コード例 #1
0
ファイル: himond.cpp プロジェクト: bartoffw/himond
string getHostname() {
    string hostname;

    ifstream statsFile("/etc/hostname");
    if (getline(statsFile, hostname)) {
        return hostname;
    }
    return "general_hostname";
}
コード例 #2
0
// ######################################################################
void SimulationViewerStats::saveAGMaskStats(const Image<float> &img,
                                            const std::string caller,
                                            const std::string suffix)
{

  ushort minx = 0, miny = 0, maxx = 0, maxy = 0;
  float  min,  max,  avg,  std;
  uint   N;
  // get a whole bunch of stats about this output image
  getMinMaxAvgEtc(img, min, max, avg, std, minx, miny, maxx, maxy, N);

  std::string fileName;
  std::string txt = suffix;
  fileName = itsGetSingleChannelStatsFile.getVal() + txt;

  LINFO("SAVING AG STATS TO %s",fileName.c_str());

  std::ofstream statsFile(fileName.c_str(), std::ios::app);

  statsFile << "AGstats" << "\t";

  statsFile << (itsFrameNumber - 1) << "\t";

  // differentiate between scale image stats and the combined max norm
  // for compatability with single channel stats

  statsFile << "COMBINED\t" << caller << "\t";
  //itsFrameIdx++;

  statsFile << "final" << "\t" << "FINAL" << "\t";
  statsFile << itsTotalCount   << "\t"
            << itsMaskCount    << "\t"
            << itsLamCount     << "\t"
            << itsOverlapCount << "\t";
  statsFile << min  << "\t" << max  << "\t" << avg  << "\t" << std  << "\t"
            << minx << "\t" << miny << "\t" << maxx << "\t" << maxy << "\t"
            << N    << "\n";

  statsFile.close();
}
コード例 #3
0
// ######################################################################
void SimulationViewerStats::saveCompat(const Image<float>& img,
                                       const std::string suffix,
                                       const int frameOffset)
{


  unsigned int frameIdx = (unsigned int)((int)itsFrameNumber + frameOffset);

  std::string fileName;
  std::string txt = suffix;
  fileName = itsGetSingleChannelStatsFile.getVal() + txt;

  ushort minx = 0, miny = 0, maxx = 0, maxy = 0;
  float  min,  max,  avg,  std;
  uint   N;
  // get a whole bunch of stats about this output image
  getMinMaxAvgEtc(img, min, max, avg, std, minx, miny, maxx, maxy, N);

  LINFO("SAVING COMPAT STATS TO %s",fileName.c_str());

  std::ofstream statsFile(fileName.c_str(), std::ios::app);

  statsFile << "final" << "\t";

  statsFile << frameIdx << "\t";

  // differentiate between scale image stats and the combined max norm
  // for compatability with single channel stats

  statsFile << "COMBINED\t-1\t";
  //itsFrameIdx++;

  statsFile << "final" << "\t" << "FINAL" << "\t";
  statsFile << min  << "\t" << max  << "\t" << avg  << "\t" << std  << "\t"
            << minx << "\t" << miny << "\t" << maxx << "\t" << maxy << "\t"
            << N    << "\n";
  statsFile.close();

  if(itsSaveStatsPerChannelFreq.getVal())
    {
      std::string txt = ".final.freq.txt";
      fileName = itsGetSingleChannelStatsFile.getVal() + txt;

      FFTWWrapper fft(img.getWidth(), img.getHeight());
      double dimg[img.getHeight() * img.getWidth()];
      Image<float>::const_iterator itr = img.begin();
      double *ditr = &dimg[0];
      while(itr != img.end()) *ditr++ = double(*itr++);
      fft.init(dimg);
      double mag[img.getHeight() * (img.getWidth()/2 + 1)];
      fft.compute(mag);

      std::ofstream freqFile(fileName.c_str(), std::ios::app);
      freqFile << "final" << "\t";
      freqFile << frameIdx << "\t";

      freqFile << "COMBINED\t-1\t";

      freqFile << "SIZE\t" << img.getWidth() <<"\t"<< img.getHeight() << "\n";

      for(int i = 0; i < img.getHeight(); i++)
        {
          for(int j = 0; j < (img.getWidth()/2 + 1); j++)
            freqFile << mag[i * (img.getWidth()/2 + 1) + j] << "\t";
          freqFile << "\n";
        }
      freqFile.close();
    }
}
コード例 #4
0
ファイル: hts_AdapterTrimmer.cpp プロジェクト: ibest/HTStream
int main(int argc, char** argv)
{
    const std::string program_name = "hts_AdapterTrimmer";
    std::string app_description =
                       "Adapter Trimmer, trims off adapters by first overlapping paired-end reads and\n";
    app_description += "  trimming off overhangs which by definition are adapter sequence in standard\n";
    app_description += "  libraries. SE Reads are trimmed by overlapping the adapter-sequence and trimming off the overlap.";

    try
    {
        /** Define and parse the program options
         */
        namespace po = boost::program_options;
        po::options_description standard = setStandardOptions();
            // version|v ; help|h ; notes|N ; stats-file|L ; append-stats-file|A
        po::options_description input = setInputOptions();
            // read1-input|1 ; read2-input|2 ; singleend-input|U
            // tab-input|T ; interleaved-input|I ; from-stdin|S
        po::options_description output = setOutputOptions(program_name);
            // force|F ; prefix|p ; gzip-output,g ; fastq-output|f
            // tab-output|t ; interleaved-output|i ; unmapped-output|u ; to-stdout,O

        po::options_description desc("Application Specific Options");

        setDefaultParamsCutting(desc);
            // no-orphans|n ; stranded|s ; min-length|m

        setDefaultParamsOverlapping(desc);
            // kmer|k ; kmer-offset|r ; max-mismatch-errorDensity|x
            // check-lengths|c ; min-overlap|o

        desc.add_options()
            ("no-fixbases,X", po::bool_switch()->default_value(false), "after trimming adapter, DO NOT use consensus sequence of paired reads, only trims adapter sequence");
        desc.add_options()
            ("adapter-sequence,a", po::value<std::string>()->default_value("AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"),  "Primer sequence to trim in SE adapter trimming, default is truseq ht primer sequence");

        po::options_description cmdline_options;
        cmdline_options.add(standard).add(input).add(output).add(desc);

        po::variables_map vm;
        try
        {
            po::store(po::parse_command_line(argc, argv, cmdline_options), vm); // can throw

            version_or_help(program_name, app_description, cmdline_options, vm);

            po::notify(vm); // throws on error, so do after help in case

            std::string statsFile(vm["stats-file"].as<std::string>());
            std::string prefix(vm["prefix"].as<std::string>());

            AdapterCounters counters(statsFile, vm["append-stats-file"].as<bool>(), program_name, vm["notes"].as<std::string>());

            std::shared_ptr<OutputWriter> pe = nullptr;
            std::shared_ptr<OutputWriter> se = nullptr;
            outputWriters(pe, se, vm["fastq-output"].as<bool>(), vm["tab-output"].as<bool>(), vm["interleaved-output"].as<bool>(), vm["unmapped-output"].as<bool>(), vm["force"].as<bool>(), vm["gzip-output"].as<bool>(), vm["to-stdout"].as<bool>(), prefix );

            if(vm.count("read1-input")) { // paired-end reads
                if (vm["read1-input"].as<std::vector<std::string> >().size() != vm["read1-input"].as<std::vector<std::string> >().size()) {
                    throw std::runtime_error("must have same number of input files for read1 and read2");
                }
                InputReader<PairedEndRead, PairedEndReadFastqImpl> ifr(vm["read1-input"].as<std::vector<std::string> >(), vm["read2-input"].as<std::vector<std::string> >());
                helper_adapterTrimmer(ifr, pe, se, counters, vm["max-mismatch-errorDensity"].as<double>(), vm["max-mismatch"].as<size_t>(), vm["min-overlap"].as<size_t>(), vm["stranded"].as<bool>(), vm["min-length"].as<size_t>(), vm["check-lengths"].as<size_t>(), vm["kmer"].as<size_t>(), vm["kmer-offset"].as<size_t>(), vm["no-orphans"].as<bool>(), vm["no-fixbases"].as<bool>(), vm["adapter-sequence"].as<std::string>() );
            }
            if (vm.count("interleaved-input")) { // interleaved pairs
                InputReader<PairedEndRead, InterReadImpl> ifr(vm["interleaved-input"].as<std::vector<std::string > >());
                helper_adapterTrimmer(ifr, pe, se, counters, vm["max-mismatch-errorDensity"].as<double>(), vm["max-mismatch"].as<size_t>(), vm["min-overlap"].as<size_t>(), vm["stranded"].as<bool>(), vm["min-length"].as<size_t>(), vm["check-lengths"].as<size_t>(), vm["kmer"].as<size_t>(), vm["kmer-offset"].as<size_t>(), vm["no-orphans"].as<bool>(), vm["no-fixbases"].as<bool>(), vm["adapter-sequence"].as<std::string>() );
            }
            if(vm.count("singleend-input")) { // single-end reads
                InputReader<SingleEndRead, SingleEndReadFastqImpl> ifr(vm["singleend-input"].as<std::vector<std::string> >());
                helper_adapterTrimmer(ifr, pe, se, counters, vm["max-mismatch-errorDensity"].as<double>(), vm["max-mismatch"].as<size_t>(), vm["min-overlap"].as<size_t>(), vm["stranded"].as<bool>(), vm["min-length"].as<size_t>(), vm["check-lengths"].as<size_t>(), vm["kmer"].as<size_t>(), vm["kmer-offset"].as<size_t>(), vm["no-orphans"].as<bool>(), vm["no-fixbases"].as<bool>(), vm["adapter-sequence"].as<std::string>() );
            }
            if(vm.count("tab-input")) { // tab_input
                InputReader<ReadBase, TabReadImpl> ifr(vm["tab-input"].as<std::vector<std::string> > ());
                helper_adapterTrimmer(ifr, pe, se, counters, vm["max-mismatch-errorDensity"].as<double>(), vm["max-mismatch"].as<size_t>(), vm["min-overlap"].as<size_t>(), vm["stranded"].as<bool>(), vm["min-length"].as<size_t>(), vm["check-lengths"].as<size_t>(), vm["kmer"].as<size_t>(), vm["kmer-offset"].as<size_t>(), vm["no-orphans"].as<bool>(), vm["no-fixbases"].as<bool>(), vm["adapter-sequence"].as<std::string>() );
            }
            if(vm["from-stdin"].as<bool>()) { // stdin
                bi::stream<bi::file_descriptor_source> tabin {fileno(stdin), bi::close_handle};
                InputReader<ReadBase, TabReadImpl> ifr(tabin);
                helper_adapterTrimmer(ifr, pe, se, counters, vm["max-mismatch-errorDensity"].as<double>(), vm["max-mismatch"].as<size_t>(), vm["min-overlap"].as<size_t>(), vm["stranded"].as<bool>(), vm["min-length"].as<size_t>(), vm["check-lengths"].as<size_t>(), vm["kmer"].as<size_t>(), vm["kmer-offset"].as<size_t>(), vm["no-orphans"].as<bool>(), vm["no-fixbases"].as<bool>(), vm["adapter-sequence"].as<std::string>() );
            }
            // no input specified on the command line
            if (!vm.count("read1-input") && !vm.count("interleaved-input") && !vm.count("singleend-input") && !vm.count("tab-input") && !vm["from-stdin"].as<bool>()) {
              std::cerr << "ERROR: " << "Input file type absent from command line" << std::endl << std::endl;
              version_or_help(program_name, app_description, cmdline_options, vm, true);
              exit(ERROR_IN_COMMAND_LINE); //success
            }

            counters.write_out();
        }
        catch(po::error& e)
        {
            std::cerr << "ERROR: " << e.what() << std::endl << std::endl;
            return ERROR_IN_COMMAND_LINE;
        }
    }
    catch(std::exception& e)
    {
        std::cerr << "\n\tUnhandled Exception: "
                  << e.what() << std::endl;
        return ERROR_UNHANDLED_EXCEPTION;
    }
    return SUCCESS;
}
コード例 #5
0
ファイル: SimulatorThread.cpp プロジェクト: mandy-nan/EECS570
int main(int argc, char** argv) {

  // Declare the supported options.
  knob::options_description desc("Allowed options");
  desc.add_options()
          ("help", "produce help message")

          (KnobStatsFile, knob::value<string>()->default_value("rcdcsim-stats.py"), "stats file to generate")
          (KnobToSimulatorFifo, knob::value<string>(), "named fifo used to get events from the front-end")

          // these are used to tag the output file, but don't affect the simulation at all
          (KnobScheme, knob::value<string>()->default_value("<none/>"), "text describing this simulation setup")
          (KnobWorkload, knob::value<string>()->default_value("<none/>"), "workload being run")
          (KnobInput, knob::value<string>()->default_value("<none/>"), "input being used")
          (KnobThreads, knob::value<unsigned>()->default_value(0), "number of threads in the workload")

          // everything below are simulator parameters

          (KnobCores, knob::value<unsigned>()->default_value(8), "number of cores to simulate")

          (KnobIgnoreStackRefs, "Ignore stack accesses." )

          // cache parameters
          (KnobBlockSize, knob::value<unsigned>()->default_value(64), "Block size for all caches")
          (KnobL1Size, knob::value<unsigned>()->default_value(1<<15/*32KB*/), "Size (in bytes) of each private L1 cache")
          (KnobL1Assoc, knob::value<unsigned>()->default_value(8), "Associativity of each private L1 cache")

          (KnobUseL2, "Model a private L2 for each core")
          (KnobL2Size, knob::value<unsigned>()->default_value(1<<18/*256KB*/), "Size (in bytes) of the private L2 cache")
          (KnobL2Assoc, knob::value<unsigned>()->default_value(8), "Associativity of the private L2 cache")

          (KnobUseL3, "Model an L3 cache shared amongst all cores")
          (KnobL3Size, knob::value<unsigned>()->default_value(1<<23/*8MB*/), "Size (in bytes) of the shared L3 cache")
          (KnobL3Assoc, knob::value<unsigned>()->default_value(16), "Associativity of the shared L3 cache")

          // RCDC
          (KnobTSO, "Enable simulation of Det-TSO.  Mutually exclusive with other Det-X schemes." )
          (KnobHB, "Enable simulation of Det-HB.  Mutually exclusive with other Det-X schemes." )
          (KnobNondet, "Enable simulation of Nondet.  Mutually exclusive with other Det-X schemes." )
          (KnobQuantumSize, knob::value<unsigned>()->default_value(1000), "Quantum size (insns)")
          (KnobSmartQuantumBuilding, "Use store buffer hit/miss information to deterministically estimate runtime when possible." )
          ;

  knob::store( knob::parse_command_line(argc, argv, desc), s_knobs );
  knob::notify(s_knobs);

  if (s_knobs.count("help")) {
      cout << desc << "\n";
      return 1;
  }

  // can only simulate one execution strategy at a time
  assert( s_knobs.count(KnobTSO) + s_knobs.count(KnobHB) + s_knobs.count(KnobNondet) == 1 );

  time_t startTime = time( NULL );

  MultiCacheSimulator<RCDCLine, uint64_t>* sim;
  CacheConfiguration<RCDCLine> l1config, l2config, l3config;
  l1config.blockSize = l2config.blockSize = l3config.blockSize = s_knobs[KnobBlockSize].as<unsigned>();
  l1config.callbacks = l2config.callbacks = l3config.callbacks = NULL;

  l1config.assoc = s_knobs[KnobL1Assoc].as<unsigned>();
  l1config.cacheSize = s_knobs[KnobL1Size].as<unsigned>();

  l2config.assoc = s_knobs[KnobL2Assoc].as<unsigned>();
  l2config.cacheSize = s_knobs[KnobL2Size].as<unsigned>();

  l3config.assoc = s_knobs[KnobL3Assoc].as<unsigned>();
  l3config.cacheSize = s_knobs[KnobL3Size].as<unsigned>();

  sim = new MultiCacheSimulator<RCDCLine, uint64_t> (
      s_knobs[KnobCores].as<unsigned>(),
      l1config,
      s_knobs.count(KnobUseL2), l2config,
      s_knobs.count(KnobUseL3), l3config );

  // pass knobs values through to the caches
  SMPCache<RCDCLine, uint64_t>::cache_iter_t it;
  sim->m_simulateHB = s_knobs.count(KnobHB);
  sim->m_simulateTSO = s_knobs.count(KnobTSO);
  sim->m_quantumSize = s_knobs[KnobQuantumSize].as<unsigned>();
  sim->m_smartQuantumBuilding = s_knobs.count(KnobSmartQuantumBuilding);
  for ( it = sim->m_allCaches.begin(); it != sim->m_allCaches.end(); it++ ) {
    // per-cache initialization goes here
    (*it)->useDetStoreBuffers = (sim->m_simulateHB || sim->m_simulateTSO);
  }

  ifstream eventFifo;
  eventFifo.open( s_knobs[KnobToSimulatorFifo].as<string>().c_str(), ios::binary );
  assert( eventFifo.good() );


  // main event loop
  processEvents( sim, eventFifo );



  cerr << "[rcdcsim] generating stats for " << nameOfDetStrategy() << endl;

  eventFifo.close();

  // each stat is dumped as a Python dictionary object
  stringstream prefix;
/*  prefix << "{'RCDCStat':True, ";

  prefix << "'determinismStrategy': '" << nameOfDetStrategy() << "', ";
  prefix << "'quantumSize': '" << (s_knobs[KnobQuantumSize].as<unsigned>()/1000) << "k', ";
  prefix << "'smartQuantumBuilding': " << pyOfBool( s_knobs.count(KnobSmartQuantumBuilding) ) << ", ";

  prefix << "'threads': " << s_knobs[KnobThreads].as<unsigned>() << ", ";
  prefix << "'workload': '" << s_knobs[KnobWorkload].as<string>() << "', ";
  prefix << "'input': '" << s_knobs[KnobInput].as<string>() << "', ";
  prefix << "'scheme': '" << s_knobs[KnobScheme].as<string>() << "', ";

  prefix << "'cores': '" << s_knobs[KnobCores].as<unsigned>() << "p', ";

  prefix << "'ignoreStackRefs': " << pyOfBool( s_knobs.count(KnobIgnoreStackRefs) ) << ", ";

  prefix << "'BlockSize': " << s_knobs[KnobBlockSize].as<unsigned>() << ", ";
  prefix << "'l1Assoc': " << s_knobs[KnobL1Assoc].as<unsigned>() << ", ";
  prefix << "'l1Size': " << s_knobs[KnobL1Size].as<unsigned>() << ", ";

  prefix << "'useL2': " << pyOfBool( s_knobs.count(KnobUseL2) ) << ", ";
  prefix << "'l2Assoc': " << s_knobs[KnobL2Assoc].as<unsigned>() << ", ";
  prefix << "'l2Size': " << s_knobs[KnobL2Size].as<unsigned>() << ", ";

  prefix << "'useL3': " << pyOfBool( s_knobs.count(KnobUseL3) ) << ", ";
  prefix << "'l3Assoc': " << s_knobs[KnobL3Assoc].as<unsigned>() << ", ";
  prefix << "'l3Size': " << s_knobs[KnobL3Size].as<unsigned>() << ", ";*/

  // actual stat value goes here
  string suffix = "}\n";

  // check for filename collisions and rename around them
  string statsFilename = s_knobs["statsfile"].as<string>();
  while ( fileExists( statsFilename ) ) {
    statsFilename += ".1";
  }
  ofstream statsFile( statsFilename.c_str(), ios_base::trunc );

  // dump stats from the caches
  sim->dumpStats( statsFile, prefix.str(), suffix );

  // dump "global" stats

  double minutes = difftime( time( NULL ), startTime ) / 60.0;
  statsFile << prefix.str() << "'SimulationRunningTimeMinutes': " << minutes << suffix;

  statsFile << prefix.str() << "'maxLiveThreads': " << s_maxLiveThreads << suffix;
  statsFile << prefix.str() << "'numSpawnedThreads': " << s_numSpawnedThreads << suffix;
  statsFile << prefix.str() << "'numStackAccesses': " << s_stackAccesses << suffix;
  statsFile << prefix.str() << "'numTotalInstructions': " << s_insnsExecuted << suffix;
  statsFile << prefix.str() << "'causalityInducedEventDelays': " << s_causalityDelays << suffix;
  statsFile << prefix.str() << "'unprocessedEvents': " << s_unprocessedEvents << suffix;
  statsFile << prefix.str() << "'forcedCommits': " << s_forcedCommits << suffix;

  statsFile.close();
  cerr << "[rcdcsim] finished generating stats for " << nameOfDetStrategy() << endl;

  delete sim;

  cerr << "[rcdcsim] simulation process exiting" << endl;

  return 0;
}
コード例 #6
0
/////////////////////////////////////////////////////////////////////////////
/// main looop
void DeviceMonitor::Main( ) {
	assert( dev_monitor_ );
	
	const int fd_mon = udev_monitor_get_fd( dev_monitor_ );
	const int nfds = fd_mon + 1;
        int queue_tok = 8;
	
	sigset_t sigempty;
	sigemptyset( &sigempty );

        struct timespec timeout;

        if( activity )
        {
            timeout.tv_sec = 0;
            //timeout.tv_sec = 1;
            timeout.tv_nsec = 100000000;
            //timeout.tv_nsec = 0;
        }
        else
        {
            timeout.tv_sec = 999;
            timeout.tv_nsec = 0;
        }

	while ( true ) {
		fd_set fds_read;
		FD_ZERO( &fds_read );
		FD_SET( fd_mon, &fds_read );
		
		// block for something interesting to happen
		int res = pselect( nfds, &fds_read, 0, 0, &timeout, &sigempty );
		if ( res < 0 ) {
			if ( EINTR != errno ) throw ErrnoException( "select" );
			std::cout << "Exiting on signal\n";
			return; // signalled
		}
		
		// udev monitor notification?
		if ( FD_ISSET( fd_mon, &fds_read ) ) {
			std::tr1::shared_ptr< udev_device > device( udev_monitor_receive_device( dev_monitor_ ), &udev_device_unref );
                        // make sure this is a device we want to monitor
			if (!acceptDevice_(device.get())) continue;
	
			const char* str = udev_device_get_action( device.get() );
			if ( !str ) {
			} else if ( 0 == strcasecmp( str, "add" ) ) {
				deviceAdded_( device.get() );
			} else if ( 0 == strcasecmp( str, "remove" ) ) {
				deviceRemove_( device.get() );
			} else {
				if ( debug ) {
					std::cout << "action: " << str << '\n';
					std::cout << ' ' << udev_device_get_syspath(device.get()) << "' (" << udev_device_get_subsystem(device.get()) << ")\n";
				}
			}
		}

                if( activity )
                {
                    for( int i = 0; i < num_disks_; ++i )
                    {
                        std::ifstream stats;
                        stats.open( statsFile(i).c_str() );

                        char buf[256];
                        stats.getline( &(buf[0]), 255 );
                        std::string s(&(buf[0]));

                        // tokenize the string
                        std::string::size_type last = s.find_first_not_of( " ", 0 );
                        std::string::size_type pos = s.find_first_of( " ", last );

                        int tok = 0;
                        int queue_length = 0;
                        while( std::string::npos != pos || std::string::npos != last )
                        {
                            last = s.find_first_not_of(" ", pos );
                            pos = s.find_first_of( " ", last );
                            ++tok;

                            if( tok == queue_tok )
                            {
                                queue_length = atoi(s.substr( last, pos - last ).c_str());
                                if( debug )
                                    std::cout << " " << i << " " << queue_length;
                                break;
                            }
                        }

                        int led_idx = ledIndex(i);

                        if( led_enabled_[led_idx] && leds_ )
                        {
                            if( queue_length > 0 )
                            {
                                leds_->Set( LED_BLUE, led_idx, true );
                                leds_->Set( LED_RED, led_idx, true );
                            }
                            else
                            {
                                leds_->Set( LED_BLUE, led_idx, true );
                                leds_->Set( LED_RED, led_idx, false );
                            }
                        }
                    }
                }
                if( debug )
                    std::cout << "\n";
	}
}