// Traverse from node0 -> node1
static void traverse_5pflank(BreakpointCaller *caller, GraphCrawler *crawler,
dBNode node0, dBNode node1)
{
const dBGraph *db_graph = crawler->cache.db_graph;
dBNode next_nodes[4];
Nucleotide next_nucs[4];
size_t i, num_next;
BinaryKmer bkmer0 = db_node_get_bkmer(db_graph, node0.key);
num_next = db_graph_next_nodes(db_graph, bkmer0, node0.orient,
db_node_edges(db_graph, node0.key, 0),
next_nodes, next_nucs);
// Find index of previous node
for(i = 0; i < num_next && !db_nodes_are_equal(next_nodes[i],node1); i++) {}
ctx_assert(i < num_next && db_nodes_are_equal(next_nodes[i],node1));
kmer_run_buf_reset(&caller->koruns_5p);
kmer_run_buf_reset(&caller->koruns_5p_ended);
kmer_run_buf_reset(&caller->flank5p_run_buf);
// Go backwards to get 5p flank
// NULL means loop from 0..(ncols-1)
graph_crawler_fetch(crawler, node0,
next_nodes, next_nucs, i, num_next,
NULL, db_graph->num_of_cols,
gcrawler_flank5p_stop_at_ref_covg,
gcrawler_flank5p_finish_ref_covg,
caller);
}
/**
* @param right_edge is true iff we this kmer is the last in a unitig
*/
static inline void _print_edge(hkey_t node, bool right_edge,
BinaryKmer bkey, Edges edges,
UnitigEnd uend0,
UnitigPrinter *p)
{
// DOT: leave from east end if +, west end if -
// connect to west end if +, east end if -
const char dot_exit[2] = "ew", dot_join[2] = "we", gfa_orient[2] = "+-";
size_t i, n;
dBNode next_nodes[4];
Nucleotide next_nucs[4];
Orientation orient = right_edge ? uend0.rorient : !uend0.lorient;
// Unitig orientations
Orientation ut_or0 = right_edge ? FORWARD : REVERSE, ut_or1;
n = db_graph_next_nodes(p->db_graph, bkey, orient, edges,
next_nodes, next_nucs);
for(i = 0; i < n; i++)
{
UnitigEnd uend1 = p->ugraph.unitig_ends[next_nodes[i].key];
char tmpstr[100];
db_node_to_str(p->db_graph, next_nodes[i], tmpstr);
if(!uend1.assigned)
status(" -> node %zu [%s]", uend1.unitigid, tmpstr);
ctx_assert(next_nodes[i].key != HASH_NOT_FOUND);
ctx_assert(uend1.assigned);
ut_or1 = next_nodes[i].orient == uend1.lorient ? FORWARD : REVERSE;
// Don't do reverse-to-reverse links when node links to itself,
// these are duplicates of forward-to-forward
if(node < next_nodes[i].key ||
(node == next_nodes[i].key && ut_or0 + ut_or1 < 2))
{
pthread_mutex_lock(&p->outlock);
switch(p->syntax) {
case PRINT_DOT:
fprintf(p->fout, " node%zu:%c -> node%zu:%c\n",
(size_t)uend0.unitigid, dot_exit[ut_or0],
(size_t)uend1.unitigid, dot_join[ut_or1]);
break;
case PRINT_GFA:
fprintf(p->fout, "L\tnode%zu\t%c\tnode%zu\t%c\t%zuM\n",
(size_t)uend0.unitigid, gfa_orient[ut_or0],
(size_t)uend1.unitigid, gfa_orient[ut_or1],
p->db_graph->kmer_size - 1);
break;
default: die("Bad syntax: %i", p->syntax);
}
pthread_mutex_unlock(&p->outlock);
}
}
}
// Edges restricted to this colour, only in one direction (node.orient)
Edges db_node_edges_in_col(dBNode node, size_t col, const dBGraph *db_graph)
{
if(db_graph->node_in_cols == NULL && db_graph->col_covgs == NULL) {
Edges edges = db_node_get_edges(db_graph, node.key, col);
return edges_mask_orientation(edges, node.orient);
}
// Edges are merged into one colour
ctx_assert(db_graph->num_edge_cols == 1);
ctx_assert(db_graph->node_in_cols != NULL || db_graph->col_covgs != NULL);
Edges edges = db_node_get_edges(db_graph, node.key, 0);
// Check which next nodes are in the given colour
BinaryKmer bkmer = db_node_get_bkmer(db_graph, node.key);
dBNode nodes[4];
Nucleotide nucs[4];
size_t i, n;
n = db_graph_next_nodes(db_graph, bkmer, node.orient,
edges, nodes, nucs);
edges = 0;
if(db_graph->node_in_cols != NULL) {
for(i = 0; i < n; i++)
if(db_node_has_col(db_graph, nodes[i].key, col))
edges = edges_set_edge(edges, nucs[i], node.orient);
}
else if(db_graph->col_covgs != NULL) {
for(i = 0; i < n; i++)
if(db_node_col_covg(db_graph, nodes[i].key, col) > 0)
edges = edges_set_edge(edges, nucs[i], node.orient);
}
else ctx_assert(0);
return edges;
}
void test_graph_crawler()
{
test_status("Testing graph crawler...");
// Construct 1 colour graph with kmer-size=11
dBGraph graph;
const size_t kmer_size = 11, ncols = 3;
db_graph_alloc(&graph, kmer_size, ncols, 1, 2048,
DBG_ALLOC_EDGES | DBG_ALLOC_NODE_IN_COL | DBG_ALLOC_BKTLOCKS);
char graphseq[3][77] =
// < X X X...............
{"GTTCCAGAGCGGAGGTCTCCCAACAACATGGTATAAGTTGTCTAGCCCCGGTTCGCGCGGGTACTTCTTACAGCGC",
"GTTCCAGAGCGGAGGTCTCCCAACAACTTGGTATAAGTTGTCTAGTCCCGGTTCGCGCGGCATTTCAGCATTGTTA",
"GTTCCAGAGCGCGACAGAGTGCATATCACGCTAAGCACAGCCCTCTTCTATCTGCTTTTAAATGGATCAATAATCG"};
build_graph_from_str_mt(&graph, 0, graphseq[0], strlen(graphseq[0]));
build_graph_from_str_mt(&graph, 1, graphseq[1], strlen(graphseq[1]));
build_graph_from_str_mt(&graph, 2, graphseq[2], strlen(graphseq[2]));
// Crawl graph
GraphCrawler crawler;
graph_crawler_alloc(&crawler, &graph);
dBNode node = db_graph_find_str(&graph, graphseq[0]);
dBNode next_node = db_graph_find_str(&graph, graphseq[0]+1);
TASSERT(node.key != HASH_NOT_FOUND);
TASSERT(next_node.key != HASH_NOT_FOUND);
BinaryKmer bkey = db_node_get_bkmer(&graph, node.key);
Edges edges = db_node_get_edges(&graph, node.key, 0);
dBNode next_nodes[4];
Nucleotide next_nucs[4];
size_t i, p, num_next, next_idx;
num_next = db_graph_next_nodes(&graph, bkey, node.orient, edges,
next_nodes, next_nucs);
next_idx = 0;
while(next_idx < num_next && !db_nodes_are_equal(next_nodes[next_idx],next_node))
next_idx++;
TASSERT(next_idx < num_next && db_nodes_are_equal(next_nodes[next_idx],next_node));
// Crawl in all colours
graph_crawler_fetch(&crawler, node, next_nodes, next_idx, num_next,
NULL, graph.num_of_cols, NULL, NULL, NULL);
TASSERT2(crawler.num_paths == 2, "crawler.num_paths: %u", crawler.num_paths);
// Fetch paths
dBNodeBuffer nbuf;
db_node_buf_alloc(&nbuf, 16);
StrBuf sbuf;
strbuf_alloc(&sbuf, 128);
for(p = 0; p < crawler.num_paths; p++) {
db_node_buf_reset(&nbuf);
graph_crawler_get_path_nodes(&crawler, p, &nbuf);
strbuf_ensure_capacity(&sbuf, nbuf.len+graph.kmer_size);
sbuf.end = db_nodes_to_str(nbuf.b, nbuf.len, &graph, sbuf.b);
for(i = 0; i < 3 && strcmp(graphseq[i]+1,sbuf.b) != 0; i++) {}
TASSERT2(i < 3, "seq: %s", sbuf.b);
TASSERT2(sbuf.end == 75, "sbuf.end: %zu", sbuf.end);
TASSERT2(nbuf.len == 65, "nbuf.len: %zu", nbuf.len);
}
strbuf_dealloc(&sbuf);
db_node_buf_dealloc(&nbuf);
graph_crawler_dealloc(&crawler);
db_graph_dealloc(&graph);
}
// Walk the graph remembering the last time we met the ref
// When traversal fails, dump sequence up to last meeting with the ref
static void follow_break(BreakpointCaller *caller, dBNode node)
{
size_t i, j, k, num_next;
dBNode next_nodes[4];
Nucleotide next_nucs[4];
size_t nonref_idx[4], num_nonref_next = 0;
const dBGraph *db_graph = caller->db_graph;
BinaryKmer bkey = db_node_get_bkmer(db_graph, node.key);
Edges edges = db_node_get_edges(db_graph, node.key, 0);
num_next = db_graph_next_nodes(db_graph, bkey, node.orient, edges,
next_nodes, next_nucs);
// Filter out next nodes in the reference
for(i = 0; i < num_next; i++) {
if(kograph_num(caller->kograph, next_nodes[i].key) == 0) {
nonref_idx[num_nonref_next] = i;
num_nonref_next++;
}
}
// Abandon if all options are in ref or none are
if(num_nonref_next == num_next || num_nonref_next == 0) return;
// Follow all paths not in ref, in all colours
GraphCrawler *fw_crawler = &caller->crawlers[node.orient];
GraphCrawler *rv_crawler = &caller->crawlers[!node.orient];
dBNodeBuffer *allelebuf = &caller->allelebuf, *flank5pbuf = &caller->flank5pbuf;
GCMultiColPath *flank5p_multicolpath, *allele_multicolpath;
KOccurRun *flank5p_runs, *flank3p_runs;
size_t flank5p_pathid, allele_pathid;
size_t num_flank5p_runs, num_flank3p_runs;
// We fetch 5' flanks in all colours then merge matching paths
// we stop fetching a single path if it stops tracking the reference
// Alternatively, we could fetch the 5' flank in everyone and stop after a
// given distance, then check for that set of paths how much it tracks the
// reference. This has the advantage of scaling much better with number of
// samples, but not so well as min_ref_nkmers increases (since we fetch
// many flanks that can't be used) - I think this is less of a worry.
// Loop over possible next nodes at this junction
for(i = 0; i < num_nonref_next; i++)
{
size_t next_idx = nonref_idx[i];
// Go backwards to get 5p flank
traverse_5pflank(caller, rv_crawler, db_node_reverse(next_nodes[next_idx]),
db_node_reverse(node));
// Loop over the flanks we got
for(j = 0; j < rv_crawler->num_paths; j++)
{
// Get 5p flank
db_node_buf_reset(flank5pbuf);
graph_crawler_get_path_nodes(rv_crawler, j, flank5pbuf);
flank5p_multicolpath = &rv_crawler->multicol_paths[j];
flank5p_pathid = flank5p_multicolpath->pathid;
// Fetch 3pflank ref position
num_flank5p_runs = caller->flank5p_refs[flank5p_pathid].num_runs;
flank5p_runs = fetch_ref_contact(&rv_crawler->cache, flank5p_pathid,
caller->flank5p_refs,
&caller->flank5p_run_buf);
koruns_reverse(flank5p_runs, num_flank5p_runs, flank5pbuf->len);
koruns_sort_by_qoffset(flank5p_runs, num_flank5p_runs);
db_nodes_reverse_complement(flank5pbuf->data, flank5pbuf->len);
if(num_flank5p_runs > 0)
{
// Reset caller
kmer_run_buf_reset(&caller->koruns_3p);
kmer_run_buf_reset(&caller->koruns_3p_ended);
kmer_run_buf_reset(&caller->allele_run_buf);
// functions gcrawler_path_stop_at_ref_covg(),
// gcrawler_path_finish_ref_covg()
// both fill koruns_3p, koruns_3p_ended and allele_run_buf
// Only traverse in the colours we have a flank for
graph_crawler_fetch(fw_crawler, node,
next_nodes, next_nucs, next_idx, num_next,
flank5p_multicolpath->cols,
flank5p_multicolpath->num_cols,
gcrawler_path_stop_at_ref_covg,
gcrawler_path_finish_ref_covg,
caller);
// Assemble contigs - fetch forwards for each path for given 5p flank
for(k = 0; k < fw_crawler->num_paths; k++)
{
// Fetch nodes
db_node_buf_reset(allelebuf);
graph_crawler_get_path_nodes(fw_crawler, k, allelebuf);
ctx_assert(allelebuf->len > 0);
allele_multicolpath = &fw_crawler->multicol_paths[k];
allele_pathid = allele_multicolpath->pathid;
// Fetch 3pflank ref position
num_flank3p_runs = caller->allele_refs[allele_pathid].num_runs;
flank3p_runs = fetch_ref_contact(&fw_crawler->cache, allele_pathid,
caller->allele_refs,
&caller->allele_run_buf);
process_contig(caller,
allele_multicolpath->cols,
allele_multicolpath->num_cols,
flank5pbuf, allelebuf,
flank5p_runs, num_flank5p_runs,
flank3p_runs, num_flank3p_runs);
}
}
}
}
}
// `fork_node` is a node with outdegree > 1
void find_bubbles(BubbleCaller *caller, dBNode fork_node)
{
graph_cache_reset(&caller->cache);
const dBGraph *db_graph = caller->db_graph;
GraphCache *cache = &caller->cache;
GraphWalker *wlk = &caller->wlk;
RepeatWalker *rptwlk = &caller->rptwlk;
// char tmpstr[MAX_KMER_SIZE+3];
// db_node_to_str(db_graph, fork_node, tmpstr);
// status("Calling from %s", tmpstr);
dBNode nodes[4];
Nucleotide bases[4];
size_t i, num_next, num_edges_in_col;
BinaryKmer fork_bkmer = db_node_get_bkmer(db_graph, fork_node.key);
num_next = db_graph_next_nodes(db_graph, fork_bkmer, fork_node.orient,
db_node_edges(db_graph, fork_node.key, 0),
nodes, bases);
// loop over alleles, then colours
Colour colour, colours_loaded = db_graph->num_of_cols;
bool node_has_col[4];
uint32_t pathid;
for(colour = 0; colour < colours_loaded; colour++)
{
if(!db_node_has_col(db_graph, fork_node.key, colour)) continue;
// Determine if this fork is a fork in the current colour
num_edges_in_col = 0;
for(i = 0; i < num_next; i++) {
node_has_col[i] = (db_node_has_col(db_graph, nodes[i].key, colour) > 0);
num_edges_in_col += node_has_col[i];
}
graph_walker_setup(wlk, true, colour, colour, db_graph);
for(i = 0; i < num_next; i++)
{
if(node_has_col[i])
{
graph_walker_start(wlk, fork_node);
graph_walker_force(wlk, nodes[i], num_edges_in_col > 1);
pathid = graph_crawler_load_path_limit(cache, nodes[i], wlk, rptwlk,
caller->prefs.max_allele_len);
graph_walker_finish(wlk);
graph_crawler_reset_rpt_walker(rptwlk, cache, pathid);
}
}
}
// Set up 5p flank
caller->flank5p.b[0] = db_node_reverse(fork_node);
caller->flank5p.len = 0; // set to one to signify we haven't fetched flank yet
}
