != "lt") && (output != "square") && (output != "column")) { m->mothurOut(output + " is not a valid output form. Options are lt, column and square. I will use lt."); m->mothurOutEndLine(); output = "lt"; }
mode = validParameter.validFile(parameters, "mode", false); if(mode == "not found"){ mode = "average"; }
if ((mode != "average") && (mode != "median")) { m->mothurOut(mode + " is not a valid mode. Options are average and medina. I will use average."); m->mothurOutEndLine(); output = "average"; }
groups = validParameter.validFile(parameters, "groups", false);
if (groups == "not found") { groups = ""; }
else {
m->splitAtDash(groups, Groups);
m->setGroups(Groups);
}
string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
m->mothurConvert(temp, processors);
calc = validParameter.validFile(parameters, "calc", false);
if (calc == "not found") { calc = "jclass-thetayc"; }
else {
if (calc == "default") { calc = "jclass-thetayc"; }
}
m->splitAtDash(calc, Estimators);
if (m->inUsersGroups("citation", Estimators)) {
ValidCalculators validCalc; validCalc.printCitations(Estimators);
//remove citation from list of calcs
for (int i = 0; i < Estimators.size(); i++) { if (Estimators[i] == "citation") { Estimators.erase(Estimators.begin()+i); break; } }
}
temp = validParameter.validFile(parameters, "iters", false); if (temp == "not found") { temp = "1000"; }
m->mothurConvert(temp, iters);
temp = validParameter.validFile(parameters, "subsample", false); if (temp == "not found") { temp = "F"; }
if (m->isNumeric1(temp)) { m->mothurConvert(temp, subsampleSize); subsample = true; }
else {
if (m->isTrue(temp)) { subsample = true; subsampleSize = -1; } //we will set it to smallest group later
else { subsample = false; }
}
if (subsample == false) { iters = 0; }
if (abort == false) {
ValidCalculators validCalculator;
int i;
for (i=0; i<Estimators.size(); i++) {
if (validCalculator.isValidCalculator("matrix", Estimators[i]) == true) {
if (Estimators[i] == "sharedsobs") {
matrixCalculators.push_back(new SharedSobsCS());
}else if (Estimators[i] == "sharedchao") {
matrixCalculators.push_back(new SharedChao1());
}else if (Estimators[i] == "sharedace") {
matrixCalculators.push_back(new SharedAce());
}else if (Estimators[i] == "jabund") {
matrixCalculators.push_back(new JAbund());
}else if (Estimators[i] == "sorabund") {
matrixCalculators.push_back(new SorAbund());
}else if (Estimators[i] == "jclass") {
matrixCalculators.push_back(new Jclass());
}else if (Estimators[i] == "sorclass") {
matrixCalculators.push_back(new SorClass());
}else if (Estimators[i] == "jest") {
matrixCalculators.push_back(new Jest());
}else if (Estimators[i] == "sorest") {
matrixCalculators.push_back(new SorEst());
}else if (Estimators[i] == "thetayc") {
matrixCalculators.push_back(new ThetaYC());
}else if (Estimators[i] == "thetan") {
matrixCalculators.push_back(new ThetaN());
}else if (Estimators[i] == "kstest") {
matrixCalculators.push_back(new KSTest());
}else if (Estimators[i] == "sharednseqs") {
matrixCalculators.push_back(new SharedNSeqs());
}else if (Estimators[i] == "ochiai") {
matrixCalculators.push_back(new Ochiai());
}else if (Estimators[i] == "anderberg") {
matrixCalculators.push_back(new Anderberg());
}else if (Estimators[i] == "kulczynski") {
matrixCalculators.push_back(new Kulczynski());
}else if (Estimators[i] == "kulczynskicody") {
matrixCalculators.push_back(new KulczynskiCody());
}else if (Estimators[i] == "lennon") {
matrixCalculators.push_back(new Lennon());
}else if (Estimators[i] == "morisitahorn") {
matrixCalculators.push_back(new MorHorn());
}else if (Estimators[i] == "braycurtis") {
matrixCalculators.push_back(new BrayCurtis());
}else if (Estimators[i] == "whittaker") {
matrixCalculators.push_back(new Whittaker());
}else if (Estimators[i] == "odum") {
matrixCalculators.push_back(new Odum());
}else if (Estimators[i] == "canberra") {
matrixCalculators.push_back(new Canberra());
}else if (Estimators[i] == "structeuclidean") {
matrixCalculators.push_back(new StructEuclidean());
}else if (Estimators[i] == "structchord") {
matrixCalculators.push_back(new StructChord());
}else if (Estimators[i] == "hellinger") {
matrixCalculators.push_back(new Hellinger());
}else if (Estimators[i] == "manhattan") {
matrixCalculators.push_back(new Manhattan());
}else if (Estimators[i] == "structpearson") {
matrixCalculators.push_back(new StructPearson());
}else if (Estimators[i] == "soergel") {
matrixCalculators.push_back(new Soergel());
}else if (Estimators[i] == "spearman") {
matrixCalculators.push_back(new Spearman());
}else if (Estimators[i] == "structkulczynski") {
matrixCalculators.push_back(new StructKulczynski());
}else if (Estimators[i] == "speciesprofile") {
matrixCalculators.push_back(new SpeciesProfile());
}else if (Estimators[i] == "hamming") {
matrixCalculators.push_back(new Hamming());
}else if (Estimators[i] == "structchi2") {
matrixCalculators.push_back(new StructChi2());
}else if (Estimators[i] == "gower") {
matrixCalculators.push_back(new Gower());
}else if (Estimators[i] == "memchi2") {
matrixCalculators.push_back(new MemChi2());
}else if (Estimators[i] == "memchord") {
matrixCalculators.push_back(new MemChord());
}else if (Estimators[i] == "memeuclidean") {
matrixCalculators.push_back(new MemEuclidean());
}else if (Estimators[i] == "mempearson") {
matrixCalculators.push_back(new MemPearson());
}else if (Estimators[i] == "jsd") {
matrixCalculators.push_back(new JSD());
}else if (Estimators[i] == "rjsd") {
matrixCalculators.push_back(new RJSD());
}
}
}
}
}
}
catch(exception& e) {
m->errorOut(e, "MatrixOutputCommand", "MatrixOutputCommand");
exit(1);
}
}
//**********************************************************************************************************************
SetCurrentCommand::SetCurrentCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
//valid paramters for this command
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string,string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("phylip");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["phylip"] = inputDir + it->second; }
}
it = parameters.find("column");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["column"] = inputDir + it->second; }
}
it = parameters.find("fasta");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
it = parameters.find("list");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["list"] = inputDir + it->second; }
}
it = parameters.find("rabund");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["rabund"] = inputDir + it->second; }
}
it = parameters.find("sabund");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["sabund"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
it = parameters.find("group");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["group"] = inputDir + it->second; }
}
it = parameters.find("design");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["design"] = inputDir + it->second; }
}
it = parameters.find("order");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["order"] = inputDir + it->second; }
}
it = parameters.find("tree");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["tree"] = inputDir + it->second; }
}
it = parameters.find("shared");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["shared"] = inputDir + it->second; }
}
it = parameters.find("ordergroup");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["ordergroup"] = inputDir + it->second; }
}
it = parameters.find("count");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["count"] = inputDir + it->second; }
}
it = parameters.find("relabund");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["relabund"] = inputDir + it->second; }
}
it = parameters.find("fasta");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
it = parameters.find("qfile");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["qfile"] = inputDir + it->second; }
}
it = parameters.find("sff");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["sff"] = inputDir + it->second; }
}
it = parameters.find("oligos");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["oligos"] = inputDir + it->second; }
}
it = parameters.find("accnos");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["accnos"] = inputDir + it->second; }
}
it = parameters.find("taxonomy");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["taxonomy"] = inputDir + it->second; }
}
it = parameters.find("flow");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["flow"] = inputDir + it->second; }
}
it = parameters.find("biom");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["biom"] = inputDir + it->second; }
}
it = parameters.find("summary");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["summary"] = inputDir + it->second; }
}
}
//check for parameters
phylipfile = validParameter.validFile(parameters, "phylip", true);
if (phylipfile == "not open") { m->mothurOut("Ignoring: " + parameters["phylip"]); m->mothurOutEndLine(); phylipfile = ""; }
else if (phylipfile == "not found") { phylipfile = ""; }
if (phylipfile != "") { m->setPhylipFile(phylipfile); }
columnfile = validParameter.validFile(parameters, "column", true);
if (columnfile == "not open") { m->mothurOut("Ignoring: " + parameters["column"]); m->mothurOutEndLine(); columnfile = ""; }
else if (columnfile == "not found") { columnfile = ""; }
if (columnfile != "") { m->setColumnFile(columnfile); }
listfile = validParameter.validFile(parameters, "list", true);
if (listfile == "not open") { m->mothurOut("Ignoring: " + parameters["list"]); m->mothurOutEndLine(); listfile = ""; }
else if (listfile == "not found") { listfile = ""; }
if (listfile != "") { m->setListFile(listfile); }
rabundfile = validParameter.validFile(parameters, "rabund", true);
if (rabundfile == "not open") { m->mothurOut("Ignoring: " + parameters["rabund"]); m->mothurOutEndLine(); rabundfile = ""; }
else if (rabundfile == "not found") { rabundfile = ""; }
if (rabundfile != "") { m->setRabundFile(rabundfile); }
sabundfile = validParameter.validFile(parameters, "sabund", true);
if (sabundfile == "not open") { m->mothurOut("Ignoring: " + parameters["sabund"]); m->mothurOutEndLine(); sabundfile = ""; }
else if (sabundfile == "not found") { sabundfile = ""; }
if (sabundfile != "") { m->setSabundFile(sabundfile); }
namefile = validParameter.validFile(parameters, "name", true);
if (namefile == "not open") { m->mothurOut("Ignoring: " + parameters["name"]); m->mothurOutEndLine(); namefile = ""; }
else if (namefile == "not found") { namefile = ""; }
if (namefile != "") { m->setNameFile(namefile); }
groupfile = validParameter.validFile(parameters, "group", true);
if (groupfile == "not open") { m->mothurOut("Ignoring: " + parameters["group"]); m->mothurOutEndLine(); groupfile = ""; }
else if (groupfile == "not found") { groupfile = ""; }
if (groupfile != "") { m->setGroupFile(groupfile); }
countfile = validParameter.validFile(parameters, "count", true);
if (countfile == "not open") { m->mothurOut("Ignoring: " + parameters["count"]); m->mothurOutEndLine(); countfile = ""; }
else if (countfile == "not found") { countfile = ""; }
if (countfile != "") { m->setCountTableFile(countfile); }
designfile = validParameter.validFile(parameters, "design", true);
if (designfile == "not open") { m->mothurOut("Ignoring: " + parameters["design"]); m->mothurOutEndLine(); designfile = ""; }
else if (designfile == "not found") { designfile = ""; }
if (designfile != "") { m->setDesignFile(designfile); }
orderfile = validParameter.validFile(parameters, "order", true);
if (orderfile == "not open") { m->mothurOut("Ignoring: " + parameters["order"]); m->mothurOutEndLine(); orderfile = ""; }
else if (orderfile == "not found") { orderfile = ""; }
if (orderfile != "") { m->setOrderFile(orderfile); }
treefile = validParameter.validFile(parameters, "tree", true);
if (treefile == "not open") { m->mothurOut("Ignoring: " + parameters["tree"]); m->mothurOutEndLine(); treefile = ""; }
else if (treefile == "not found") { treefile = ""; }
if (treefile != "") { m->setTreeFile(treefile); }
sharedfile = validParameter.validFile(parameters, "shared", true);
if (sharedfile == "not open") { m->mothurOut("Ignoring: " + parameters["shared"]); m->mothurOutEndLine(); sharedfile = ""; }
else if (sharedfile == "not found") { sharedfile = ""; }
if (sharedfile != "") { m->setSharedFile(sharedfile); }
ordergroupfile = validParameter.validFile(parameters, "ordergroup", true);
if (ordergroupfile == "not open") { m->mothurOut("Ignoring: " + parameters["ordergroup"]); m->mothurOutEndLine(); ordergroupfile = ""; }
else if (ordergroupfile == "not found") { ordergroupfile = ""; }
if (ordergroupfile != "") { m->setOrderGroupFile(ordergroupfile); }
relabundfile = validParameter.validFile(parameters, "relabund", true);
if (relabundfile == "not open") { m->mothurOut("Ignoring: " + parameters["relabund"]); m->mothurOutEndLine(); relabundfile = ""; }
else if (relabundfile == "not found") { relabundfile = ""; }
if (relabundfile != "") { m->setRelAbundFile(relabundfile); }
fastafile = validParameter.validFile(parameters, "fasta", true);
if (fastafile == "not open") { m->mothurOut("Ignoring: " + parameters["fasta"]); m->mothurOutEndLine(); fastafile = ""; }
else if (fastafile == "not found") { fastafile = ""; }
if (fastafile != "") { m->setFastaFile(fastafile); }
qualfile = validParameter.validFile(parameters, "qfile", true);
if (qualfile == "not open") { m->mothurOut("Ignoring: " + parameters["qfile"]); m->mothurOutEndLine(); qualfile = ""; }
else if (qualfile == "not found") { qualfile = ""; }
if (qualfile != "") { m->setQualFile(qualfile); }
sfffile = validParameter.validFile(parameters, "sff", true);
if (sfffile == "not open") { m->mothurOut("Ignoring: " + parameters["sff"]); m->mothurOutEndLine(); sfffile = ""; }
else if (sfffile == "not found") { sfffile = ""; }
if (sfffile != "") { m->setSFFFile(sfffile); }
oligosfile = validParameter.validFile(parameters, "oligos", true);
if (oligosfile == "not open") { m->mothurOut("Ignoring: " + parameters["oligos"]); m->mothurOutEndLine(); oligosfile = ""; }
else if (oligosfile == "not found") { oligosfile = ""; }
if (oligosfile != "") { m->setOligosFile(oligosfile); }
accnosfile = validParameter.validFile(parameters, "accnos", true);
if (accnosfile == "not open") { m->mothurOut("Ignoring: " + parameters["accnos"]); m->mothurOutEndLine(); accnosfile = ""; }
else if (accnosfile == "not found") { accnosfile = ""; }
if (accnosfile != "") { m->setAccnosFile(accnosfile); }
taxonomyfile = validParameter.validFile(parameters, "taxonomy", true);
if (taxonomyfile == "not open") { m->mothurOut("Ignoring: " + parameters["taxonomy"]); m->mothurOutEndLine(); taxonomyfile = ""; }
else if (taxonomyfile == "not found") { taxonomyfile = ""; }
if (taxonomyfile != "") { m->setTaxonomyFile(taxonomyfile); }
flowfile = validParameter.validFile(parameters, "flow", true);
if (flowfile == "not open") { m->mothurOut("Ignoring: " + parameters["flow"]); m->mothurOutEndLine(); flowfile = ""; }
else if (flowfile == "not found") { flowfile = ""; }
if (flowfile != "") { m->setFlowFile(flowfile); }
biomfile = validParameter.validFile(parameters, "biom", true);
if (biomfile == "not open") { m->mothurOut("Ignoring: " + parameters["biom"]); m->mothurOutEndLine(); biomfile = ""; }
else if (biomfile == "not found") { biomfile = ""; }
if (biomfile != "") { m->setBiomFile(biomfile); }
summaryfile = validParameter.validFile(parameters, "summary", true);
if (summaryfile == "not open") { m->mothurOut("Ignoring: " + parameters["summary"]); m->mothurOutEndLine(); summaryfile = ""; }
else if (summaryfile == "not found") { summaryfile = ""; }
if (summaryfile != "") { m->setSummaryFile(summaryfile); }
string temp = validParameter.validFile(parameters, "processors", false);
if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
clearTypes = validParameter.validFile(parameters, "clear", false);
if (clearTypes == "not found") { clearTypes = ""; }
else { m->splitAtDash(clearTypes, types); }
}
}
catch(exception& e) {
m->errorOut(e, "SetCurrentCommand", "SetCurrentCommand");
exit(1);
}
}
//**********************************************************************************************************************
//This function checks to make sure the cluster command has no errors and then clusters based on the method chosen.
ClusterCommand::ClusterCommand(string option) {
try{
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
map<string,string>::iterator it;
ValidParameters validParameter;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) {
abort = true;
}
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["list"] = tempOutNames;
outputTypes["rabund"] = tempOutNames;
outputTypes["sabund"] = tempOutNames;
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("phylip");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["phylip"] = inputDir + it->second; }
}
it = parameters.find("column");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["column"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
}
//check for required parameters
phylipfile = validParameter.validFile(parameters, "phylip", true);
if (phylipfile == "not open") { phylipfile = ""; abort = true; }
else if (phylipfile == "not found") { phylipfile = ""; }
else { distfile = phylipfile; format = "phylip"; m->setPhylipFile(phylipfile); }
columnfile = validParameter.validFile(parameters, "column", true);
if (columnfile == "not open") { columnfile = ""; abort = true; }
else if (columnfile == "not found") { columnfile = ""; }
else { distfile = columnfile; format = "column"; m->setColumnFile(columnfile); }
namefile = validParameter.validFile(parameters, "name", true);
if (namefile == "not open") { abort = true; }
else if (namefile == "not found") { namefile = ""; }
else { m->setNameFile(namefile); }
if ((phylipfile == "") && (columnfile == "")) {
//is there are current file available for either of these?
//give priority to column, then phylip
columnfile = m->getColumnFile();
if (columnfile != "") { distfile = columnfile; format = "column"; m->mothurOut("Using " + columnfile + " as input file for the column parameter."); m->mothurOutEndLine(); }
else {
phylipfile = m->getPhylipFile();
if (phylipfile != "") { distfile = phylipfile; format = "phylip"; m->mothurOut("Using " + phylipfile + " as input file for the phylip parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("No valid current files. You must provide a phylip or column file before you can use the cluster command."); m->mothurOutEndLine();
abort = true;
}
}
}
else if ((phylipfile != "") && (columnfile != "")) { m->mothurOut("When executing a cluster command you must enter ONLY ONE of the following: phylip or column."); m->mothurOutEndLine(); abort = true; }
if (columnfile != "") {
if (namefile == "") {
namefile = m->getNameFile();
if (namefile != "") { m->mothurOut("Using " + namefile + " as input file for the name parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("You need to provide a namefile if you are going to use the column format."); m->mothurOutEndLine();
abort = true;
}
}
}
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
//get user cutoff and precision or use defaults
string temp;
temp = validParameter.validFile(parameters, "precision", false);
if (temp == "not found") { temp = "100"; }
//saves precision legnth for formatting below
length = temp.length();
m->mothurConvert(temp, precision);
temp = validParameter.validFile(parameters, "hard", false); if (temp == "not found") { temp = "T"; }
hard = m->isTrue(temp);
temp = validParameter.validFile(parameters, "sim", false); if (temp == "not found") { temp = "F"; }
sim = m->isTrue(temp);
temp = validParameter.validFile(parameters, "cutoff", false);
if (temp == "not found") { temp = "10"; }
m->mothurConvert(temp, cutoff);
cutoff += (5 / (precision * 10.0));
method = validParameter.validFile(parameters, "method", false);
if (method == "not found") { method = "average"; }
if ((method == "furthest") || (method == "nearest") || (method == "average") || (method == "weighted")) { }
else { m->mothurOut("Not a valid clustering method. Valid clustering algorithms are furthest, nearest, average, and weighted."); m->mothurOutEndLine(); abort = true; }
showabund = validParameter.validFile(parameters, "showabund", false);
if (showabund == "not found") { showabund = "T"; }
timing = validParameter.validFile(parameters, "timing", false);
if (timing == "not found") { timing = "F"; }
}
}
catch(exception& e) {
m->errorOut(e, "ClusterCommand", "ClusterCommand");
exit(1);
}
}
SensSpecCommand::SensSpecCommand(string option) {
try {
abort = false; calledHelp = false;
allLines = 1;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
string temp;
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string,string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["sensspec"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("list");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["list"] = inputDir + it->second; }
}
it = parameters.find("phylip");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["phylip"] = inputDir + it->second; }
}
it = parameters.find("column");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["column"] = inputDir + it->second; }
}
}
//check for required parameters
listFile = validParameter.validFile(parameters, "list", true);
if (listFile == "not found") {
listFile = m->getListFile();
if (listFile != "") { m->mothurOut("Using " + listFile + " as input file for the list parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current list file and the list parameter is required."); m->mothurOutEndLine(); abort = true; }
}
else if (listFile == "not open") { abort = true; }
else { m->setListFile(listFile); }
phylipfile = validParameter.validFile(parameters, "phylip", true);
if (phylipfile == "not found") { phylipfile = ""; }
else if (phylipfile == "not open") { abort = true; }
else { distFile = phylipfile; format = "phylip"; m->setPhylipFile(phylipfile); }
columnfile = validParameter.validFile(parameters, "column", true);
if (columnfile == "not found") { columnfile = ""; }
else if (columnfile == "not open") { abort = true; }
else { distFile = columnfile; format = "column"; m->setColumnFile(columnfile); }
if ((phylipfile == "") && (columnfile == "")) { //is there are current file available for either of these?
//give priority to column, then phylip
columnfile = m->getColumnFile();
if (columnfile != "") { distFile = columnfile; format = "column"; m->mothurOut("Using " + columnfile + " as input file for the column parameter."); m->mothurOutEndLine(); }
else {
phylipfile = m->getPhylipFile();
if (phylipfile != "") { distFile = phylipfile; format = "phylip"; m->mothurOut("Using " + phylipfile + " as input file for the phylip parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("No valid current files. You must provide a phylip or column file."); m->mothurOutEndLine();
abort = true;
}
}
}else if ((phylipfile != "") && (columnfile != "")) { m->mothurOut("When executing a sens.spec command you must enter ONLY ONE of the following: phylip or column."); m->mothurOutEndLine(); abort = true; }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false);
if (outputDir == "not found"){
outputDir = "";
outputDir += m->hasPath(listFile); //if user entered a file with a path then preserve it
}
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
temp = validParameter.validFile(parameters, "hard", false);
if (temp == "not found"){ hard = 0; }
else if(!m->isTrue(temp)) { hard = 0; }
else if(m->isTrue(temp)) { hard = 1; }
temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found") { temp = "-1.00"; }
m->mothurConvert(temp, cutoff);
// cout << cutoff << endl;
temp = validParameter.validFile(parameters, "precision", false); if (temp == "not found") { temp = "100"; }
m->mothurConvert(temp, precision);
// cout << precision << endl;
string label = validParameter.validFile(parameters, "label", false);
if (label == "not found") { label = ""; }
else {
if(label != "all") { m->splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
map<string, string> variables;
variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(listFile));
sensSpecFileName = getOutputFileName("sensspec",variables);
}
}
catch(exception& e) {
m->errorOut(e, "SensSpecCommand", "SensSpecCommand");
exit(1);
}
}
//**********************************************************************************************************************
GetSharedOTUCommand::GetSharedOTUCommand(string option) {
try {
abort = false; calledHelp = false;
unique = true;
allLines = 1;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string,string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["fasta"] = tempOutNames;
outputTypes["accnos"] = tempOutNames;
outputTypes["sharedseqs"] = tempOutNames;
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("fasta");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
it = parameters.find("list");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["list"] = inputDir + it->second; }
}
it = parameters.find("shared");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["shared"] = inputDir + it->second; }
}
it = parameters.find("group");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["group"] = inputDir + it->second; }
}
}
//check for required parameters
listfile = validParameter.validFile(parameters, "list", true);
if (listfile == "not open") { abort = true; }
else if (listfile == "not found") { listfile = ""; }
else { format = "list"; m->setListFile(listfile); }
groupfile = validParameter.validFile(parameters, "group", true);
if (groupfile == "not open") { abort = true; }
else if (groupfile == "not found") { groupfile = ""; }
else { m->setGroupFile(groupfile); }
sharedfile = validParameter.validFile(parameters, "shared", true);
if (sharedfile == "not open") { abort = true; }
else if (sharedfile == "not found") { sharedfile = ""; }
else { m->setSharedFile(sharedfile); }
fastafile = validParameter.validFile(parameters, "fasta", true);
if (fastafile == "not open") { abort = true; }
else if (fastafile == "not found") { fastafile = ""; }
else { m->setFastaFile(fastafile); }
if ((sharedfile == "") && (listfile == "")) { //look for currents
//is there are current file available for either of these?
//give priority to shared, then list
sharedfile = m->getSharedFile();
if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); }
else {
listfile = m->getListFile();
if (listfile != "") { m->mothurOut("Using " + listfile + " as input file for the list parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("No valid current files. You must provide a shared or list file."); m->mothurOutEndLine();
abort = true;
}
}
}else if ((sharedfile != "") && (listfile != "")) {
m->mothurOut("You may enter ONLY ONE of the following: shared or list."); m->mothurOutEndLine(); abort = true;
}
if (listfile != "") {
if (groupfile == ""){
groupfile = m->getGroupFile();
if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You need to provide a group file if you are going to use the list format."); m->mothurOutEndLine(); abort = true;
}
}
}
if ((sharedfile != "") && (fastafile != "")) { m->mothurOut("You cannot use the fasta file with the shared file."); m->mothurOutEndLine(); abort = true; }
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
label = validParameter.validFile(parameters, "label", false);
if (label == "not found") { label = ""; }
else {
if(label != "all") { m->splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
output = validParameter.validFile(parameters, "output", false);
if (output == "not found") { output = ""; }
else if (output == "default") { output = ""; }
groups = validParameter.validFile(parameters, "uniquegroups", false);
if (groups == "not found") { groups = ""; }
else {
userGroups = "unique." + groups;
m->splitAtDash(groups, Groups);
}
groups = validParameter.validFile(parameters, "sharedgroups", false);
if (groups == "not found") { groups = ""; }
else {
userGroups = groups;
m->splitAtDash(groups, Groups);
unique = false;
}
}
}
catch(exception& e) {
m->errorOut(e, "GetSharedOTUCommand", "GetSharedOTUCommand");
exit(1);
}
}
//**********************************************************************************************************************
PipelineCommand::PipelineCommand(string option) {
try {
cFactory = CommandFactory::getInstance();
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string, string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("sff");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["sff"] = inputDir + it->second; }
}
it = parameters.find("oligos");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["oligos"] = inputDir + it->second; }
}
it = parameters.find("align");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["align"] = inputDir + it->second; }
}
it = parameters.find("chimera");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["chimera"] = inputDir + it->second; }
}
it = parameters.find("classify");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["classify"] = inputDir + it->second; }
}
it = parameters.find("taxonomy");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["taxonomy"] = inputDir + it->second; }
}
it = parameters.find("pipeline");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["pipeline"] = inputDir + it->second; }
}
}
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
pipeFilename = validParameter.validFile(parameters, "pipeline", true);
if (pipeFilename == "not found") { pipeFilename = ""; }
else if (pipeFilename == "not open") { pipeFilename = ""; abort = true; }
string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
m->mothurConvert(temp, processors);
if (pipeFilename != "") {
abort = readUsersPipeline();
}else{
sffFile = validParameter.validFile(parameters, "sff", true);
if (sffFile == "not found") { m->mothurOut("sff is a required parameter for the pipeline command."); m->mothurOutEndLine(); abort = true; }
else if (sffFile == "not open") { sffFile = ""; abort = true; }
else { m->setSFFFile(sffFile); }
oligosFile = validParameter.validFile(parameters, "oligos", true);
if (oligosFile == "not found") { m->mothurOut("oligos is a required parameter for the pipeline command."); m->mothurOutEndLine(); abort = true; }
else if (oligosFile == "not open") { oligosFile = ""; abort = true; }
alignFile = validParameter.validFile(parameters, "align", true);
if (alignFile == "not found") { m->mothurOut("align is a required parameter for the pipeline command. Please provide the template to align with."); m->mothurOutEndLine(); abort = true; }
else if (alignFile == "not open") { alignFile = ""; abort = true; }
chimeraFile = validParameter.validFile(parameters, "chimera", true);
if (chimeraFile == "not found") { m->mothurOut("chimera is a required parameter for the pipeline command. Please provide the template to check for chimeras with."); m->mothurOutEndLine(); abort = true; }
else if (chimeraFile == "not open") { chimeraFile = ""; abort = true; }
classifyFile = validParameter.validFile(parameters, "classify", true);
if (classifyFile == "not found") { m->mothurOut("classify is a required parameter for the pipeline command. Please provide the template to use with the classifier."); m->mothurOutEndLine(); abort = true; }
else if (classifyFile == "not open") { classifyFile = ""; abort = true; }
taxonomyFile = validParameter.validFile(parameters, "taxonomy", true);
if (taxonomyFile == "not found") { m->mothurOut("taxonomy is a required parameter for the pipeline command."); m->mothurOutEndLine(); abort = true; }
else if (taxonomyFile == "not open") { taxonomyFile = ""; abort = true; }
}
}
}
catch(exception& e) {
m->errorOut(e, "PipelineCommand", "PipelineCommand");
exit(1);
}
}
SffMultipleCommand::SffMultipleCommand(string option) {
try {
abort = false; calledHelp = false; append=false; makeGroup=false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
//valid paramters for this command
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string,string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["fasta"] = tempOutNames;
outputTypes["name"] = tempOutNames;
outputTypes["group"] = tempOutNames;
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
//if the user changes the input directory command factory will send this info to us in the output parameter
inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("file");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["file"] = inputDir + it->second; }
}
it = parameters.find("lookup");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["lookup"] = inputDir + it->second; }
}
}
filename = validParameter.validFile(parameters, "file", true);
if (filename == "not open") { filename = ""; abort = true; }
else if (filename == "not found") { filename = ""; }
string temp;
temp = validParameter.validFile(parameters, "trim", false); if (temp == "not found"){ temp = "T"; }
trim = m->isTrue(temp);
temp = validParameter.validFile(parameters, "minflows", false); if (temp == "not found") { temp = "450"; }
m->mothurConvert(temp, minFlows);
temp = validParameter.validFile(parameters, "maxflows", false); if (temp == "not found") { temp = "450"; }
m->mothurConvert(temp, maxFlows);
temp = validParameter.validFile(parameters, "maxhomop", false); if (temp == "not found"){ temp = "9"; }
m->mothurConvert(temp, maxHomoP);
temp = validParameter.validFile(parameters, "signal", false); if (temp == "not found"){ temp = "0.50"; }
m->mothurConvert(temp, signal);
temp = validParameter.validFile(parameters, "noise", false); if (temp == "not found"){ temp = "0.70"; }
m->mothurConvert(temp, noise);
temp = validParameter.validFile(parameters, "bdiffs", false); if (temp == "not found"){ temp = "0"; }
m->mothurConvert(temp, bdiffs);
temp = validParameter.validFile(parameters, "pdiffs", false); if (temp == "not found"){ temp = "0"; }
m->mothurConvert(temp, pdiffs);
temp = validParameter.validFile(parameters, "ldiffs", false); if (temp == "not found") { temp = "0"; }
m->mothurConvert(temp, ldiffs);
temp = validParameter.validFile(parameters, "sdiffs", false); if (temp == "not found") { temp = "0"; }
m->mothurConvert(temp, sdiffs);
temp = validParameter.validFile(parameters, "tdiffs", false); if (temp == "not found") { int tempTotal = pdiffs + bdiffs + ldiffs + sdiffs; temp = toString(tempTotal); }
m->mothurConvert(temp, tdiffs);
if(tdiffs == 0){ tdiffs = bdiffs + pdiffs + ldiffs + sdiffs; }
temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
m->mothurConvert(temp, processors);
temp = validParameter.validFile(parameters, "order", false); if (temp == "not found"){ temp = "A"; }
if (temp.length() > 1) { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
}
else {
if (toupper(temp[0]) == 'A') { flowOrder = "A"; }
else if(toupper(temp[0]) == 'B'){
flowOrder = "B"; }
else if(toupper(temp[0]) == 'I'){
flowOrder = "I"; }
else {
m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
}
}
temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found"){ temp = "0.01"; }
m->mothurConvert(temp, cutoff);
temp = validParameter.validFile(parameters, "mindelta", false); if (temp == "not found"){ temp = "0.000001"; }
minDelta = temp;
temp = validParameter.validFile(parameters, "maxiter", false); if (temp == "not found"){ temp = "1000"; }
m->mothurConvert(temp, maxIters);
temp = validParameter.validFile(parameters, "large", false); if (temp == "not found"){ temp = "0"; }
m->mothurConvert(temp, largeSize);
if (largeSize != 0) { large = true; }
else { large = false; }
if (largeSize < 0) { m->mothurOut("The value of the large cannot be negative.\n"); }
temp = validParameter.validFile(parameters, "sigma", false);if (temp == "not found") { temp = "60"; }
m->mothurConvert(temp, sigma);
temp = validParameter.validFile(parameters, "flip", false);
if (temp == "not found") { flip = 0; }
else { flip = m->isTrue(temp); }
temp = validParameter.validFile(parameters, "maxambig", false); if (temp == "not found") { temp = "-1"; }
m->mothurConvert(temp, maxAmbig);
temp = validParameter.validFile(parameters, "minlength", false); if (temp == "not found") { temp = "0"; }
m->mothurConvert(temp, minLength);
temp = validParameter.validFile(parameters, "maxlength", false); if (temp == "not found") { temp = "0"; }
m->mothurConvert(temp, maxLength);
temp = validParameter.validFile(parameters, "keepfirst", false); if (temp == "not found") { temp = "0"; }
convert(temp, keepFirst);
temp = validParameter.validFile(parameters, "removelast", false); if (temp == "not found") { temp = "0"; }
convert(temp, removeLast);
temp = validParameter.validFile(parameters, "allfiles", false); if (temp == "not found") { temp = "F"; }
allFiles = m->isTrue(temp);
temp = validParameter.validFile(parameters, "keepforward", false); if (temp == "not found") { temp = "F"; }
keepforward = m->isTrue(temp);
temp = validParameter.validFile(parameters, "lookup", true);
if (temp == "not found") {
string path = m->argv;
string tempPath = path;
for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); }
path = path.substr(0, (tempPath.find_last_of('m')));
#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
path += "lookupFiles/";
#else
path += "lookupFiles\\";
#endif
lookupFileName = m->getFullPathName(path) + "LookUp_Titanium.pat";
bool ableToOpen = m->checkLocations(lookupFileName, inputDir);
if (!ableToOpen) { abort=true; }
}else if(temp == "not open") {
lookupFileName = validParameter.validFile(parameters, "lookup", false);
//if you can't open it its not inputDir, try mothur excutable location
string exepath = m->argv;
string tempPath = exepath;
for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); }
exepath = exepath.substr(0, (tempPath.find_last_of('m')));
string tryPath = m->getFullPathName(exepath) + m->getSimpleName(lookupFileName);
m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine();
ifstream in2;
int ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
lookupFileName = tryPath;
if (ableToOpen == 1) { m->mothurOut("Unable to open " + lookupFileName + "."); m->mothurOutEndLine(); abort=true; }
}else { lookupFileName = temp; }
}
}
catch(exception& e) {
m->errorOut(e, "SffMultipleCommand", "SffMultipleCommand");
exit(1);
}
}
//**********************************************************************************************************************
SplitGroupCommand::SplitGroupCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string, string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["fasta"] = tempOutNames;
outputTypes["name"] = tempOutNames;
outputTypes["count"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("group");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["group"] = inputDir + it->second; }
}
it = parameters.find("fasta");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
it = parameters.find("count");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["count"] = inputDir + it->second; }
}
}
namefile = validParameter.validFile(parameters, "name", true);
if (namefile == "not open") { namefile = ""; abort = true; }
else if (namefile == "not found") { namefile = ""; }
else { m->setNameFile(namefile); }
fastafile = validParameter.validFile(parameters, "fasta", true);
if (fastafile == "not open") { abort = true; }
else if (fastafile == "not found") {
fastafile = m->getFastaFile();
if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { m->setFastaFile(fastafile); }
groupfile = validParameter.validFile(parameters, "group", true);
if (groupfile == "not open") { groupfile = ""; abort = true; }
else if (groupfile == "not found") { groupfile = "";
}else { m->setGroupFile(groupfile); }
countfile = validParameter.validFile(parameters, "count", true);
if (countfile == "not open") { countfile = ""; abort = true; }
else if (countfile == "not found") { countfile = ""; }
else { m->setCountTableFile(countfile); }
if ((countfile != "") && (namefile != "")) { m->mothurOut("You must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; }
if ((countfile != "") && (groupfile != "")) { m->mothurOut("You must enter ONLY ONE of the following: count or group."); m->mothurOutEndLine(); abort = true; }
if ((countfile == "") && (groupfile == "")) {
if (namefile == "") { //check for count then group
countfile = m->getCountTableFile();
if (countfile != "") { m->mothurOut("Using " + countfile + " as input file for the count parameter."); m->mothurOutEndLine(); }
else {
groupfile = m->getGroupFile();
if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("You need to provide a count or group file."); m->mothurOutEndLine();
abort = true;
}
}
}else { //check for group
groupfile = m->getGroupFile();
if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("You need to provide a count or group file."); m->mothurOutEndLine();
abort = true;
}
}
}
groups = validParameter.validFile(parameters, "groups", false);
if (groups == "not found") { groups = ""; }
else { m->splitAtDash(groups, Groups); }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){
if (groupfile != "") { outputDir = m->hasPath(groupfile); }
else { outputDir = m->hasPath(countfile); }
}
if (countfile == "") {
if (namefile == "") {
vector<string> files; files.push_back(fastafile);
parser.getNameFile(files);
}
}
}
}
catch(exception& e) {
m->errorOut(e, "SplitGroupCommand", "SplitAbundCommand");
exit(1);
}
}
//**********************************************************************************************************************
RareFactCommand::RareFactCommand(string option) {
try {
abort = false; calledHelp = false;
allLines = 1;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
map<string,string>::iterator it;
ValidParameters validParameter;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["rarefaction"] = tempOutNames;
outputTypes["r_chao"] = tempOutNames;
outputTypes["r_ace"] = tempOutNames;
outputTypes["r_jack"] = tempOutNames;
outputTypes["r_shannon"] = tempOutNames;
outputTypes["r_shannoneven"] = tempOutNames;
outputTypes["r_shannonrange"] = tempOutNames;
outputTypes["r_heip"] = tempOutNames;
outputTypes["r_smithwilson"] = tempOutNames;
outputTypes["r_npshannon"] = tempOutNames;
outputTypes["r_simpson"] = tempOutNames;
outputTypes["r_simpsoneven"] = tempOutNames;
outputTypes["r_invsimpson"] = tempOutNames;
outputTypes["r_bootstrap"] = tempOutNames;
outputTypes["r_coverage"] = tempOutNames;
outputTypes["r_nseqs"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("shared");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["shared"] = inputDir + it->second; }
}
it = parameters.find("rabund");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["rabund"] = inputDir + it->second; }
}
it = parameters.find("sabund");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["sabund"] = inputDir + it->second; }
}
it = parameters.find("list");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["list"] = inputDir + it->second; }
}
}
//check for required parameters
listfile = validParameter.validFile(parameters, "list", true);
if (listfile == "not open") { listfile = ""; abort = true; }
else if (listfile == "not found") { listfile = ""; }
else { format = "list"; inputfile = listfile; m->setListFile(listfile); }
sabundfile = validParameter.validFile(parameters, "sabund", true);
if (sabundfile == "not open") { sabundfile = ""; abort = true; }
else if (sabundfile == "not found") { sabundfile = ""; }
else { format = "sabund"; inputfile = sabundfile; m->setSabundFile(sabundfile); }
rabundfile = validParameter.validFile(parameters, "rabund", true);
if (rabundfile == "not open") { rabundfile = ""; abort = true; }
else if (rabundfile == "not found") { rabundfile = ""; }
else { format = "rabund"; inputfile = rabundfile; m->setRabundFile(rabundfile); }
sharedfile = validParameter.validFile(parameters, "shared", true);
if (sharedfile == "not open") { sharedfile = ""; abort = true; }
else if (sharedfile == "not found") { sharedfile = ""; }
else { format = "sharedfile"; inputfile = sharedfile; m->setSharedFile(sharedfile); }
if ((sharedfile == "") && (listfile == "") && (rabundfile == "") && (sabundfile == "")) {
//is there are current file available for any of these?
//give priority to shared, then list, then rabund, then sabund
//if there is a current shared file, use it
sharedfile = m->getSharedFile();
if (sharedfile != "") { inputfile = sharedfile; format = "sharedfile"; m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); }
else {
listfile = m->getListFile();
if (listfile != "") { inputfile = listfile; format = "list"; m->mothurOut("Using " + listfile + " as input file for the list parameter."); m->mothurOutEndLine(); }
else {
rabundfile = m->getRabundFile();
if (rabundfile != "") { inputfile = rabundfile; format = "rabund"; m->mothurOut("Using " + rabundfile + " as input file for the rabund parameter."); m->mothurOutEndLine(); }
else {
sabundfile = m->getSabundFile();
if (sabundfile != "") { inputfile = sabundfile; format = "sabund"; m->mothurOut("Using " + sabundfile + " as input file for the sabund parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("No valid current files. You must provide a list, sabund, rabund or shared file before you can use the collect.single command."); m->mothurOutEndLine();
abort = true;
}
}
}
}
}
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = m->hasPath(inputfile); }
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
label = validParameter.validFile(parameters, "label", false);
if (label == "not found") { label = ""; }
else {
if(label != "all") { m->splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
calc = validParameter.validFile(parameters, "calc", false);
if (calc == "not found") { calc = "sobs"; }
else {
if (calc == "default") { calc = "sobs"; }
}
m->splitAtDash(calc, Estimators);
if (m->inUsersGroups("citation", Estimators)) {
ValidCalculators validCalc; validCalc.printCitations(Estimators);
//remove citation from list of calcs
for (int i = 0; i < Estimators.size(); i++) { if (Estimators[i] == "citation") { Estimators.erase(Estimators.begin()+i); break; } }
}
string temp;
temp = validParameter.validFile(parameters, "freq", false); if (temp == "not found") { temp = "100"; }
m->mothurConvert(temp, freq);
temp = validParameter.validFile(parameters, "abund", false); if (temp == "not found") { temp = "10"; }
m->mothurConvert(temp, abund);
temp = validParameter.validFile(parameters, "iters", false); if (temp == "not found") { temp = "1000"; }
m->mothurConvert(temp, nIters);
temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
m->mothurConvert(temp, processors);
temp = validParameter.validFile(parameters, "alpha", false); if (temp == "not found") { temp = "1"; }
m->mothurConvert(temp, alpha);
if ((alpha != 0) && (alpha != 1) && (alpha != 2)) { m->mothurOut("[ERROR]: Not a valid alpha value. Valid values are 0, 1 and 2."); m->mothurOutEndLine(); abort=true; }
temp = validParameter.validFile(parameters, "groupmode", false); if (temp == "not found") { temp = "T"; }
groupMode = m->isTrue(temp);
}
}
catch(exception& e) {
m->errorOut(e, "RareFactCommand", "RareFactCommand");
exit(1);
}
}
MergeGroupsCommand::MergeGroupsCommand(string option) {
try {
abort = false; calledHelp = false;
allLines = 1;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
//check to make sure all parameters are valid for command
map<string,string>::iterator it;
for (it = parameters.begin(); it != parameters.end(); it++) {
if (!validParameter.isValidParameter(it->first, myArray, it->second)) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["shared"] = tempOutNames;
outputTypes["group"] = tempOutNames;
outputTypes["count"] = tempOutNames;
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){ outputDir = ""; }
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.valid(parameters, "inputdir");
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("design");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["design"] = inputDir + it->second; }
}
it = parameters.find("shared");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["shared"] = inputDir + it->second; }
}
it = parameters.find("group");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["group"] = inputDir + it->second; }
}
it = parameters.find("count");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["count"] = inputDir + it->second; }
}
it = parameters.find("fasta");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
}
//check for required parameters
designfile = validParameter.validFile(parameters, "design");
if (designfile == "not open") { abort = true; }
else if (designfile == "not found") {
//if there is a current shared file, use it
designfile = current->getDesignFile();
if (designfile != "") { m->mothurOut("Using " + designfile + " as input file for the design parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current designfile and the design parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { current->setDesignFile(designfile); }
sharedfile = validParameter.validFile(parameters, "shared");
if (sharedfile == "not open") { abort = true; sharedfile = ""; }
else if (sharedfile == "not found") { sharedfile = ""; }
else { current->setSharedFile(sharedfile); }
groupfile = validParameter.validFile(parameters, "group");
if (groupfile == "not open") { abort = true; groupfile = ""; }
else if (groupfile == "not found") { groupfile = ""; }
else { current->setGroupFile(groupfile); }
countfile = validParameter.validFile(parameters, "count");
if (countfile == "not open") { abort = true; countfile = ""; }
else if (countfile == "not found") { countfile = ""; }
else { current->setCountFile(countfile); }
fastafile = validParameter.validFile(parameters, "fasta");
if (fastafile == "not open") { abort = true; countfile = ""; }
else if (fastafile == "not found") { fastafile = ""; }
else { current->setFastaFile(fastafile); }
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
label = validParameter.valid(parameters, "label");
if (label == "not found") { label = ""; }
else {
if(label != "all") { util.splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
groups = validParameter.valid(parameters, "groups");
if (groups == "not found") { groups = "all"; }
util.splitAtDash(groups, Groups);
if (Groups.size() != 0) { if (Groups[0]== "all") { Groups.clear(); } }
method = validParameter.valid(parameters, "method"); if(method == "not found"){ method = "sum"; }
if ((method != "sum") && (method != "average") && (method != "median")) { m->mothurOut(method + " is not a valid method. Options are sum, average and median. I will use sum."); m->mothurOutEndLine(); method = "sum"; }
if ((groupfile != "") && (countfile != "")) {
m->mothurOut("[ERROR]: you may only use one of the following: group or count."); m->mothurOutEndLine(); abort=true;
}
if ((sharedfile == "") && (groupfile == "") && (countfile == "")) {
//give priority to group, then shared
groupfile = current->getGroupFile();
if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); }
else {
sharedfile = current->getSharedFile();
if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); }
else {
countfile = current->getCountFile();
if (countfile != "") { m->mothurOut("Using " + countfile + " as input file for the count parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("You have no current groupfile, countfile or sharedfile and one is required."); m->mothurOutEndLine(); abort = true;
}
}
}
}
if ((countfile == "") && (fastafile != "")) { m->mothurOut("[ERROR]: You may only use the fasta file with the count file, quitting."); m->mothurOutEndLine(); abort=true; }
else if ((countfile != "") && (method == "average")) { m->mothurOut("You may not use the average method with the count file. I will use the sum method."); m->mothurOutEndLine(); method = "sum"; }
else if ((countfile != "") && (method == "median") && (fastafile == "")) {
fastafile = current->getFastaFile();
if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("[ERROR]: Fasta file is required with the median method and a count file so that sequences removed from your count table can also be removed from your fasta file to avoid downstream file mismatches, quitting.\n"); abort=true;
}
}
}
}
catch(exception& e) {
m->errorOut(e, "MergeGroupsCommand", "MergeGroupsCommand");
exit(1);
}
}
PreClusterCommand::PreClusterCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string, string>::iterator it;
//check to make sure all parameters are valid for command
for (map<string, string>::iterator it2 = parameters.begin(); it2 != parameters.end(); it2++) {
if (validParameter.isValidParameter(it2->first, myArray, it2->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["fasta"] = tempOutNames;
outputTypes["name"] = tempOutNames;
outputTypes["map"] = tempOutNames;
outputTypes["count"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("fasta");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
it = parameters.find("group");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["group"] = inputDir + it->second; }
}
it = parameters.find("count");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["count"] = inputDir + it->second; }
}
}
//check for required parameters
fastafile = validParameter.validFile(parameters, "fasta", true);
if (fastafile == "not found") {
fastafile = m->getFastaFile();
if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; }
}
else if (fastafile == "not open") { abort = true; }
else { m->setFastaFile(fastafile); }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){
outputDir = "";
outputDir += m->hasPath(fastafile); //if user entered a file with a path then preserve it
}
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
namefile = validParameter.validFile(parameters, "name", true);
if (namefile == "not found") { namefile = ""; }
else if (namefile == "not open") { namefile = ""; abort = true; }
else { m->setNameFile(namefile); }
groupfile = validParameter.validFile(parameters, "group", true);
if (groupfile == "not found") { groupfile = ""; bygroup = false; }
else if (groupfile == "not open") { abort = true; groupfile = ""; }
else { m->setGroupFile(groupfile); bygroup = true; }
countfile = validParameter.validFile(parameters, "count", true);
if (countfile == "not found") { countfile = ""; }
else if (countfile == "not open") { abort = true; countfile = ""; }
else {
m->setCountTableFile(countfile);
ct.readTable(countfile, true, false);
if (ct.hasGroupInfo()) { bygroup = true; }
else { bygroup = false; }
}
if ((namefile != "") && (countfile != "")) {
m->mothurOut("[ERROR]: you may only use one of the following: name or count."); m->mothurOutEndLine(); abort = true;
}
if ((groupfile != "") && (countfile != "")) {
m->mothurOut("[ERROR]: you may only use one of the following: group or count."); m->mothurOutEndLine(); abort=true;
}
string temp = validParameter.validFile(parameters, "diffs", false); if(temp == "not found"){ temp = "1"; }
m->mothurConvert(temp, diffs);
temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
m->mothurConvert(temp, processors);
temp = validParameter.validFile(parameters, "topdown", false); if(temp == "not found"){ temp = "T"; }
topdown = m->isTrue(temp);
temp = validParameter.validFile(parameters, "match", false); if (temp == "not found"){ temp = "1.0"; }
m->mothurConvert(temp, match);
temp = validParameter.validFile(parameters, "mismatch", false); if (temp == "not found"){ temp = "-1.0"; }
m->mothurConvert(temp, misMatch);
if (misMatch > 0) { m->mothurOut("[ERROR]: mismatch must be negative.\n"); abort=true; }
temp = validParameter.validFile(parameters, "gapopen", false); if (temp == "not found"){ temp = "-2.0"; }
m->mothurConvert(temp, gapOpen);
if (gapOpen > 0) { m->mothurOut("[ERROR]: gapopen must be negative.\n"); abort=true; }
temp = validParameter.validFile(parameters, "gapextend", false); if (temp == "not found"){ temp = "-1.0"; }
m->mothurConvert(temp, gapExtend);
if (gapExtend > 0) { m->mothurOut("[ERROR]: gapextend must be negative.\n"); abort=true; }
align = validParameter.validFile(parameters, "align", false); if (align == "not found"){ align = "needleman"; }
method = "unaligned";
if (countfile == "") {
if (namefile == "") {
vector<string> files; files.push_back(fastafile);
parser.getNameFile(files);
}
}
}
}
catch(exception& e) {
m->errorOut(e, "PreClusterCommand", "PreClusterCommand");
exit(1);
}
}
//**********************************************************************************************************************
NewCommand::NewCommand(string option) {
try {
////////////////////////////////////////////////////////
/////////////////// start leave alone block ////////////
////////////////////////////////////////////////////////
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
//valid paramters for this command
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string,string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (!validParameter.isValidParameter(it->first, myArray, it->second)) { abort = true; }
}
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.valid(parameters, "inputdir");
if (inputDir == "not found"){ inputDir = ""; }
else {
///////////////////////////////////////////////////////////////
//////////////// stop leave alone block ///////////////////////
///////////////////////////////////////////////////////////////
//edit file types below to include only the types you added as parameters
string path;
it = parameters.find("phylip");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["phylip"] = inputDir + it->second; }
}
it = parameters.find("column");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["column"] = inputDir + it->second; }
}
it = parameters.find("fasta");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
it = parameters.find("shared");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["shared"] = inputDir + it->second; }
}
}
///////////////////////////////////////////////////////////////////////////////
/////////// example of getting filenames and checking dependancies ////////////
// the validParameter class will make sure file exists, fill with correct //
// and name is current is given ///////////////////////////////////////////////
///////////////////////////////////////////////////////////////////////////////
///variables for examples below that you will most likely want to put in the header for
//use by the other class functions.
string phylipfile, columnfile, namefile, fastafile, sharedfile, method, countfile;
int processors;
bool useTiming, allLines;
vector<string> Estimators, Groups;
set<string> labels;
//if allLines is used it should be initialized to 1 above.
//check for parameters
phylipfile = validParameter.validFile(parameters, "phylip");
if (phylipfile == "not open") { phylipfile = ""; abort = true; }
else if (phylipfile == "not found") { phylipfile = ""; }
else { current->setPhylipFile(phylipfile); }
columnfile = validParameter.validFile(parameters, "column");
if (columnfile == "not open") { columnfile = ""; abort = true; }
else if (columnfile == "not found") { columnfile = ""; }
else { current->setColumnFile(columnfile); }
namefile = validParameter.validFile(parameters, "name");
if (namefile == "not open") { abort = true; }
else if (namefile == "not found") { namefile = ""; }
else { current->setNameFile(namefile); }
//get fastafile - it is not required
fastafile = validParameter.validFile(parameters, "fasta");
if (fastafile == "not open") { fastafile = ""; abort=true; }
else if (fastafile == "not found") { fastafile = ""; }
if (fastafile != "") { current->setFastaFile(fastafile); }
if ((phylipfile == "") && (columnfile == "")) {
//is there are current file available for either of these?
//give priority to column, then phylip
columnfile = current->getColumnFile();
if (columnfile != "") { m->mothurOut("Using " + columnfile + " as input file for the column parameter."); m->mothurOutEndLine(); }
else {
phylipfile = current->getPhylipFile();
if (phylipfile != "") { m->mothurOut("Using " + phylipfile + " as input file for the phylip parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("No valid current files. You must provide a phylip or column file before you can use the cluster command."); m->mothurOutEndLine();
abort = true;
}
}
}
else if ((phylipfile != "") && (columnfile != "")) { m->mothurOut("When executing a cluster command you must enter ONLY ONE of the following: phylip or column."); m->mothurOutEndLine(); abort = true; }
if (columnfile != "") {
if (namefile == "") {
namefile = current->getNameFile();
if (namefile != "") { m->mothurOut("Using " + namefile + " as input file for the name parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("You need to provide a namefile if you are going to use the column format."); m->mothurOutEndLine();
abort = true;
}
}
}
//get shared file, it is required
sharedfile = validParameter.validFile(parameters, "shared");
if (sharedfile == "not open") { sharedfile = ""; abort = true; }
else if (sharedfile == "not found") {
//if there is a current shared file, use it
sharedfile = current->getSharedFile();
if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current sharedfile and the shared parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { current->setSharedFile(sharedfile); }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){
outputDir = util.hasPath(sharedfile); //if user entered a file with a path then preserve it
}
//////////////////////////////////////////////////////////////////////
////////// example of getting other types of parameters //////////////
//////////////////////////////////////////////////////////////////////
//use only one Mutliple type
method = validParameter.valid(parameters, "method");
if (method == "not found") { method = "average"; }
if ((method == "furthest") || (method == "nearest") || (method == "average") || (method == "weighted")) { }
else { m->mothurOut("Not a valid clustering method. Valid clustering algorithms are furthest, nearest, average, and weighted."); m->mothurOutEndLine(); abort = true; }
//use more than one multiple type. do not check to make sure the entry is valid.
string calc = validParameter.valid(parameters, "calc");
if (calc == "not found") { calc = "sobs-chao-ace-jack-shannon-npshannon-simpson"; }
else {
if (calc == "default") { calc = "sobs-chao-ace-jack-shannon-npshannon-simpson"; }
}
util.splitAtDash(calc, Estimators);
//Boolean type - m->isTrue looks for t, true, f or false and is case insensitive
string timing = validParameter.valid(parameters, "timing");
if (timing == "not found") { timing = "F"; }
useTiming = util.isTrue(timing);
//Number type - mothurConvert makes sure the convert can happen to avoid a crash.
string temp = validParameter.valid(parameters, "processors"); if (temp == "not found"){ temp = current->getProcessors(); }
processors = current->setProcessors(temp);
//Groups must be checked later to make sure they are valid. SharedUtilities has functions of check the validity, just make to so m->setGroups() after the checks. If you are using these with a shared file no need to check the SharedRAbundVector class will call SharedUtilites for you, kinda nice, huh?
string groups = validParameter.valid(parameters, "groups");
if (groups == "not found") { groups = ""; }
else {
util.splitAtDash(groups, Groups);
if (Groups.size() != 0) { if (Groups[0]== "all") { Groups.clear(); } }
}
//Commonly used to process list, rabund, sabund, shared and relabund files. Look at "smart distancing" examples below in the execute function.
string label = validParameter.valid(parameters, "label");
if (label == "not found") { label = ""; }
else {
if(label != "all") { util.splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
//if your command has a namefile as an option, you may want ot check to see if there is a current namefile
//saved by mothur that is associated with the other files you are using as inputs.
//You can do so by adding the files associated with the namefile to the files vector and then asking parser to check.
//This saves our users headaches over file mismatches because they forgot to include the namefile, :)
if (countfile == "") {
if (namefile == "") {
vector<string> files; files.push_back(fastafile);
if (!current->getMothurCalling()) { parser.getNameFile(files); }
}
}
}
}
catch(exception& e) {
m->errorOut(e, "NewCommand", "NewCommand");
exit(1);
}
}
//**********************************************************************************************************************
ClassifyOtuCommand::ClassifyOtuCommand(string option) {
try{
abort = false; calledHelp = false;
allLines = 1;
labels.clear();
//allow user to run help
if (option == "help") {
help(); abort = true; calledHelp = true;
}else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string, string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["constaxonomy"] = tempOutNames;
outputTypes["taxsummary"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("list");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["list"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
it = parameters.find("taxonomy");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["taxonomy"] = inputDir + it->second; }
}
it = parameters.find("reftaxonomy");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["reftaxonomy"] = inputDir + it->second; }
}
it = parameters.find("group");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["group"] = inputDir + it->second; }
}
it = parameters.find("count");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["count"] = inputDir + it->second; }
}
}
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
//check for required parameters
listfile = validParameter.validFile(parameters, "list", true);
if (listfile == "not found") {
//if there is a current list file, use it
listfile = m->getListFile();
if (listfile != "") { m->mothurOut("Using " + listfile + " as input file for the list parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current listfile and the list parameter is required."); m->mothurOutEndLine(); abort = true; }
}
else if (listfile == "not open") { abort = true; }
else { m->setListFile(listfile); }
taxfile = validParameter.validFile(parameters, "taxonomy", true);
if (taxfile == "not found") { //if there is a current list file, use it
taxfile = m->getTaxonomyFile();
if (taxfile != "") { m->mothurOut("Using " + taxfile + " as input file for the taxonomy parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current taxonomy file and the taxonomy parameter is required."); m->mothurOutEndLine(); abort = true; }
}
else if (taxfile == "not open") { abort = true; }
else { m->setTaxonomyFile(taxfile); }
refTaxonomy = validParameter.validFile(parameters, "reftaxonomy", true);
if (refTaxonomy == "not found") { refTaxonomy = ""; m->mothurOut("reftaxonomy is not required, but if given will keep the rankIDs in the summary file static."); m->mothurOutEndLine(); }
else if (refTaxonomy == "not open") { abort = true; }
namefile = validParameter.validFile(parameters, "name", true);
if (namefile == "not open") { namefile = ""; abort = true; }
else if (namefile == "not found") { namefile = ""; }
else { m->setNameFile(namefile); }
groupfile = validParameter.validFile(parameters, "group", true);
if (groupfile == "not open") { abort = true; }
else if (groupfile == "not found") { groupfile = ""; }
else { m->setGroupFile(groupfile); }
countfile = validParameter.validFile(parameters, "count", true);
if (countfile == "not open") { countfile = ""; abort = true; }
else if (countfile == "not found") { countfile = ""; }
else { m->setCountTableFile(countfile); }
if ((namefile != "") && (countfile != "")) {
m->mothurOut("[ERROR]: you may only use one of the following: name or count."); m->mothurOutEndLine(); abort = true;
}
if ((groupfile != "") && (countfile != "")) {
m->mothurOut("[ERROR]: you may only use one of the following: group or count."); m->mothurOutEndLine(); abort=true;
}
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
label = validParameter.validFile(parameters, "label", false);
if (label == "not found") { label = ""; allLines = 1; }
else {
if(label != "all") { m->splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
basis = validParameter.validFile(parameters, "basis", false);
if (basis == "not found") { basis = "otu"; }
if ((basis != "otu") && (basis != "sequence")) { m->mothurOut("Invalid option for basis. basis options are otu and sequence, using otu."); m->mothurOutEndLine(); }
string temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found") { temp = "51"; }
m->mothurConvert(temp, cutoff);
temp = validParameter.validFile(parameters, "probs", false); if (temp == "not found"){ temp = "true"; }
probs = m->isTrue(temp);
temp = validParameter.validFile(parameters, "persample", false); if (temp == "not found"){ temp = "f"; }
persample = m->isTrue(temp);
if ((groupfile == "") && (countfile == "")) { if (persample) { m->mothurOut("persample is only valid with a group file, or count file with group information. Setting persample=f.\n"); persample = false; }
}
if (countfile != "") {
CountTable cts;
if (!cts.testGroups(countfile)) {
if (persample) { m->mothurOut("persample is only valid with a group file, or count file with group information. Setting persample=f.\n"); persample = false; }
}
}
if ((cutoff < 51) || (cutoff > 100)) { m->mothurOut("cutoff must be above 50, and no greater than 100."); m->mothurOutEndLine(); abort = true; }
if (countfile == "") {
if (namefile == ""){
vector<string> files; files.push_back(taxfile);
parser.getNameFile(files);
}
}
}
}
catch(exception& e) {
m->errorOut(e, "ClassifyOtuCommand", "ClassifyOtuCommand");
exit(1);
}
}
//***************************************************************************************************************
DegapSeqsCommand::DegapSeqsCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string,string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (!validParameter.isValidParameter(it->first, myArray, it->second)) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["fasta"] = tempOutNames;
string inputDir = validParameter.valid(parameters, "inputdir");
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("fasta");
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
}
fastafile = validParameter.validFile(parameters, "fasta");
if (fastafile == "not found") {
fastafile = current->getFastaFile();
if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter.\n"); }
else { m->mothurOut("[ERROR]: You have no current fasta file and the fasta parameter is required.\n"); abort = true; }
}
else if (fastafile == "not open") { abort = true; }
else { current->setFastaFile(fastafile); }
string temp = validParameter.valid(parameters, "processors"); if (temp == "not found"){ temp = current->getProcessors(); }
processors = current->setProcessors(temp);
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){
outputDir = "";
outputDir += util.hasPath(fastafile); //if user entered a file with a path then preserve it
}
}
}
catch(exception& e) {
m->errorOut(e, "DegapSeqsCommand", "DegapSeqsCommand");
exit(1);
}
}
//**********************************************************************************************************************
GetSAbundCommand::GetSAbundCommand(string option) {
try {
abort = false; calledHelp = false;
allLines = 1;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
map<string,string>::iterator it;
ValidParameters validParameter;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["sabund"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("list");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["list"] = inputDir + it->second; }
}
it = parameters.find("rabund");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["rabund"] = inputDir + it->second; }
}
}
//check for required parameters
listfile = validParameter.validFile(parameters, "list", true);
if (listfile == "not open") { listfile = ""; abort = true; }
else if (listfile == "not found") { listfile = ""; }
else { format = "list"; inputfile = listfile; m->setListFile(listfile); }
rabundfile = validParameter.validFile(parameters, "rabund", true);
if (rabundfile == "not open") { rabundfile = ""; abort = true; }
else if (rabundfile == "not found") { rabundfile = ""; }
else { format = "rabund"; inputfile = rabundfile; m->setRabundFile(rabundfile); }
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
label = validParameter.validFile(parameters, "label", false);
if (label == "not found") { label = ""; }
else {
if(label != "all") { m->splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
if ((listfile == "") && (rabundfile == "")) {
//is there are current file available for any of these?
//give priority to shared, then list, then rabund, then sabund
//if there is a current shared file, use it
listfile = m->getListFile();
if (listfile != "") { inputfile = listfile; format = "list"; m->mothurOut("Using " + listfile + " as input file for the list parameter."); m->mothurOutEndLine(); }
else {
rabundfile = m->getRabundFile();
if (rabundfile != "") { inputfile = rabundfile; format = "rabund"; m->mothurOut("Using " + rabundfile + " as input file for the rabund parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("No valid current files. You must provide a list or rabund file."); m->mothurOutEndLine();
abort = true;
}
}
}
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = m->hasPath(inputfile); }
}
}
catch(exception& e) {
m->errorOut(e, "GetSAbundCommand", "GetSAbundCommand");
exit(1);
}
}
DeconvoluteCommand::DeconvoluteCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string, string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (!validParameter.isValidParameter(it->first, myArray, it->second)) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["fasta"] = tempOutNames;
outputTypes["name"] = tempOutNames;
outputTypes["count"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.valid(parameters, "inputdir");
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("fasta");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
it = parameters.find("count");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["count"] = inputDir + it->second; }
}
}
//check for required parameters
fastafile = validParameter.validFile(parameters, "fasta");
if (fastafile == "not open") { abort = true; }
else if (fastafile == "not found") {
fastafile = current->getFastaFile();
if (fastafile != "") { m->mothurOut("Using " + fastafile + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { current->setFastaFile(fastafile); }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){
outputDir = "";
outputDir += util.hasPath(fastafile); //if user entered a file with a path then preserve it
}
namefile = validParameter.validFile(parameters, "name");
if (namefile == "not open") { namefile = ""; abort = true; }
else if (namefile == "not found"){ namefile = ""; }
else { current->setNameFile(namefile); }
countfile = validParameter.validFile(parameters, "count");
if (countfile == "not open") { abort = true; countfile = ""; }
else if (countfile == "not found") { countfile = ""; }
else { current->setCountFile(countfile); }
if ((countfile != "") && (namefile != "")) { m->mothurOut("When executing a unique.seqs command you must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; }
format = validParameter.valid(parameters, "format");
if(format == "not found"){
if (countfile != "") { format = "count"; }
else { format = "name"; }
}
if ((format != "name") && (format != "count")) {
m->mothurOut(format + " is not a valid format option. Options are count or name.");
if (countfile == "") { m->mothurOut("I will use name.\n"); format = "name"; }
else { m->mothurOut("I will use count.\n"); format = "count"; }
}
if (countfile == "") {
if (namefile == "") {
vector<string> files; files.push_back(fastafile);
if (!current->getMothurCalling()) { parser.getNameFile(files); }
}
}
}
}
catch(exception& e) {
m->errorOut(e, "DeconvoluteCommand", "DeconvoluteCommand");
exit(1);
}
}
bool PipelineCommand::checkForValidAndRequiredParameters(string name, string options, map<string, vector<string> >& mothurMadeFiles){
try {
if (name == "system") { return false; }
//get shell of the command so we can check to make sure its valid without running it
Command* command = cFactory->getCommand(name);
//check to make sure all parameters are valid for command
vector<string> validParameters = command->setParameters();
OptionParser parser(options);
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string, string>::iterator it;
map<string, vector<string> >::iterator itMade;
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, validParameters, it->second) != true) { return true; } // not valid
if (it->second == "current") {
itMade = mothurMadeFiles.find(it->first);
if (itMade == mothurMadeFiles.end()) {
m->mothurOut("You have the " + it->first + " listed as a current file for the " + name + " command, but it seems mothur will not make that file in your current pipeline, please correct."); m->mothurOutEndLine();
return true;
}
}
}
//is the command missing any required
vector<CommandParameter> commandParameters = command->getParameters();
vector<string> requiredParameters;
for (int i = 0; i < commandParameters.size(); i++) {
if (commandParameters[i].required) {
requiredParameters.push_back(commandParameters[i].name);
}
}
for (int i = 0; i < requiredParameters.size(); i++) {
it = parameters.find(requiredParameters[i]);
if (it == parameters.end()) {
string paraToLookFor = requiredParameters[i];
//does mothur have a current file for this?
itMade = mothurMadeFiles.find(requiredParameters[i]);
if (itMade == mothurMadeFiles.end()) {
m->mothurOut(name + " requires the " + requiredParameters[i] + " parameter, please correct."); m->mothurOutEndLine();
}
}
}
//update MothurMade
map<string, vector<string> > thisCommandsFile = command->getOutputFiles();
for (itMade = thisCommandsFile.begin(); itMade != thisCommandsFile.end(); itMade++) {
mothurMadeFiles[itMade->first] = itMade->second; //adds any new types
}
return false;
}
catch(exception& e) {
m->errorOut(e, "PipelineCommand", "checkForValidAndRequiredParameters");
exit(1);
}
}
RenameSeqsCommand::RenameSeqsCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string, string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
vector<string> tempOutNames;
outputTypes["fasta"] = tempOutNames;
outputTypes["name"] = tempOutNames;
outputTypes["group"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("fasta");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["fasta"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
it = parameters.find("group");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["group"] = inputDir + it->second; }
}
}
//check for required parameters
fastaFile = validParameter.validFile(parameters, "fasta", true);
if (fastaFile == "not open") { abort = true; }
else if (fastaFile == "not found") {
fastaFile = m->getFastaFile();
if (fastaFile != "") { m->mothurOut("Using " + fastaFile + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { m->setFastaFile(fastaFile); }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){
outputDir = "";
outputDir += m->hasPath(fastaFile); //if user entered a file with a path then preserve it
}
groupfile = validParameter.validFile(parameters, "group", true);
if (groupfile == "not open") { abort = true; }
else if (groupfile == "not found") {
groupfile = m->getGroupFile();
if (groupfile != "") { m->mothurOut("Using " + groupfile + " as input file for the group parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current groupfile and the group parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { m->setGroupFile(groupfile); }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
nameFile = validParameter.validFile(parameters, "name", true);
if (nameFile == "not open") { abort = true; }
else if (nameFile == "not found"){ nameFile =""; }
else { m->setNameFile(nameFile); }
if (nameFile == "") {
vector<string> files; files.push_back(fastaFile);
parser.getNameFile(files);
}
}
}
catch(exception& e) {
m->errorOut(e, "RenameSeqsCommand", "RenameSeqsCommand");
exit(1);
}
}
MetaStatsCommand::MetaStatsCommand(string option) {
try {
abort = false; calledHelp = false;
allLines = 1;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
//check to make sure all parameters are valid for command
map<string,string>::iterator it;
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["metastats"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("design");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["design"] = inputDir + it->second; }
}
it = parameters.find("shared");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["shared"] = inputDir + it->second; }
}
}
//check for required parameters
sharedfile = validParameter.validFile(parameters, "shared", true);
if (sharedfile == "not open") { abort = true; }
else if (sharedfile == "not found") { //if there is a current shared file, use it
sharedfile = m->getSharedFile();
if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current sharedfile and the shared parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { m->setSharedFile(sharedfile); }
//check for required parameters
designfile = validParameter.validFile(parameters, "design", true);
if (designfile == "not open") { abort = true; }
else if (designfile == "not found") {
//if there is a current design file, use it
designfile = m->getDesignFile();
if (designfile != "") { m->mothurOut("Using " + designfile + " as input file for the design parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current designfile and the design parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { m->setDesignFile(designfile); }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){
outputDir = "";
outputDir += m->hasPath(sharedfile); //if user entered a file with a path then preserve it
}
//check for optional parameter and set defaults
// ...at some point should added some additional type checking...
label = validParameter.validFile(parameters, "label", false);
if (label == "not found") { label = ""; }
else {
if(label != "all") { m->splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
groups = validParameter.validFile(parameters, "groups", false);
if (groups == "not found") { groups = ""; pickedGroups = false; }
else {
pickedGroups = true;
m->splitAtDash(groups, Groups);
m->setGroups(Groups);
}
sets = validParameter.validFile(parameters, "sets", false);
if (sets == "not found") { sets = ""; }
else {
m->splitAtDash(sets, Sets);
}
string temp = validParameter.validFile(parameters, "iters", false); if (temp == "not found") { temp = "1000"; }
m->mothurConvert(temp, iters);
temp = validParameter.validFile(parameters, "threshold", false); if (temp == "not found") { temp = "0.05"; }
m->mothurConvert(temp, threshold);
temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
m->mothurConvert(temp, processors);
}
}
catch(exception& e) {
m->errorOut(e, "MetaStatsCommand", "MetaStatsCommand");
exit(1);
}
}
//**********************************************************************************************************************
CollectSharedCommand::CollectSharedCommand(string option) {
try {
abort = false; calledHelp = false;
allLines = 1;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters=parser.getParameters();
map<string,string>::iterator it;
ValidParameters validParameter;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["sharedchao"] = tempOutNames;
outputTypes["sharedsobs"] = tempOutNames;
outputTypes["sharedace"] = tempOutNames;
outputTypes["jabund"] = tempOutNames;
outputTypes["sorabund"] = tempOutNames;
outputTypes["jclass"] = tempOutNames;
outputTypes["sorclass"] = tempOutNames;
outputTypes["jest"] = tempOutNames;
outputTypes["sorest"] = tempOutNames;
outputTypes["thetayc"] = tempOutNames;
outputTypes["thetan"] = tempOutNames;
outputTypes["kstest"] = tempOutNames;
outputTypes["whittaker"] = tempOutNames;
outputTypes["sharednseqs"] = tempOutNames;
outputTypes["ochiai"] = tempOutNames;
outputTypes["anderberg"] = tempOutNames;
outputTypes["kulczynski"] = tempOutNames;
outputTypes["kulczynskicody"] = tempOutNames;
outputTypes["lennon"] = tempOutNames;
outputTypes["morisitahorn"] = tempOutNames;
outputTypes["braycurtis"] = tempOutNames;
outputTypes["odum"] = tempOutNames;
outputTypes["canberra"] = tempOutNames;
outputTypes["structeuclidean"] = tempOutNames;
outputTypes["structchord"] = tempOutNames;
outputTypes["hellinger"] = tempOutNames;
outputTypes["manhattan"] = tempOutNames;
outputTypes["structpearson"] = tempOutNames;
outputTypes["soergel"] = tempOutNames;
outputTypes["spearman"] = tempOutNames;
outputTypes["structkulczynski"] = tempOutNames;
outputTypes["speciesprofile"] = tempOutNames;
outputTypes["structchi2"] = tempOutNames;
outputTypes["hamming"] = tempOutNames;
outputTypes["gower"] = tempOutNames;
outputTypes["memchi2"] = tempOutNames;
outputTypes["memchord"] = tempOutNames;
outputTypes["memeuclidean"] = tempOutNames;
outputTypes["mempearson"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("shared");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["shared"] = inputDir + it->second; }
}
}
//get shared file
sharedfile = validParameter.validFile(parameters, "shared", true);
if (sharedfile == "not open") { sharedfile = ""; abort = true; }
else if (sharedfile == "not found") {
//if there is a current shared file, use it
sharedfile = m->getSharedFile();
if (sharedfile != "") { m->mothurOut("Using " + sharedfile + " as input file for the shared parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current sharedfile and the shared parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { m->setSharedFile(sharedfile); }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = m->hasPath(sharedfile); }
//check for optional parameter and set defaults
// ...at some point should added some additional type checking..
label = validParameter.validFile(parameters, "label", false);
if (label == "not found") { label = ""; }
else {
if(label != "all") { m->splitAtDash(label, labels); allLines = 0; }
else { allLines = 1; }
}
calc = validParameter.validFile(parameters, "calc", false);
if (calc == "not found") { calc = "sharedsobs-sharedchao-sharedace-jabund-sorabund-jclass-sorclass-jest-sorest-thetayc-thetan"; }
else {
if (calc == "default") { calc = "sharedsobs-sharedchao-sharedace-jabund-sorabund-jclass-sorclass-jest-sorest-thetayc-thetan"; }
}
m->splitAtDash(calc, Estimators);
if (m->inUsersGroups("citation", Estimators)) {
ValidCalculators validCalc; validCalc.printCitations(Estimators);
//remove citation from list of calcs
for (int i = 0; i < Estimators.size(); i++) { if (Estimators[i] == "citation") { Estimators.erase(Estimators.begin()+i); break; } }
}
groups = validParameter.validFile(parameters, "groups", false);
if (groups == "not found") { groups = ""; }
else {
m->splitAtDash(groups, Groups);
}
m->setGroups(Groups);
string temp;
temp = validParameter.validFile(parameters, "freq", false); if (temp == "not found") { temp = "100"; }
m->mothurConvert(temp, freq);
temp = validParameter.validFile(parameters, "all", false); if (temp == "not found") { temp = "false"; }
all = m->isTrue(temp);
if (abort == false) {
string fileNameRoot = outputDir + m->getRootName(m->getSimpleName(sharedfile));
ValidCalculators validCalculator;
for (int i=0; i<Estimators.size(); i++) {
if (validCalculator.isValidCalculator("shared", Estimators[i]) == true) {
if (Estimators[i] == "sharedchao") {
cDisplays.push_back(new CollectDisplay(new SharedChao1(), new SharedOneColumnFile(fileNameRoot+"shared.chao")));
outputNames.push_back(fileNameRoot+"shared.chao"); outputTypes["sharedchao"].push_back(fileNameRoot+"shared.chao");
}else if (Estimators[i] == "sharedsobs") {
cDisplays.push_back(new CollectDisplay(new SharedSobsCS(), new SharedOneColumnFile(fileNameRoot+"shared.sobs")));
outputNames.push_back(fileNameRoot+"shared.sobs"); outputTypes["sharedsobs"].push_back(fileNameRoot+"shared.sobs");
}else if (Estimators[i] == "sharedace") {
cDisplays.push_back(new CollectDisplay(new SharedAce(), new SharedOneColumnFile(fileNameRoot+"shared.ace")));
outputNames.push_back(fileNameRoot+"shared.ace"); outputTypes["sharedace"].push_back(fileNameRoot+"shared.ace");
}else if (Estimators[i] == "jabund") {
cDisplays.push_back(new CollectDisplay(new JAbund(), new SharedOneColumnFile(fileNameRoot+"jabund")));
outputNames.push_back(fileNameRoot+"jabund"); outputTypes["jabund"].push_back(fileNameRoot+"jabund");
}else if (Estimators[i] == "sorabund") {
cDisplays.push_back(new CollectDisplay(new SorAbund(), new SharedOneColumnFile(fileNameRoot+"sorabund")));
outputNames.push_back(fileNameRoot+"sorabund"); outputTypes["sorabund"].push_back(fileNameRoot+"sorabund");
}else if (Estimators[i] == "jclass") {
cDisplays.push_back(new CollectDisplay(new Jclass(), new SharedOneColumnFile(fileNameRoot+"jclass")));
outputNames.push_back(fileNameRoot+"jclass"); outputTypes["jclass"].push_back(fileNameRoot+"jclass");
}else if (Estimators[i] == "sorclass") {
cDisplays.push_back(new CollectDisplay(new SorClass(), new SharedOneColumnFile(fileNameRoot+"sorclass")));
outputNames.push_back(fileNameRoot+"sorclass"); outputTypes["sorclass"].push_back(fileNameRoot+"sorclass");
}else if (Estimators[i] == "jest") {
cDisplays.push_back(new CollectDisplay(new Jest(), new SharedOneColumnFile(fileNameRoot+"jest")));
outputNames.push_back(fileNameRoot+"jest"); outputTypes["jest"].push_back(fileNameRoot+"jest");
}else if (Estimators[i] == "sorest") {
cDisplays.push_back(new CollectDisplay(new SorEst(), new SharedOneColumnFile(fileNameRoot+"sorest")));
outputNames.push_back(fileNameRoot+"sorest"); outputTypes["sorest"].push_back(fileNameRoot+"sorest");
}else if (Estimators[i] == "thetayc") {
cDisplays.push_back(new CollectDisplay(new ThetaYC(), new SharedOneColumnFile(fileNameRoot+"thetayc")));
outputNames.push_back(fileNameRoot+"thetayc"); outputTypes["thetayc"].push_back(fileNameRoot+"thetayc");
}else if (Estimators[i] == "thetan") {
cDisplays.push_back(new CollectDisplay(new ThetaN(), new SharedOneColumnFile(fileNameRoot+"thetan")));
outputNames.push_back(fileNameRoot+"thetan"); outputTypes["thetan"].push_back(fileNameRoot+"thetan");
}else if (Estimators[i] == "kstest") {
cDisplays.push_back(new CollectDisplay(new KSTest(), new SharedOneColumnFile(fileNameRoot+"kstest")));
outputNames.push_back(fileNameRoot+"kstest"); outputTypes["kstest"].push_back(fileNameRoot+"kstest");
}else if (Estimators[i] == "whittaker") {
cDisplays.push_back(new CollectDisplay(new Whittaker(), new SharedOneColumnFile(fileNameRoot+"whittaker")));
outputNames.push_back(fileNameRoot+"whittaker"); outputTypes["whittaker"].push_back(fileNameRoot+"whittaker");
}else if (Estimators[i] == "sharednseqs") {
cDisplays.push_back(new CollectDisplay(new SharedNSeqs(), new SharedOneColumnFile(fileNameRoot+"shared.nseqs")));
outputNames.push_back(fileNameRoot+"shared.nseqs"); outputTypes["shared.nseqs"].push_back(fileNameRoot+"shared.nseqs");
}else if (Estimators[i] == "ochiai") {
cDisplays.push_back(new CollectDisplay(new Ochiai(), new SharedOneColumnFile(fileNameRoot+"ochiai")));
outputNames.push_back(fileNameRoot+"ochiai"); outputTypes["ochiai"].push_back(fileNameRoot+"ochiai");
}else if (Estimators[i] == "anderberg") {
cDisplays.push_back(new CollectDisplay(new Anderberg(), new SharedOneColumnFile(fileNameRoot+"anderberg")));
outputNames.push_back(fileNameRoot+"anderberg"); outputTypes["anderberg"].push_back(fileNameRoot+"anderberg");
}else if (Estimators[i] == "kulczynski") {
cDisplays.push_back(new CollectDisplay(new Kulczynski(), new SharedOneColumnFile(fileNameRoot+"kulczynski")));
outputNames.push_back(fileNameRoot+"kulczynski"); outputTypes["kulczynski"].push_back(fileNameRoot+"kulczynski");
}else if (Estimators[i] == "kulczynskicody") {
cDisplays.push_back(new CollectDisplay(new KulczynskiCody(), new SharedOneColumnFile(fileNameRoot+"kulczynskicody")));
outputNames.push_back(fileNameRoot+"kulczynskicody"); outputTypes["kulczynskicody"].push_back(fileNameRoot+"kulczynskicody");
}else if (Estimators[i] == "lennon") {
cDisplays.push_back(new CollectDisplay(new Lennon(), new SharedOneColumnFile(fileNameRoot+"lennon")));
outputNames.push_back(fileNameRoot+"lennon"); outputTypes["lennon"].push_back(fileNameRoot+"lennon");
}else if (Estimators[i] == "morisitahorn") {
cDisplays.push_back(new CollectDisplay(new MorHorn(), new SharedOneColumnFile(fileNameRoot+"morisitahorn")));
outputNames.push_back(fileNameRoot+"morisitahorn"); outputTypes["morisitahorn"].push_back(fileNameRoot+"morisitahorn");
}else if (Estimators[i] == "braycurtis") {
cDisplays.push_back(new CollectDisplay(new BrayCurtis(), new SharedOneColumnFile(fileNameRoot+"braycurtis")));
outputNames.push_back(fileNameRoot+"braycurtis"); outputTypes["braycurtis"].push_back(fileNameRoot+"braycurtis");
}else if (Estimators[i] == "odum") {
cDisplays.push_back(new CollectDisplay(new Odum(), new SharedOneColumnFile(fileNameRoot+"odum")));
outputNames.push_back(fileNameRoot+"odum"); outputTypes["odum"].push_back(fileNameRoot+"odum");
}else if (Estimators[i] == "canberra") {
cDisplays.push_back(new CollectDisplay(new Canberra(), new SharedOneColumnFile(fileNameRoot+"canberra")));
outputNames.push_back(fileNameRoot+"canberra"); outputTypes["canberra"].push_back(fileNameRoot+"canberra");
}else if (Estimators[i] == "structeuclidean") {
cDisplays.push_back(new CollectDisplay(new StructEuclidean(), new SharedOneColumnFile(fileNameRoot+"structeuclidean")));
outputNames.push_back(fileNameRoot+"structeuclidean"); outputTypes["structeuclidean"].push_back(fileNameRoot+"structeuclidean");
}else if (Estimators[i] == "structchord") {
cDisplays.push_back(new CollectDisplay(new StructChord(), new SharedOneColumnFile(fileNameRoot+"structchord")));
outputNames.push_back(fileNameRoot+"structchord"); outputTypes["structchord"].push_back(fileNameRoot+"structchord");
}else if (Estimators[i] == "hellinger") {
cDisplays.push_back(new CollectDisplay(new Hellinger(), new SharedOneColumnFile(fileNameRoot+"hellinger")));
outputNames.push_back(fileNameRoot+"hellinger"); outputTypes["hellinger"].push_back(fileNameRoot+"hellinger");
}else if (Estimators[i] == "manhattan") {
cDisplays.push_back(new CollectDisplay(new Manhattan(), new SharedOneColumnFile(fileNameRoot+"manhattan")));
outputNames.push_back(fileNameRoot+"manhattan"); outputTypes["manhattan"].push_back(fileNameRoot+"manhattan");
}else if (Estimators[i] == "structpearson") {
cDisplays.push_back(new CollectDisplay(new StructPearson(), new SharedOneColumnFile(fileNameRoot+"structpearson")));
outputNames.push_back(fileNameRoot+"structpearson"); outputTypes["structpearson"].push_back(fileNameRoot+"structpearson");
}else if (Estimators[i] == "soergel") {
cDisplays.push_back(new CollectDisplay(new Soergel(), new SharedOneColumnFile(fileNameRoot+"soergel")));
outputNames.push_back(fileNameRoot+"soergel"); outputTypes["soergel"].push_back(fileNameRoot+"soergel");
}else if (Estimators[i] == "spearman") {
cDisplays.push_back(new CollectDisplay(new Spearman(), new SharedOneColumnFile(fileNameRoot+"spearman")));
outputNames.push_back(fileNameRoot+"spearman"); outputTypes["spearman"].push_back(fileNameRoot+"spearman");
}else if (Estimators[i] == "structkulczynski") {
cDisplays.push_back(new CollectDisplay(new StructKulczynski(), new SharedOneColumnFile(fileNameRoot+"structkulczynski")));
outputNames.push_back(fileNameRoot+"structkulczynski"); outputTypes["structkulczynski"].push_back(fileNameRoot+"structkulczynski");
}else if (Estimators[i] == "speciesprofile") {
cDisplays.push_back(new CollectDisplay(new SpeciesProfile(), new SharedOneColumnFile(fileNameRoot+"speciesprofile")));
outputNames.push_back(fileNameRoot+"speciesprofile"); outputTypes["speciesprofile"].push_back(fileNameRoot+"speciesprofile");
}else if (Estimators[i] == "hamming") {
cDisplays.push_back(new CollectDisplay(new Hamming(), new SharedOneColumnFile(fileNameRoot+"hamming")));
outputNames.push_back(fileNameRoot+"hamming"); outputTypes["hamming"].push_back(fileNameRoot+"hamming");
}else if (Estimators[i] == "structchi2") {
cDisplays.push_back(new CollectDisplay(new StructChi2(), new SharedOneColumnFile(fileNameRoot+"structchi2")));
outputNames.push_back(fileNameRoot+"structchi2"); outputTypes["structchi2"].push_back(fileNameRoot+"structchi2");
}else if (Estimators[i] == "gower") {
cDisplays.push_back(new CollectDisplay(new Gower(), new SharedOneColumnFile(fileNameRoot+"gower")));
outputNames.push_back(fileNameRoot+"gower"); outputTypes["gower"].push_back(fileNameRoot+"gower");
}else if (Estimators[i] == "memchi2") {
cDisplays.push_back(new CollectDisplay(new MemChi2(), new SharedOneColumnFile(fileNameRoot+"memchi2")));
outputNames.push_back(fileNameRoot+"memchi2"); outputTypes["memchi2"].push_back(fileNameRoot+"memchi2");
}else if (Estimators[i] == "memchord") {
cDisplays.push_back(new CollectDisplay(new MemChord(), new SharedOneColumnFile(fileNameRoot+"memchord")));
outputNames.push_back(fileNameRoot+"memchord"); outputTypes["memchord"].push_back(fileNameRoot+"memchord");
}else if (Estimators[i] == "memeuclidean") {
cDisplays.push_back(new CollectDisplay(new MemEuclidean(), new SharedOneColumnFile(fileNameRoot+"memeuclidean")));
outputNames.push_back(fileNameRoot+"memeuclidean"); outputTypes["memeuclidean"].push_back(fileNameRoot+"memeuclidean");
}else if (Estimators[i] == "mempearson") {
cDisplays.push_back(new CollectDisplay(new MemPearson(), new SharedOneColumnFile(fileNameRoot+"mempearson")));
outputNames.push_back(fileNameRoot+"mempearson"); outputTypes["mempearson"].push_back(fileNameRoot+"mempearson");
}
}
}
}
}
}
catch(exception& e) {
m->errorOut(e, "CollectSharedCommand", "CollectSharedCommand");
exit(1);
}
}
SummaryQualCommand::SummaryQualCommand(string option) {
try {
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
map<string,string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("qfile");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["qfile"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
it = parameters.find("count");
//user has given a template file
if(it != parameters.end()){
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["count"] = inputDir + it->second; }
}
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["summary"] = tempOutNames;
//check for required parameters
qualfile = validParameter.validFile(parameters, "qfile", true);
if (qualfile == "not open") { qualfile = ""; abort = true; }
else if (qualfile == "not found") {
qualfile = m->getQualFile();
if (qualfile != "") { m->mothurOut("Using " + qualfile + " as input file for the qfile parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current quality file and the qfile parameter is required."); m->mothurOutEndLine(); abort = true; }
}else { m->setQualFile(qualfile); }
namefile = validParameter.validFile(parameters, "name", true);
if (namefile == "not open") { namefile = ""; abort = true; }
else if (namefile == "not found") { namefile = ""; }
else { m->setNameFile(namefile); }
countfile = validParameter.validFile(parameters, "count", true);
if (countfile == "not open") { abort = true; countfile = ""; }
else if (countfile == "not found") { countfile = ""; }
else { m->setCountTableFile(countfile); }
if ((countfile != "") && (namefile != "")) { m->mothurOut("You must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){
outputDir = "";
outputDir += m->hasPath(qualfile); //if user entered a file with a path then preserve it
}
string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
m->mothurConvert(temp, processors);
if (countfile == "") {
if (namefile == "") {
vector<string> files; files.push_back(qualfile);
parser.getNameFile(files);
}
}
}
}
catch(exception& e) {
m->errorOut(e, "SummaryQualCommand", "SummaryQualCommand");
exit(1);
}
}
//**********************************************************************************************************************
//This function checks to make sure the cluster command has no errors and then clusters based on the method chosen.
ClusterDoturCommand::ClusterDoturCommand(string option) {
try{
abort = false; calledHelp = false;
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter;
//check to make sure all parameters are valid for command
map<string,string>::iterator it;
for (it = parameters.begin(); it != parameters.end(); it++) {
if (!validParameter.isValidParameter(it->first, myArray, it->second)) {
abort = true;
}
}
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.valid(parameters, "inputdir");
if (inputDir == "not found"){ inputDir = ""; }
else {
string path;
it = parameters.find("phylip");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["phylip"] = inputDir + it->second; }
}
it = parameters.find("name");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["name"] = inputDir + it->second; }
}
it = parameters.find("count");
//user has given a template file
if(it != parameters.end()){
path = util.hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["count"] = inputDir + it->second; }
}
}
//initialize outputTypes
vector<string> tempOutNames;
outputTypes["list"] = tempOutNames;
outputTypes["rabund"] = tempOutNames;
outputTypes["sabund"] = tempOutNames;
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.valid(parameters, "outputdir"); if (outputDir == "not found"){ outputDir = ""; }
//check for required parameters
phylipfile = validParameter.validFile(parameters, "phylip");
if (phylipfile == "not open") { abort = true; }
else if (phylipfile == "not found") {
phylipfile = current->getPhylipFile();
if (phylipfile != "") { m->mothurOut("Using " + phylipfile + " as input file for the phylip parameter."); m->mothurOutEndLine(); }
else {
m->mothurOut("You need to provide a phylip file with the cluster.classic command."); m->mothurOutEndLine();
abort = true;
}
}else { current->setPhylipFile(phylipfile); }
//check for optional parameter and set defaults
namefile = validParameter.validFile(parameters, "name");
if (namefile == "not open") { abort = true; namefile = ""; }
else if (namefile == "not found") { namefile = ""; }
else { current->setNameFile(namefile); }
countfile = validParameter.validFile(parameters, "count");
if (countfile == "not open") { abort = true; countfile = ""; }
else if (countfile == "not found") { countfile = ""; }
else { current->setCountFile(countfile); }
if ((countfile != "") && (namefile != "")) { m->mothurOut("When executing a cluster.classic command you must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; }
string temp;
temp = validParameter.valid(parameters, "precision");
if (temp == "not found") { temp = "100"; }
//saves precision legnth for formatting below
length = temp.length();
util.mothurConvert(temp, precision);
temp = validParameter.valid(parameters, "cutoff");
if (temp == "not found") { temp = "10"; }
util.mothurConvert(temp, cutoff);
temp = validParameter.valid(parameters, "sim"); if (temp == "not found") { temp = "F"; }
sim = util.isTrue(temp);
method = validParameter.valid(parameters, "method");
if (method == "not found") { method = "average"; }
if ((method == "furthest") || (method == "nearest") || (method == "average") || (method == "weighted")) {
if (method == "furthest") { tag = "fn"; }
else if (method == "nearest") { tag = "nn"; }
else if (method == "average") { tag = "an"; }
else if (method == "weighted") { tag = "wn"; }
}else { m->mothurOut("Not a valid clustering method. Valid clustering algorithms are furthest, nearest, average, weighted."); m->mothurOutEndLine(); abort = true; }
}
}
catch(exception& e) {
m->errorOut(e, "ClusterDoturCommand", "ClusterCommand");
exit(1);
}
}