// Traverse from node0 -> node1
static void traverse_5pflank(BreakpointCaller *caller, GraphCrawler *crawler,
dBNode node0, dBNode node1)
{
const dBGraph *db_graph = crawler->cache.db_graph;
dBNode next_nodes[4];
Nucleotide next_nucs[4];
size_t i, num_next;
BinaryKmer bkmer0 = db_node_get_bkmer(db_graph, node0.key);
num_next = db_graph_next_nodes(db_graph, bkmer0, node0.orient,
db_node_edges(db_graph, node0.key, 0),
next_nodes, next_nucs);
// Find index of previous node
for(i = 0; i < num_next && !db_nodes_are_equal(next_nodes[i],node1); i++) {}
ctx_assert(i < num_next && db_nodes_are_equal(next_nodes[i],node1));
kmer_run_buf_reset(&caller->koruns_5p);
kmer_run_buf_reset(&caller->koruns_5p_ended);
kmer_run_buf_reset(&caller->flank5p_run_buf);
// Go backwards to get 5p flank
// NULL means loop from 0..(ncols-1)
graph_crawler_fetch(crawler, node0,
next_nodes, next_nucs, i, num_next,
NULL, db_graph->num_of_cols,
gcrawler_flank5p_stop_at_ref_covg,
gcrawler_flank5p_finish_ref_covg,
caller);
}
// Orient supernode
// Once oriented, supernode has lowest possible kmerkey at the beginning,
// oriented FORWARDs if possible
void supernode_normalise(dBNode *nlist, size_t len, const dBGraph *db_graph)
{
// Sort supernode into forward orientation
ctx_assert(len > 0);
if(len == 1) {
nlist[0].orient = FORWARD;
return;
}
BinaryKmer bkmer0 = db_node_get_bkmer(db_graph, nlist[0].key);
BinaryKmer bkmer1 = db_node_get_bkmer(db_graph, nlist[len-1].key);
// Check if closed cycle
if(supernode_is_closed_cycle(nlist, len, bkmer0, bkmer1, db_graph))
{
// find lowest kmer to start from
BinaryKmer lowest = bkmer0, tmp;
size_t i, idx = 0;
for(i = 1; i < len; i++) {
tmp = db_node_get_bkmer(db_graph, nlist[i].key);
if(binary_kmer_less_than(tmp, lowest)) {
lowest = tmp;
idx = i;
}
}
// If already starting from the lowest kmer no change needed
if(idx > 0 || nlist[0].orient != FORWARD)
{
// a->b->c->d->e->f->a
// if c is lowest and FORWARD: c->d->e->f->a->b (keep orientations)
// if c is lowest and REVERSE: c->b->a->f->e->d (reverse orientations)
if(nlist[idx].orient == FORWARD) {
// Shift left by idx, without affecting orientations
db_nodes_left_shift(nlist, len, idx);
} else {
db_nodes_reverse_complement(nlist, idx+1);
db_nodes_reverse_complement(nlist+idx+1, len-idx-1);
}
}
}
else if(binary_kmer_less_than(bkmer1,bkmer0)) {
db_nodes_reverse_complement(nlist, len);
}
}
// Get bkey:orient string representation e.g. "AGAGTTTTATC:1".
// :0 means forward, :1 means reverse
// `str` must be at least kmer_size+3 chars long
// Returns length in bytes. Null terminates `str`.
size_t db_node_to_str(const dBGraph *db_graph, dBNode node, char *str)
{
const size_t kmer_size = db_graph->kmer_size;
BinaryKmer bkmer = db_node_get_bkmer(db_graph, node.key);
binary_kmer_to_str(bkmer, kmer_size, str);
str[kmer_size] = ':';
str[kmer_size+1] = '0' + node.orient;
str[kmer_size+2] = '\0';
return kmer_size + 2;
}
// Print:
// 0: AAACCCAAATGCAAACCCAAATGCAAACCCA:1 TGGGTTTGCATTTGGGTTTGCATTTGGGTTT
// 1: CAAACCCAAATGCAAACCCAAATGCAAACCC:1 GGGTTTGCATTTGGGTTTGCATTTGGGTTTG
// ...
void db_nodes_print_verbose(const dBNode *nodes, size_t num,
const dBGraph *db_graph, FILE *out)
{
if(num == 0) return;
const size_t kmer_size = db_graph->kmer_size;
size_t i;
BinaryKmer bkmer, bkey;
char kmerstr[MAX_KMER_SIZE+1], keystr[MAX_KMER_SIZE+1];
bkmer = db_node_get_bkmer(db_graph, nodes[0].key);
bkey = db_node_oriented_bkmer(db_graph, nodes[0]);
binary_kmer_to_str(bkmer, kmer_size, kmerstr);
binary_kmer_to_str(bkey, kmer_size, keystr);
fprintf(out, "%3zu: %s:%i %s\n", (size_t)0, kmerstr, (int)nodes[0].orient, keystr);
for(i = 1; i < num; i++) {
bkmer = db_node_get_bkmer(db_graph, nodes[i].key);
bkey = db_node_oriented_bkmer(db_graph, nodes[i]);
binary_kmer_to_str(bkmer, kmer_size, kmerstr);
binary_kmer_to_str(bkey, kmer_size, keystr);
fprintf(out, "%3zu: %s:%i %s\n", i, kmerstr, (int)nodes[i].orient, keystr);
}
}
// For every kmer in the graph, we run this function
static inline bool print_edges(hkey_t hkey, size_t threadid, void *arg)
{
(void)threadid;
UnitigPrinter *p = (UnitigPrinter*)arg;
UnitigEnd uend = p->ugraph.unitig_ends[hkey];
// Check if node is an end of a unitig
if(uend.assigned) {
BinaryKmer bkey = db_node_get_bkmer(p->db_graph, hkey);
Edges edges = db_node_get_edges(p->db_graph, hkey, 0);
if(uend.left) {
_print_edge(hkey, false, bkey, edges, uend, p);
}
if(uend.right) {
_print_edge(hkey, true, bkey, edges, uend, p);
}
}
return false; // keep iterating
}
// Returns number of bytes added
size_t db_nodes_to_str(const dBNode *nodes, size_t num,
const dBGraph *db_graph, char *str)
{
if(num == 0) return 0;
size_t i;
size_t kmer_size = db_graph->kmer_size;
BinaryKmer bkmer = db_node_get_bkmer(db_graph, nodes[0].key);
Nucleotide nuc;
binary_kmer_to_str(bkmer, kmer_size, str);
if(nodes[0].orient == REVERSE) dna_reverse_complement_str(str, kmer_size);
for(i = 1; i < num; i++) {
nuc = db_node_get_last_nuc(nodes[i], db_graph);
str[kmer_size+i-1] = dna_nuc_to_char(nuc);
}
str[kmer_size+num-1] = '\0';
return kmer_size+num-1;
}
// Edges restricted to this colour, only in one direction (node.orient)
Edges db_node_edges_in_col(dBNode node, size_t col, const dBGraph *db_graph)
{
if(db_graph->node_in_cols == NULL && db_graph->col_covgs == NULL) {
Edges edges = db_node_get_edges(db_graph, node.key, col);
return edges_mask_orientation(edges, node.orient);
}
// Edges are merged into one colour
ctx_assert(db_graph->num_edge_cols == 1);
ctx_assert(db_graph->node_in_cols != NULL || db_graph->col_covgs != NULL);
Edges edges = db_node_get_edges(db_graph, node.key, 0);
// Check which next nodes are in the given colour
BinaryKmer bkmer = db_node_get_bkmer(db_graph, node.key);
dBNode nodes[4];
Nucleotide nucs[4];
size_t i, n;
n = db_graph_next_nodes(db_graph, bkmer, node.orient,
edges, nodes, nucs);
edges = 0;
if(db_graph->node_in_cols != NULL) {
for(i = 0; i < n; i++)
if(db_node_has_col(db_graph, nodes[i].key, col))
edges = edges_set_edge(edges, nucs[i], node.orient);
}
else if(db_graph->col_covgs != NULL) {
for(i = 0; i < n; i++)
if(db_node_col_covg(db_graph, nodes[i].key, col) > 0)
edges = edges_set_edge(edges, nucs[i], node.orient);
}
else ctx_assert(0);
return edges;
}
static inline int infer_edges_node(hkey_t hkey,
bool add_all_edges,
Covg *tmp_covgs,
const dBGraph *db_graph,
size_t *num_nodes_modified)
{
BinaryKmer bkmer = db_node_get_bkmer(db_graph, hkey);
Edges *edges = &db_node_edges(db_graph, hkey, 0);
size_t col;
// Create coverages that are zero or one depending on if node has colour
if(db_graph->col_covgs == NULL) {
for(col = 0; col < db_graph->num_of_cols; col++)
tmp_covgs[col] = db_node_has_col(db_graph, hkey, col);
} else {
tmp_covgs = &db_node_covg(db_graph, hkey, 0);
}
(*num_nodes_modified)
+= (add_all_edges ? infer_all_edges(bkmer, edges, tmp_covgs, db_graph)
: infer_pop_edges(bkmer, edges, tmp_covgs, db_graph));
return 0; // => keep iterating
}
void test_graph_crawler()
{
test_status("Testing graph crawler...");
// Construct 1 colour graph with kmer-size=11
dBGraph graph;
const size_t kmer_size = 11, ncols = 3;
db_graph_alloc(&graph, kmer_size, ncols, 1, 2048,
DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL | DBG_ALLOC_BKTLOCKS);
char graphseq[3][77] =
// < X X X...............
{"GTTCCAGAGCGGAGGTCTCCCAACAACATGGTATAAGTTGTCTAGCCCCGGTTCGCGCGGGTACTTCTTACAGCGC",
"GTTCCAGAGCGGAGGTCTCCCAACAACTTGGTATAAGTTGTCTAGTCCCGGTTCGCGCGGCATTTCAGCATTGTTA",
"GTTCCAGAGCGCGACAGAGTGCATATCACGCTAAGCACAGCCCTCTTCTATCTGCTTTTAAATGGATCAATAATCG"};
build_graph_from_str_mt(&graph, 0, graphseq[0], strlen(graphseq[0]));
build_graph_from_str_mt(&graph, 1, graphseq[1], strlen(graphseq[1]));
build_graph_from_str_mt(&graph, 2, graphseq[2], strlen(graphseq[2]));
// Crawl graph
GraphCrawler crawler;
graph_crawler_alloc(&crawler, &graph);
dBNode node = db_graph_find_str(&graph, graphseq[0]);
dBNode next_node = db_graph_find_str(&graph, graphseq[0]+1);
TASSERT(node.key != HASH_NOT_FOUND);
TASSERT(next_node.key != HASH_NOT_FOUND);
BinaryKmer bkey = db_node_get_bkmer(&graph, node.key);
Edges edges = db_node_get_edges(&graph, node.key, 0);
dBNode next_nodes[4];
Nucleotide next_nucs[4];
size_t i, p, num_next, next_idx;
num_next = db_graph_next_nodes(&graph, bkey, node.orient, edges,
next_nodes, next_nucs);
next_idx = 0;
while(next_idx < num_next && !db_nodes_are_equal(next_nodes[next_idx],next_node))
next_idx++;
TASSERT(next_idx < num_next && db_nodes_are_equal(next_nodes[next_idx],next_node));
// Crawl in all colours
graph_crawler_fetch(&crawler, node, next_nodes, next_idx, num_next,
NULL, graph.num_of_cols, NULL, NULL, NULL);
TASSERT2(crawler.num_paths == 2, "crawler.num_paths: %u", crawler.num_paths);
// Fetch paths
dBNodeBuffer nbuf;
db_node_buf_alloc(&nbuf, 16);
StrBuf sbuf;
strbuf_alloc(&sbuf, 128);
for(p = 0; p < crawler.num_paths; p++) {
db_node_buf_reset(&nbuf);
graph_crawler_get_path_nodes(&crawler, p, &nbuf);
strbuf_ensure_capacity(&sbuf, nbuf.len+graph.kmer_size);
sbuf.end = db_nodes_to_str(nbuf.b, nbuf.len, &graph, sbuf.b);
for(i = 0; i < 3 && strcmp(graphseq[i]+1,sbuf.b) != 0; i++) {}
TASSERT2(i < 3, "seq: %s", sbuf.b);
TASSERT2(sbuf.end == 75, "sbuf.end: %zu", sbuf.end);
TASSERT2(nbuf.len == 65, "nbuf.len: %zu", nbuf.len);
}
strbuf_dealloc(&sbuf);
db_node_buf_dealloc(&nbuf);
graph_crawler_dealloc(&crawler);
db_graph_dealloc(&graph);
}
// Walk the graph remembering the last time we met the ref
// When traversal fails, dump sequence up to last meeting with the ref
static void follow_break(BreakpointCaller *caller, dBNode node)
{
size_t i, j, k, num_next;
dBNode next_nodes[4];
Nucleotide next_nucs[4];
size_t nonref_idx[4], num_nonref_next = 0;
const dBGraph *db_graph = caller->db_graph;
BinaryKmer bkey = db_node_get_bkmer(db_graph, node.key);
Edges edges = db_node_get_edges(db_graph, node.key, 0);
num_next = db_graph_next_nodes(db_graph, bkey, node.orient, edges,
next_nodes, next_nucs);
// Filter out next nodes in the reference
for(i = 0; i < num_next; i++) {
if(kograph_num(caller->kograph, next_nodes[i].key) == 0) {
nonref_idx[num_nonref_next] = i;
num_nonref_next++;
}
}
// Abandon if all options are in ref or none are
if(num_nonref_next == num_next || num_nonref_next == 0) return;
// Follow all paths not in ref, in all colours
GraphCrawler *fw_crawler = &caller->crawlers[node.orient];
GraphCrawler *rv_crawler = &caller->crawlers[!node.orient];
dBNodeBuffer *allelebuf = &caller->allelebuf, *flank5pbuf = &caller->flank5pbuf;
GCMultiColPath *flank5p_multicolpath, *allele_multicolpath;
KOccurRun *flank5p_runs, *flank3p_runs;
size_t flank5p_pathid, allele_pathid;
size_t num_flank5p_runs, num_flank3p_runs;
// We fetch 5' flanks in all colours then merge matching paths
// we stop fetching a single path if it stops tracking the reference
// Alternatively, we could fetch the 5' flank in everyone and stop after a
// given distance, then check for that set of paths how much it tracks the
// reference. This has the advantage of scaling much better with number of
// samples, but not so well as min_ref_nkmers increases (since we fetch
// many flanks that can't be used) - I think this is less of a worry.
// Loop over possible next nodes at this junction
for(i = 0; i < num_nonref_next; i++)
{
size_t next_idx = nonref_idx[i];
// Go backwards to get 5p flank
traverse_5pflank(caller, rv_crawler, db_node_reverse(next_nodes[next_idx]),
db_node_reverse(node));
// Loop over the flanks we got
for(j = 0; j < rv_crawler->num_paths; j++)
{
// Get 5p flank
db_node_buf_reset(flank5pbuf);
graph_crawler_get_path_nodes(rv_crawler, j, flank5pbuf);
flank5p_multicolpath = &rv_crawler->multicol_paths[j];
flank5p_pathid = flank5p_multicolpath->pathid;
// Fetch 3pflank ref position
num_flank5p_runs = caller->flank5p_refs[flank5p_pathid].num_runs;
flank5p_runs = fetch_ref_contact(&rv_crawler->cache, flank5p_pathid,
caller->flank5p_refs,
&caller->flank5p_run_buf);
koruns_reverse(flank5p_runs, num_flank5p_runs, flank5pbuf->len);
koruns_sort_by_qoffset(flank5p_runs, num_flank5p_runs);
db_nodes_reverse_complement(flank5pbuf->data, flank5pbuf->len);
if(num_flank5p_runs > 0)
{
// Reset caller
kmer_run_buf_reset(&caller->koruns_3p);
kmer_run_buf_reset(&caller->koruns_3p_ended);
kmer_run_buf_reset(&caller->allele_run_buf);
// functions gcrawler_path_stop_at_ref_covg(),
// gcrawler_path_finish_ref_covg()
// both fill koruns_3p, koruns_3p_ended and allele_run_buf
// Only traverse in the colours we have a flank for
graph_crawler_fetch(fw_crawler, node,
next_nodes, next_nucs, next_idx, num_next,
flank5p_multicolpath->cols,
flank5p_multicolpath->num_cols,
gcrawler_path_stop_at_ref_covg,
gcrawler_path_finish_ref_covg,
caller);
// Assemble contigs - fetch forwards for each path for given 5p flank
for(k = 0; k < fw_crawler->num_paths; k++)
{
// Fetch nodes
db_node_buf_reset(allelebuf);
graph_crawler_get_path_nodes(fw_crawler, k, allelebuf);
ctx_assert(allelebuf->len > 0);
allele_multicolpath = &fw_crawler->multicol_paths[k];
allele_pathid = allele_multicolpath->pathid;
// Fetch 3pflank ref position
num_flank3p_runs = caller->allele_refs[allele_pathid].num_runs;
flank3p_runs = fetch_ref_contact(&fw_crawler->cache, allele_pathid,
caller->allele_refs,
&caller->allele_run_buf);
process_contig(caller,
allele_multicolpath->cols,
allele_multicolpath->num_cols,
flank5pbuf, allelebuf,
flank5p_runs, num_flank5p_runs,
flank3p_runs, num_flank3p_runs);
}
}
}
}
}
// `fork_node` is a node with outdegree > 1
void find_bubbles(BubbleCaller *caller, dBNode fork_node)
{
graph_cache_reset(&caller->cache);
const dBGraph *db_graph = caller->db_graph;
GraphCache *cache = &caller->cache;
GraphWalker *wlk = &caller->wlk;
RepeatWalker *rptwlk = &caller->rptwlk;
// char tmpstr[MAX_KMER_SIZE+3];
// db_node_to_str(db_graph, fork_node, tmpstr);
// status("Calling from %s", tmpstr);
dBNode nodes[4];
Nucleotide bases[4];
size_t i, num_next, num_edges_in_col;
BinaryKmer fork_bkmer = db_node_get_bkmer(db_graph, fork_node.key);
num_next = db_graph_next_nodes(db_graph, fork_bkmer, fork_node.orient,
db_node_edges(db_graph, fork_node.key, 0),
nodes, bases);
// loop over alleles, then colours
Colour colour, colours_loaded = db_graph->num_of_cols;
bool node_has_col[4];
uint32_t pathid;
for(colour = 0; colour < colours_loaded; colour++)
{
if(!db_node_has_col(db_graph, fork_node.key, colour)) continue;
// Determine if this fork is a fork in the current colour
num_edges_in_col = 0;
for(i = 0; i < num_next; i++) {
node_has_col[i] = (db_node_has_col(db_graph, nodes[i].key, colour) > 0);
num_edges_in_col += node_has_col[i];
}
graph_walker_setup(wlk, true, colour, colour, db_graph);
for(i = 0; i < num_next; i++)
{
if(node_has_col[i])
{
graph_walker_start(wlk, fork_node);
graph_walker_force(wlk, nodes[i], num_edges_in_col > 1);
pathid = graph_crawler_load_path_limit(cache, nodes[i], wlk, rptwlk,
caller->prefs.max_allele_len);
graph_walker_finish(wlk);
graph_crawler_reset_rpt_walker(rptwlk, cache, pathid);
}
}
}
// Set up 5p flank
caller->flank5p.b[0] = db_node_reverse(fork_node);
caller->flank5p.len = 0; // set to one to signify we haven't fetched flank yet
}